Article pubs.acs.org/acssensors
Integration of Solution-Based Assays onto Lateral Flow Device for One-Step Quantitative Point-of-Care Diagnostics Using Personal Glucose Meter JingJing Zhang,† Zhe Shen,† Yu Xiang,†,‡ and Yi Lu*,† †
Department of Chemistry, University of Illinois at Urbana−Champaign, Urbana, Illinois 61801, United States Department of Chemistry, Tsinghua University, Beijing 100084, P.R. China
ACS Sens. 2016.1:1091-1096. Downloaded from pubs.acs.org by EASTERN KENTUCKY UNIV on 01/26/19. For personal use only.
‡
S Supporting Information *
ABSTRACT: The personal glucose meter (PGM) has been recently adapted as a novel point-of-care (POC) device for the detection of various targets. However, multistep target binding and enzymatic reactions in solution make it difficult for end users to use this technology for POC detection. To overcome this limitation, we report herein the integration of all assay procedures in solution onto a lateral flow device (LFD) by demonstrating competitive assays in a single step for quantitative detection of both a small molecule (cocaine) and a large protein (streptavidin) based on the glucose measured by PGMs. The LFD system demonstrated here simplifies the POC operation significantly and thus allows an even wider application of the PGM for POC diagnostics at home or in low-resource settings.
KEYWORDS: lateral flow, glucose meter, point-of-care, biosensors, aptamers
P
enzyme substrates that are covalently linked to glucose or is not transferable as a general strategy.24−26 Recently, Wang and coworkers integrated a microfluidic chip with PGM to develop a quantitative approach for detection of DNA using PGMs.27 Despite the progress, it is desirable to develop a much simpler and less expensive method for detecting not only DNA, but also a wide range of targets in a single step by users for selfdiagnostics at home. We herein report the integration of all the steps into a lateral flow device (LFD), similar to glucose strips, for quantitative POC analysis using PGM. The proposed PGMLFDs system combines the advantage of both PGMs and LFDs, offering a new way for point-of-care diagnostics in a lowresource setting. LFDs have been widely used for medical diagnostics, ranging from home testing for pregnancy and drugs of abuse to disease detection in low resource settings.28−35 It allows a single step operation with high speed, low operational cost, and simple instrumentation in a user-friendly format. The incorporation of chromatographic separation makes it possible to remove interferences and achieve high sensitivity.36−38 Despite these advantages, most of the LFD strips can achieve only qualitative or semiquantitative detection.39−41 To make LFD more quantitative, the LDF strips have been interfaced with portable devices, such as colorimeters.42−46 However, the colorimetric
oint-of-care (POC) diagnosis can facilitate the detection of diseases or monitoring biomarkers related to human health at home or in the field.1−6 To this end, various POC devices have been developed in recent years, among which the personal glucose meter (PGM) is the most widely used device in the world because of its portable size, easy operation, low cost, and reliable quantitative results.7 However, the traditional PGMs are designed to monitor only blood glucose levels.8 To overcome this challenge, Whitesides and co-workers have added more functionality to the basic PGMs by modifying the PGM strips by replacing the enzymes for glucose (e.g., glucose oxidase) with those enzymes selective for other target analytes (e.g., cholesterol, lactate, and alcohol).9 This approach, however, is still limited, as enzymes selective for every potential target may not be available and the modified strips can only be operated on a specific brand of PGMs. To broaden the applicability of PGMs, we and others have developed approaches to link the selective binding of nonglucose targets with aptamers, DNAzymes, or antibodies through conjugation of these DNAzyme/aptamer/antibodies with an enzyme such as invertase or amylase, which can catalyze the conversion of nonglucose analytes into glucose.10−23 While the results are encouraging, the majority of these systems involve multiple sequential steps, including affinity capture on a solid surface (e.g., magnetic materials), physical separation, and chemical or biochemical signal amplifications, making it less user-friendly for POC applications. Some progress has been made toward the use of PGMs for enzyme activity assay in a single step; however, it either requires sophisticated syntheses of the © 2016 American Chemical Society
Received: April 20, 2016 Accepted: August 8, 2016 Published: August 8, 2016 1091
DOI: 10.1021/acssensors.6b00270 ACS Sens. 2016, 1, 1091−1096
Article
ACS Sensors
Design and Preparation of Lateral Flow Strips. For all experiments, the Millipore High-Flow Plus Assembly Kit (Millipore Corporation, Bedford, MA) was used. The kit contains a High-Flow Plus Cellulose Ester Membrane with a nominal capillary flow time of 90 s/4 cm and a nominal membrane thickness of 135 μm directly cast onto 2 mil polyester backing and placed on an adhesive card. Each strip was cut from a pad and assembled according to the design using an office paper cutter. The detailed design of the strip was shown in Figure 1A. The length of the filter membrane along the flow direction
detection method is often vulnerable to interference from biofluids, including the color of blood or urine. Electrochemical detection used in PGM, on the other hand, is much less vulnerable to such intrusions and is more amenable to electronic amplification.
■
EXPERIMENTAL SECTION
Materials and Reagents. Streptavidin-coated magnetic beads (1 μm in diameter) and Amicon-10K/100K centrifugal filters were purchased from Bangs Laboratories Inc. (Fishers, IN) and Millipore Inc. (Billerica, MA), respectively. Streptavidin, EZ-Link NHS-PEG4Biotin, and sulfosuccinimidyl-4-(N-maleimidomethyl)-cyclohexane-1carboxylate (Sulfo-SMCC) were obtained from Pierce Inc. (Rockford, IL). Grade VII invertase from baker’s yeast (S. cerevisiae), tris(2carboxyethyl)phosphine (TCEP), sucrose, and other chemicals for buffers and solvents were purchased from Sigma-Aldrich, Inc. (St. Louis, MO). The commercial personal glucose meter used in this study was an ACCU-CHEK Avia. glucose meter, and the test of a solution by the meter was simply conducted by contacting the solution with the strip loaded on the glucose meter. Buffers used in this work are as follows: PBS Buffer: pH 7.3, 0.1 M sodium phosphate, 0.1 M NaCl, 0.05% Tween-20. DNA sequences used in the method were purchased from Integrated DNA Technologies, Inc. (Coralville, IA): from left to right: 5′ to 3′. Biotin-modified DNA (Biotin-DNA) for cocaine, and uranium sensors: TCACAGATGAGTAAAAAAAAAAAA-biotin. Thiol-modified DNA (Thiol-DNA) for cocaine and uranium sensors: HS-AAAAAAAAAAAAGTCTCCCGAGAT. Cocaine aptamer (Coc-Apt): TTTTTTACTCATCTGTGAATCTCGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC. DNA−Invertase Conjugation. The DNA−invertase conjugate was synthesized by the maleimide−thiol reaction using heterobifunctional linker sulfo-SMCC (Figure S1). Briefly, 30 μL of 1 mM thiolDNA, 2 μL of 1 M PBS buffer (pH 5.5), and 2 μL of 30 mM TCEP were mixed and incubated at room temperature for 1 h. Then, the thiol-DNA was purified by Amicon-10K using PBS buffer 8 times. For invertase conjugation, 400 μL of 20 mg mL−1 invertase in PBS buffer was mixed with 1 mg of sulfo-SMCC. After vortexing for 5 min, the solution was placed on a shaker for 1 h at room temperature. The mixture was then purified by Amicon-10K using PBS buffer 8 times. The purified solution of sulfo-SMCC-activated invertase was mixed with the above solution of thiol-DNA. The resulting solution was kept at room temperature for 48 h. To remove unreacted thiol-DNA, and the solution was purified by Amicon-30K 8 times using PBS buffer. The DNA−invertase conjugate was finally dispersed in PBS buffer at a concentration of 20 mg mL−1. Biotin−Invertase Conjugation. The biotin−invertase conjugate was synthesized by using the NHS-ester biotinylation reagent (Figure S3). Briefly, to 1 mL 20 mg mL−1 invertase in PBS buffer without Tween-20, 5 mg EZ-Link NHS-PEG4-Biotin was added and the mixture was mixed well at room temperature for 4 h. Then, the biotin−invertase conjugate was purified 8 times by Amicon-100 K using PBS buffer without Tween-20, and then dispersed in 1 mL of PBS Buffer with a final concentration of 2.0 mg mL−1 for preparation of lateral flow strips. Preparation of DNA−Invertase Conjugate Functionalized MBs. For the cocaine sensor, a portion of 1 mL 1 mg mL−1 solution of MBs was placed close to a magnetic rack for 1 min. The clear solution was discarded and replaced by 1 mL of PBS buffer. This buffer exchange procedure was repeated twice. Then, 12 μL 0.5 mM BiotinDNA was added to the MBs solution and mixed well for 30 min at room temperature. After that, the MBs were washed twice using PBS buffer to remove excess biotin-DNA. Later, 12 μL of 0.5 mM cocaine aptamer were added to the MB solution and mixed well for 30 min at room temperature. After triplicate washing using PBS buffer to remove excess DNA, 400 μL of 20 mg mL−1 DNA−invertase conjugate was added to the solution and mixed well at room temperature for 30 min. Excess DNA−invertase conjugate was washed off by PBS buffer three times. The DNA−invertase functionalized MBs were then dispersed in 1 mL of PBS Buffer for preparation of lateral flow strips.
Figure 1. (A) Design of disposable lateral flow strips. (B) Target detection using lateral flow strips. is 12.5 mm on the backing. To prepare the reaction pads, cellulose pads were spotted with 1 M sucrose water solution to ensure complete immersion and left at room temperature to dry overnight. After drying, reaction pads were cut into proper dimensions as mentioned in Figure S4 (12 mm length, 4 mm width). To prepare the sample pad for cocaine detection, cellulose pads (34 mm length, 4 mm width) previously assembled on the backing pad were spotted with 10 μL DNA−invertase conjugate functionalized MBs in PBS buffer and left at room temperature for 15 min to dry (Figure S3). To prepare the sample pad for streptavidin detection, cellulose pads (34 mm length, 4 mm width) previously assembled on the backing pad were spotted with 10 μL of 2.0 mg mL−1 biotin−invertase conjugate and 10 μL of 10 mg mL−1 streptavidin-coated MBs (molecular weight ratio, streptavidin/biotin >2:1), and then left at room temperature for 15 min to dry (Figure S4). The sample pad and reaction pad were attached to the adhesive card of the filter membrane in the way shown in Figure S4. The overlap for each pad was ∼3 mm, and the width was ∼4 mm cut by a paper cutter. Target Detection Using Lateral Flow Strips. For cocaine detection using LFDs integrated glucose meters, the LFDs coated with DNA−invertase conjugate functionalized MBs were dipped into 200 μL of sample solution containing different concentration of cocaine in 1.7 mL Eppendorf tubes (Figure 1B). The capillary effect of the sample pad would drive sample solution up along the filter membrane into the sucrose pad. After 30 min of reaction, the solution in the sucrose pad was squeezed out and applied to a portable glucometer to quantify the concentration of glucose. For streptavidin detection using LFD integrated glucose meters, the LFDs coated with biotin−invertase conjugate and streptavidin-coated MBs were dipped into 200 μL of sample solution containing different concentrations of streptavidin in 1.7 mL Eppendorf tubes (Figure 1B). The capillary effect of the sample pad would drive sample solution up along the filter membrane into the sucrose pad. After 20 min of reaction, the solution in the sucrose pad was squeezed out and applied to a portable glucometer to quantify the concentration of glucose.
■
RESULTS AND DISCUSSION Design and Principle of LFD-Based PGM Sensors. The LFD was prepared following the similar protocol reported previously by our lab, with slight modification.47 Briefly, it consists of three overlapping pads placed on a backing (from left to right): sample pad (34 mm), HiFlow Plus filter membrane (12.5 mm), and reaction pad (12 mm) (Figure 1A). The invertase-functionalized magnetic beads (MBs) were 1092
DOI: 10.1021/acssensors.6b00270 ACS Sens. 2016, 1, 1091−1096
Article
ACS Sensors
cocaine aptamer. This disassembly process was verified by fluorescence assays using FAM-labeled DNA−invertase conjugates, as the fluorescence intensity increased as a function of increasing cocaine concentration (Figure S2), indicating that the concentration of the target cocaine is proportional to the amount of DNA−invertase released to the solution. The released DNA−invertase conjugates were then transferred along the LFDs to the reaction pad by capillary action, and could convert sucrose into glucose in amounts proportionate with the concentrations of cocaine in the solutions (Figure 2B). The Hi-Flow nitrocellulose membrane prevented the MBs from traveling into the reaction pad and interfering with the assay results. At the end of this LFD operation, a PGM was used to quantify the concentrations of glucose in the reaction pad. As shown in Figure 2C, the PGM signal increased with the increasing concentration of cocaine in the samples, and a limit of detection (LOD) of 7.7 μM, well within the detection range of 0−300 μM cocaine, was achieved. This sensitivity is comparable to the commercial cocaine test kits, and previously reported LFDs-based cocaine sensors,47,50 but slightly worse than our previously reported in-tube based PGM assay for cocaine (LOD = 3.4 μM).10 The decreased sensitivity might be due to the loss of released DNA−invertase conjugate before traveling into the reaction pad. To evaluate the selectivity of the LFD-PGM system for cocaine detection, the LFD was dipped into a solution containing ADP, ATP, or Uridine. The PGM reading is much less than that in the presence of cocaine and is similar to that in just PBS buffer (as blank; Figure 2D). These results indicate that our LFD-PGM-system retained the aptamer selectivity with a highly specific response to the target, cocaine. As the cost of assembling such strips is very low (calculated to be at < $3 per test), the required time of reaction is short (2:1. The solution containing STV-biotinINV would further travel into the reaction pad, where the INV catalyzed the hydrolysis of sucrose into glucose in amounts that were proportional to the concentration of STV in the solution. A PGM was then used to quantify the concentrations of glucose in the reaction pad. As shown in Figure 3B, the presence of STV in the samples resulted in elevated glucose production, and the concentration
spotted on the specific position of the sample pad, and sucrose as the enzyme substrate was applied on the reaction pad (Figure 1A). The whole device was then dried at room temperature before use. When the sample pad of the device was dipped into a solution (Figure 1B), the solution would move up along the device and the target inside could transfer the invertase from the sample pad to the reaction pad where the sucrose would be hydrolyzed to glucose. Although the optimal temperature for sucrose to glucose conversion catalyzed by invertase from bakers’ yeast is 55 °C,19 we performed all the assays at room temperature to simplify our LFD-PGM sensor for practical application. Since the glucose produced had a direct relationship with the amount of invertase released, which depends on the concentration of target in sample solution, the concentration of the target could be quantified by monitoring the glucose using a PGM. Detection of Cocaine. To test the ability of the LFD-PGM system to detect a broad range of targets, we first investigated quantitative detection of cocaine as a representative target for testing new analytical techniques due to unmet diagnostic needs.48−50 To prepare the LFDs specific to cocaine, a DNA sandwich structure was assembled on MBs by connecting the DNA−invertase conjugate to a biotinylated capture DNA (biotin-DNA), through simultaneous hybridization with the cocaine aptamer (Figure 2A), and then deposited on the reagent pad. When the resulting LFD was dipped into a sample solution, the cocaine in the sample would cause the disassembly of the DNA sandwich structure to release DNA−invertase conjugate, due to the target-specific structure switching of the
Figure 2. (A) Cocaine-induced release of immobilized DNA− invertase conjugates from DNA−invertase conjugate functionalized magnetic beads (MBs). DNA−invertase conjugates are immobilized onto MBs by DNA hybridization with a cocaine aptamer and biotin− DNA. (B) Proof-of-concept competitive assay for the detection of cocaine by DNA−invertase conjugate functionalized MBs using a PGM integrated with a lateral flow dipstick. (C) Relationship between PGM signals and cocaine concentrations in the samples. (D) Selectivity of the proposed PGM-LFD system for cocaine detection. Concentrations of analytes were 200 μM. 1093
DOI: 10.1021/acssensors.6b00270 ACS Sens. 2016, 1, 1091−1096
Article
ACS Sensors
and is suitable for rapid diagnostics. Second, the wide availability, operation simplicity, high accuracy, and low cost of the pocket-sized PGMs to end users make this a simple but reliable tool for quantitative signal capture and collection. Moreover, as a variety of functional DNAs or antibodies for a broad range of targets are either available or can be obtained through SELEX,52,53 the method developed here can be used as a powerful tool for the detection of other targets, simply by changing specific molecular recognition elements on the LFD strips. These advantages, combined with FDA-approved PGM, can be interfaced with smartphones for wireless transmission of the data. We expect that the LFD-PGM system demonstrated here will become a promising alternative POC test system designed for low-resource settings.
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssensors.6b00270. Mechanism of DNA and invertase conjugation, fluorescence assay of cocaine, mechanism of biotin and invertase conjugation, scheme of assembly of a lateral flow device, and glucose meter response to invertase− biotin conjugate (PDF)
Figure 3. (A) Proof-of-concept competitive assay for the detection of streptavidin by streptavidin-coated MBs and invertase−biotin conjugates using a PGM integrated with a lateral flow dipstick. (B) Relationship between PGM signals and streptavidin concentrations in the samples.
of STV in the sample was dependent on the glucose concentration measured by PGMs, showing an approximately linear relationship within 0−1.25 μM until the signal gradually reached saturation at 2.5 μM. The detection limit was determined to be 0.2 μM based on a 3σb/slope, where σb is the standard deviation of three blank samples. To investigate the potential LOD achievable in principle, we performed an assay that directly measured the lowest level of invertase−biotin conjugate on the reaction pad of the LFDs. As shown in Figure S5, the LOD of invertase−biotin conjugate was calculated to be 50 nM. Therefore, the potential LOD for streptavidin in principle was calculated to be 12.5 nM, assuming the invertase release was 100% and each streptavidin could bind four invertase−biotin. This potential LOD is comparable to our previous in-tube based PGM assay for streptavidin (LOD of 4.0 nM), but much lower than the streptavidin assay on the proposed LFD-PGM format (LOD of 200 nM). This reduced sensitivity was due to the lower binding efficiency of streptavidin and biotin−invertase conjugate, as well as potential loss of the released biotin−invertase on the strips before moving into the reaction pad for sucrose to glucose conversion. In comparison with other detection methods, the distinct advantages of this proposed LFD-PGM system were low cost (∼$2.5 per test), short reaction time (∼20 min), and small sample volume (200 μL), which provides a facile, cost-effective on-site method of quantification of STV under low-resource settings.13,51
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We wish to thank Ms. Nitya Sai Reddy Satyavolu for help with proof-reading and the U.S. National Institutes of Health (1R41MH11133) for financial support.
■
REFERENCES
(1) Gong, M. M.; MacDonald, B. D.; Nguyen, T. V.; Van Nguyen, K.; Sinton, D. Lab-in-a-pen: a diagnostics format familiar to patients for low-resource settings. Lab Chip 2014, 14 (5), 957−963. (2) Choi, J. R.; Tang, R.; Wang, S.; Wan Abas, W. A.; PingguanMurphy, B.; Xu, F. Paper-based sample-to-answer molecular diagnostic platform for point-of-care diagnostics. Biosens. Bioelectron. 2015, 74, 427−439. (3) Mace, C. R.; Deraney, R. N. Manufacturing prototypes for paperbased diagnostic devices. Microfluid. Nanofluid. 2014, 16 (5), 801−809. (4) Song, Y.; Huang, Y. Y.; Liu, X.; Zhang, X.; Ferrari, M.; Qin, L. Point-of-care technologies for molecular diagnostics using a drop of blood. Trends Biotechnol. 2014, 32 (3), 132−139. (5) Zhao, Y.; Du, D.; Lin, Y. Glucose encapsulating liposome for signal amplification for quantitative detection of biomarkers with glucometer readout. Biosens. Bioelectron. 2015, 72, 348−354. (6) Chen, Z. X.; Li, J. J.; Chen, X. Q.; Cao, J. T.; Zhang, J. R.; Min, Q. H.; Zhu, J. J. Single Gold@Silver Nanoprobes for Real-Time Tracing the Entire Autophagy Process at Single-Cell Level. J. Am. Chem. Soc. 2015, 137 (5), 1903−1908. (7) Montagnana, M.; Caputo, M.; Giavarina, D.; Lippi, G. Overview on self-monitoring of blood glucose. Clin. Chim. Acta 2009, 402 (1− 2), 7−13. (8) Clarke, S. F.; Foster, J. R. A history of blood glucose meters and their role in self-monitoring of diabetes mellitus. Br. J. Biomed. Sci. 2012, 69 (2), 83−93.
■
CONCLUSIONS We have developed a simple and general quantitative POC diagnostic system by integrating target recognition by DNA aptamer or biotin-STV with LFD for sample processing, and PGM for signal readout. This LFD-PGM system allows inexpensive, rapid, portable, and quantitative detection of a wide range of targets in a single step, thereby offering several advantages. First, compared with previous PGM-based sensors, the employment of LFDs helps to improve and simplify the sample testing, decrease the total sample-to-answer assay time, 1094
DOI: 10.1021/acssensors.6b00270 ACS Sens. 2016, 1, 1091−1096
Article
ACS Sensors (9) Nie, Z.; Deiss, F.; Liu, X.; Akbulut, O.; Whitesides, G. M. Integration of paper-based microfluidic devices with commercial electrochemical readers. Lab Chip 2010, 10 (22), 3163−3169. (10) Xiang, Y.; Lu, Y. Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets. Nat. Chem. 2011, 3 (9), 697−703. (11) Su, J.; Xu, J.; Chen, Y.; Xiang, Y.; Yuan, R.; Chai, Y. Personal glucose sensor for point-of-care early cancer diagnosis. Chem. Commun. 2012, 48 (55), 6909−6911. (12) Xiang, Y.; Lu, Y. Using Commercially Available Personal Glucose Meters for Portable Quantification of DNA. Anal. Chem. 2012, 84 (4), 1975−1980. (13) Xiang, Y.; Lu, Y. Portable and quantitative detection of protein biomarkers and small molecular toxins using antibodies and ubiquitous personal glucose meters. Anal. Chem. 2012, 84 (9), 4174−4178. (14) Yan, L.; Zhu, Z.; Zou, Y.; Huang, Y.; Liu, D.; Jia, S.; Xu, D.; Wu, M.; Zhou, Y.; Zhou, S.; Yang, C. J. Target-responsive ″sweet″ hydrogel with glucometer readout for portable and quantitative detection of non-glucose targets. J. Am. Chem. Soc. 2013, 135 (10), 3748−3751. (15) Chen, J.; Wu, W.; Zeng, L. A universal glucometer-based biosensor for portable and quantitative detection of transcription factors. Anal. Methods 2014, 6 (13), 4840. (16) Ma, X.; Chen, Z.; Zhou, J.; Weng, W.; Zheng, O.; Lin, Z.; Guo, L.; Qiu, B.; Chen, G. Aptamer-based portable biosensor for plateletderived growth factor-BB (PDGF-BB) with personal glucose meter readout. Biosens. Bioelectron. 2014, 55, 412−416. (17) Tang, D.; Lin, Y.; Zhou, Q.; Lin, Y.; Li, P.; Niessner, R.; Knopp, D. Low-cost and highly sensitive immunosensing platform for aflatoxins using one-step competitive displacement reaction mode and portable glucometer-based detection. Anal. Chem. 2014, 86 (22), 11451−11458. (18) Xue-tao, X.; Kai-yi, L.; Jia-ying, Z. Portable and sensitive quantitative detection of DNA using personal glucose meters and exonuclease III-assisted signal amplification. Analyst 2014, 139 (19), 4982−4986. (19) Du, Y.; Hughes, R. A.; Bhadra, S.; Jiang, Y. S.; Ellington, A. D.; Li, B. A Sweet Spot for Molecular Diagnostics: Coupling Isothermal Amplification and Strand Exchange Circuits to Glucometers. Sci. Rep. 2015, 5, 11039. (20) Gu, C.; Lan, T.; Shi, H.; Lu, Y. Portable Detection of Melamine in Milk Using a Personal Glucose Meter Based on an in Vitro Selected Structure-Switching Aptamer. Anal. Chem. 2015, 87 (15), 7676−7682. (21) Wang, Z.; Chen, Z.; Gao, N.; Ren, J.; Qu, X. Transmutation of Personal Glucose Meters into Portable and Highly Sensitive Microbial Pathogen Detection Platform. Small 2015, 11, 4970. (22) Xu, X. T.; Liang, K. Y.; Zeng, J. Y. Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction. Biosens. Bioelectron. 2015, 64, 671−675. (23) Wang, W. J.; Huang, S.; Li, J. J.; Rui, K.; Zhang, J. R.; Zhu, J. J. Coupling a DNA-Based Machine with Glucometer Readouts for Amplified Detection of Telomerase Activity in Cancer Cells. Sci. Rep. 2016, 6, 23504. (24) Mohapatra, H.; Phillips, S. T. Reagents and assay strategies for quantifying active enzyme analytes using a personal glucose meter. Chem. Commun. 2013, 49 (55), 6134−6136. (25) Wang, Q.; Wang, H.; Yang, X.; Wang, K.; Liu, R.; Li, Q.; Ou, J. A sensitive one-step method for quantitative detection of alphaamylase in serum and urine using a personal glucose meter. Analyst 2015, 140 (4), 1161−1165. (26) Yang, W.; Lu, X.; Wang, Y.; Sun, S.; Liu, C.; Li, Z. Portable and sensitive detection of protein kinase activity by using commercial personal glucose meter. Sens. Actuators, B 2015, 210, 508−512. (27) Wang, Q.; Wang, H.; Yang, X.; Wang, K.; Liu, F.; Zhao, Q.; Liu, P.; Liu, R. Multiplex detection of nucleic acids using a low cost microfluidic chip and a personal glucose meter at the point-of-care. Chem. Commun. 2014, 50 (29), 3824−3826.
(28) Liu, H.; Crooks, R. M. Paper-based electrochemical sensing platform with integral battery and electrochromic read-out. Anal. Chem. 2012, 84 (5), 2528−2532. (29) Liu, H.; Xiang, Y.; Lu, Y.; Crooks, R. M. Aptamer-based origami paper analytical device for electrochemical detection of adenosine. Angew. Chem., Int. Ed. 2012, 51 (28), 6925−6928. (30) Yang, X.; Forouzan, O.; Brown, T. P.; Shevkoplyas, S. S. Integrated separation of blood plasma from whole blood for microfluidic paper-based analytical devices. Lab Chip 2012, 12 (2), 274−280. (31) Roskos, K.; Hickerson, A. I.; Lu, H. W.; Ferguson, T. M.; Shinde, D. N.; Klaue, Y.; Niemz, A. Simple system for isothermal DNA amplification coupled to lateral flow detection. PLoS One 2013, 8 (7), e69355. (32) Pohlmann, C.; Dieser, I.; Sprinzl, M. A lateral flow assay for identification of Escherichia coli by ribosomal RNA hybridisation. Analyst 2014, 139 (5), 1063−1071. (33) Lee, J. H.; Seo, H. S.; Kwon, J. H.; Kim, H. T.; Kwon, K. C.; Sim, S. J.; Cha, Y. J.; Lee, J. Multiplex diagnosis of viral infectious diseases (AIDS, hepatitis C, and hepatitis A) based on point of care lateral flow assay using engineered proteinticles. Biosens. Bioelectron. 2015, 69, 213−225. (34) Liu, Y.; Wu, A.; Hu, J.; Lin, M.; Wen, M.; Zhang, X.; Xu, C.; Hu, X.; Zhong, J.; Jiao, L.; Xie, Y.; Zhang, C.; Yu, X.; Liang, Y.; Liu, X. Detection of 3-phenoxybenzoic acid in river water with a colloidal gold-based lateral flow immunoassay. Anal. Biochem. 2015, 483, 7−11. (35) Rodriguez, N. M.; Linnes, J. C.; Fan, A.; Ellenson, C. K.; Pollock, N. R.; Klapperich, C. M. Paper-Based RNA Extraction, in Situ Isothermal Amplification, and Lateral Flow Detection for Low-Cost, Rapid Diagnosis of Influenza A (H1N1) from Clinical Specimens. Anal. Chem. 2015, 87 (15), 7872−7879. (36) Mark, D.; Haeberle, S.; Roth, G.; von Stetten, F.; Zengerle, R. Microfluidic lab-on-a-chip platforms: requirements, characteristics and applications. Chem. Soc. Rev. 2010, 39 (3), 1153−1182. (37) Yetisen, A. K.; Akram, M. S.; Lowe, C. R. Paper-based microfluidic point-of-care diagnostic devices. Lab Chip 2013, 13 (12), 2210−2251. (38) Quesada-Gonzalez, D.; Merkoci, A. Nanoparticle-based lateral flow biosensors. Biosens. Bioelectron. 2015, 73, 47−63. (39) Fang, Z.; Huang, J.; Lie, P.; Xiao, Z.; Ouyang, C.; Wu, Q.; Wu, Y.; Liu, G.; Zeng, L. Lateral flow nucleic acid biosensor for Cu2+ detection in aqueous solution with high sensitivity and selectivity. Chem. Commun. 2010, 46 (47), 9043−9045. (40) Luckham, R. E.; Brennan, J. D. Bioactive paper dipstick sensors for acetylcholinesterase inhibitors based on sol-gel/enzyme/gold nanoparticle composites. Analyst 2010, 135 (8), 2028−2035. (41) Lie, P.; Liu, J.; Fang, Z.; Dun, B.; Zeng, L. A lateral flow biosensor for detection of nucleic acids with high sensitivity and selectivity. Chem. Commun. 2012, 48 (2), 236−238. (42) Chen, C.; Wu, J. A fast and sensitive quantitative lateral flow immunoassay for Cry1Ab based on a novel signal amplification conjugate. Sensors 2012, 12 (9), 11684−11696. (43) Zhu, X.; Shah, P.; Stoff, S.; Liu, H.; Li, C. Z. A paper electrode integrated lateral flow immunosensor for quantitative analysis of oxidative stress induced DNA damage. Analyst 2014, 139 (11), 2850− 2857. (44) Schramm, E. C.; Staten, N. R.; Zhang, Z.; Bruce, S. S.; Kellner, C.; Atkinson, J. P.; Kyttaris, V. C.; Tsokos, G. C.; Petri, M.; Sander Connolly, E.; Olson, P. K. A quantitative lateral flow assay to detect complement activation in blood. Anal. Biochem. 2015, 477, 78−85. (45) Yu, L.; Shi, Z.; Fang, C.; Zhang, Y.; Liu, Y.; Li, C. Disposable lateral flow-through strip for smartphone-camera to quantitatively detect alkaline phosphatase activity in milk. Biosens. Bioelectron. 2015, 69, 307−315. (46) Zangheri, M.; Cevenini, L.; Anfossi, L.; Baggiani, C.; Simoni, P.; Di Nardo, F.; Roda, A. A simple and compact smartphone accessory for quantitative chemiluminescence-based lateral flow immunoassay for salivary cortisol detection. Biosens. Bioelectron. 2015, 64, 63−68. 1095
DOI: 10.1021/acssensors.6b00270 ACS Sens. 2016, 1, 1091−1096
Article
ACS Sensors (47) Liu, J.; Mazumdar, D.; Lu, Y. A simple and sensitive ″dipstick″ test in serum based on lateral flow separation of aptamer-linked nanostructures. Angew. Chem., Int. Ed. 2006, 45 (47), 7955−7959. (48) Qiu, L.; Zhou, H.; Zhu, W. P.; Qiu, L. P.; Jiang, J. H.; Shen, G. L.; Yu, R. Q. A novel label-free fluorescence aptamer-based sensor method for cocaine detection based on isothermal circular stranddisplacement amplification and graphene oxide absorption. New J. Chem. 2013, 37 (12), 3998−4003. (49) Zhu, Z.; Guan, Z.; Jia, S.; Lei, Z.; Lin, S.; Zhang, H.; Ma, Y.; Tian, Z. Q.; Yang, C. J. Au@Pt nanoparticle encapsulated targetresponsive hydrogel with volumetric bar-chart chip readout for quantitative point-of-care testing. Angew. Chem., Int. Ed. 2014, 53 (46), 12503−12507. (50) Zhou, Z.; Xiang, Y.; Tong, A.; Lu, Y. Simple and efficient method to purify DNA-protein conjugates and its sensing applications. Anal. Chem. 2014, 86 (8), 3869−3875. (51) Pu, Q. S.; Elazazy, M. S.; Alvarez, J. C. Label-free detection of heparin, streptavidin, and other probes by pulsed streaming potentials in plastic microfluidic channels. Anal. Chem. 2008, 80 (17), 6532− 6536. (52) Zhu, G.; Zhang, C.-y. Functional nucleic acid-based sensors for heavy metal ion assays. Analyst 2014, 139 (24), 6326−6342. (53) Chen, A. L.; Yang, S. M. Replacing antibodies with aptamers in lateral flow immunoassay. Biosens. Bioelectron. 2015, 71, 230−242.
1096
DOI: 10.1021/acssensors.6b00270 ACS Sens. 2016, 1, 1091−1096
