Intracellular delivery of human purine nucleoside phosphorylase by

Subscriber access provided by University of South Dakota

Article

Intracellular delivery of human purine nucleoside phosphorylase by engineered diphtheria toxin rescues function in target cells Minyoung Park, Xiaobai Xu, Weixan Min, Seiji N. Sugiman-Marangos, Greg L. Beilhartz, Jarrett J. Adams, Sachdev S. Sidhu, Eyal Grunebaum, and Roman A. Melnyk Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.8b00735 • Publication Date (Web): 13 Sep 2018 Downloaded from http://pubs.acs.org on September 14, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

72x73mm (300 x 300 DPI)

ACS Paragon Plus Environment

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 33

Intracellular delivery of human purine nucleoside phosphorylase by engineered diphtheria toxin rescues function in target cells

Minyoung Parka,b, Xiaobai Xuc, Weixian Minc, Seiji N. Sugiman-Marangosb, Greg L. Beilhartzb, Jarret J. Adamse, Sachdev S. Sidhue,f, Eyal Grunebaumc,d, Roman A. Melnyka,b,*

a

Department of Biochemistry, University of Toronto, Toronto, ON, Canada; bMolecular Medicine Program, The Hospital for Sick Children Research Institute, Toronto, ON, Canada; c

Developmental and Stem Cell Biology Program, The Hospital for Sick Children Research

Institute, Toronto, ON, Canada; dDivision of Immunology and Allergy, The Hospital for Sick Children, Toronto, ON, Canada; eBanting and Best Department of Medical Research, Terrence Donnelly Center for Cellular and Biomolecular Research, University of Toronto, Toronto, ON, Canada; fDepartment of Molecular Genetics, University of Toronto, Toronto, ON, Canada

*Correspondence should be addressed to R.A.M: Roman Melnyk | 686 Bay Street, Toronto, ON, M5G 0A4| [email protected] | Tel: (416) 813-7654 x328557 | Fax: (416) 813-5022

Short title: Intracellular delivery of a human cytosolic enzyme


1

Page 3 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract Despite a wealth of potential applications inside target cells, protein-based therapeutics are largely limited to extracellular targets due to the inability of proteins to readily cross biological membranes and enter the cytosol. Bacterial toxins, which deliver a cytotoxic enzyme into cells as part of their intoxication mechanism, hold great potential as platforms for delivering therapeutic protein cargo into cells. Diphtheria toxin (DT) has been shown to be capable of delivering an array of model proteins of varying sizes, structures and stabilities into mammalian cells as amino-terminal fusions. Here, seeking to expand the utility of DT as a delivery vector, we asked whether an active human enzyme, purine nucleoside phosphorylase (PNP), could be delivered by DT into cells to rescue PNP deficiency. Using a series of biochemical and cellular readouts, we demonstrate that PNP is efficiently delivered into target cells in a receptor- and translocation-dependent manner. In patient-derived PNP-deficient lymphocytes and pluripotent stem cell-differentiated neurons, we show that human PNP is efficiently translocated into target cells by DT, where it is able to restore intracellular hypoxanthine levels. Further, through replacement of the native receptor-binding moiety of DT with single-chain variable fragments that were selected to bind mouse HBEGF, we show that PNP can be retargeted into mouse splenocytes from PNP-deficient mice resulting in restoration of proliferative capacity of T cells. These findings highlight the versatility of the DT delivery platform and provide an attractive approach for the delivery PNP as well as other cytosolic enzymes implicated in disease.

KEYWORDS: Intracellular Delivery; translocation; enzyme replacement; toxin delivery


2


Page 4 of 33

Introduction Since the approval of recombinant human insulin in the early 1980s, protein-based therapeutics have dramatically increased both in number and clinical use1. Currently, therapeutic proteins and peptides comprise ~85% of the FDA approved biologics2. Despite this dramatic expansion, however, the full potential of protein-based therapeutics as drugs has still not been reached mainly because these protein-based therapeutics cannot cross biological membranes and enter cells to target intracellular biomolecules. As such, approximately 60% of all human proteins remain inaccessible to protein-based drugs3. Successful delivery of proteinbased drugs into cells would transform all areas of medicine as it provides novel approaches to, for example, manipulate signaling pathways4, stabilize or disrupt protein-protein interactions and modulate transcription factors that are notoriously difficult to target with small molecules5-6. Moreover, effective in vivo protein delivery would provide therapeutic replacement of missing, defective or poorly expressed proteins. To date, several vectors for intracellular protein delivery into cells have been described, however, few if any are simultaneously efficient, safe, versatile and specific. Bacterial toxins with intracellular sites-of-action are promising systems to consider as delivery platforms as they have evolved sophisticated mechanisms of delivering proteins across membranes and into specific cells. We previously developed a bacterial toxin-based protein delivery system using diphtheria toxin (DT) and showed that DT efficiently translocates diverse model cargo proteins spanning a range of sizes, structures and stabilities into cells in a receptor-specific manner7. Here, we expand the application of the DT-based delivery platform to deliver a human enzyme implicated in a disease as a potential therapeutic approach for enzyme replacement therapy. Purine nucleoside phosphorylase (PNP) is an intracellular ubiquitous enzyme essential for purine metabolism. Inherited mutations in the PNP gene interfere with the production and function of PNP, preventing the degradation of purine nucleosides, (deoxy)inosine and


3

Page 5 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(deoxy)guanosine, to the corresponding purine bases and ribose-1-phosphate8. The accumulating deoxyguanosine is phosphorylated to deoxyguanosine triphosphate, which interferes with DNA synthesis and repair, resulting in increased apoptosis of thymocytes and subsequently severe immune dysfunction9-10. In PNP-deficient patients, reduced hypoxanthine levels and abnormal response of T lymphocytes to stimulation are found9. Individuals with PNPdeficiency therefore exhibit both metabolic and immune abnormalities, rendering them very susceptible to infections, often resulting in early death in childhood9, 11. Previous studies of PNP deficiency suggest that introducing functional enzyme into cells via hematopoietic stem cells transplantations (HSCT) or transfusions with allogeneic red blood cells, which are rich in PNP, leads to improvements in metabolic and immune functions, indicating that enzyme replacement therapy may be helpful12. However, frequent transfusions were associated with iron accumulation in the liver and only temporary improvement, while the outcomes of HSCT have been disappointing. Therefore, currently, there are no effective treatments available for PNPdeficient patients. By using our previously developed DT delivery platform, we set out in this study to investigate the capability of DT to deliver human PNP into cells and restore defective function. DT is a single-chain polypeptide, composed of three domains, an enzymatically active domain (dtA), a translocation domain (dtT) and a receptor-binding domain (dtR)13 (Fig. 1). Intoxication of target cells begins with the dtR domain binding the heparin-binding epidermal growth factor-like growth factor (HB-EGF; also known as the diphtheria toxin receptor)14, triggering endocytosis into clathrin-coated vesicles, which are then converted into early endosomal vesicles15. Upon exposure to low pH in the endosome, the translocation domain (dtT) undergoes a conformational change and inserts into the endosomal membrane, creating a transmembrane pore that facilitates translocation of the catalytic dtA domain into the cytosol16-22. Once in the cytosol, the dtA domain catalyzes the transfer of the ADP-ribose moiety of NAD+ to eukaryotic elongation factor (eEF-2), which inhibits protein synthesis and ultimately leads to cell death23-24.


4


Page 6 of 33

The toxicity of the dtA domain can be completely abolished by introducing two point mutations, K51E/E148K25, which we refer to here as dta. In this study, we genetically fused PNP to the amino-terminus of both catalytically active dtA (i.e., PNP-dtA-dtT-dtR) and catalytically inactive dta (i.e. PNP-dta-dtT-dtR) and used a number of different techniques to demonstrate cytosolic delivery (Fig. 1). The data presented here demonstrate the versatility, efficiency and robustness of the DT translocation system in restoring missing functionality through targeted intracellular delivery of a human enzyme for the first time.


5

Page 7 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Methods Generation of PNP-DT Chimera DT plasmid carrying the E148S mutation was a kind gift from Dr. R. John Collier (Harvard Medical School, Boston, MA). Point mutations were made in the DT E148S plasmid using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies) to prepare wtDT (E148) and catalytically inactive DT (K51E/E148K). DNA sequence corresponding to human PNP (NM_000270) was amplified using primers and fused to different DT variants using the InFusion HDs Cloning Kit (Clontech) and the products were cloned into the Champion pET-SUMO expression system (Invitrogen). The SUMO tag in the expression vector was genetically removed and the StrepTagII tag was inserted.

Expression and Purification of PNP-DT Fusion Protein Different DT variants fused to PNP (PNP-dta-dtT-dtR, PNP-dtA-dtT-dtR, dtA-PNP-dta-dtT-dtR, and PNP-dta-dtT-scFv08-scFv08) and PNP alone without the DT fusion were expressed as Nterminal His6-tagged and C-terminal StrepTagII-tagged proteins in E. coli NiCo21(DE3) cells, induced with 1 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) for 4 h at 24 °C. Cells were harvested by centrifugation, resuspended in lysis buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole, benzonase, lysozyme, and protease inhibitor cocktail) and lysed by an EmulsifiFlex C3 microfluidizer (Avestin) at 15,000 psi. The lysates were centrifuged at 18,000 x g for 20 min. His6- and StrepTagII-tagged proteins were purified by nickel affinity chromatography followed by Strep-Tactin® affinity chromatography using HisTrap Crude FF and StrepTrap HP columns (GE Healthcare), respectively. Proteins were concentrated using spin concentrators (Corning) and glycerol was added to 10% v/v. The protein concentrations were determined by NanoPhotometer® Pearl (Montreal Biotech Inc.) and stored at -80 °C.

Generation of a Stable NlucP Expressing Vero and NIH3T3 Cells


6


Page 8 of 33

Vero cells and mouse embryonic fibroblasts (NIH3T3) were plated in a 6-well plate and transduced with lentivirus containing the ORF for NanoLuc-PEST (NlucP) luciferase under the control of a CMV promoter and the puromycin resistance gene for antibiotic selection. Production and transduction of lentivirus was performed by the SPARC lentiviral core facility (Toronto, Canada). Following transduction, the cells were incubated for 24 h and then transferred to a 10 cm cell culture dish followed by an additional 24 h of incubation. To select for cells containing NlucP luciferase as a stable integration in the host genome, the cells were subjected to the puromycin antibiotic. Stable NlucP expressing clones were subsequently isolated from the puromycin-resistant pool by limiting dilution followed by testing of individual clones for Nluc activity. The selected Nluc clones (Vero NlucP and NIH3T3 NlucP) were expanded and maintained in DMEM growth medium supplemented with 10% FBS and 1% penicillin/streptomycin.

Cellular DTA Intoxication Assay Protein synthesis inhibition assay was used to measure the ability of PNP-DT chimera to deliver dtA to the cytosol. Vero NlucP cells (6000 cells per well in a 96-well plate) were exposed to three-fold serial dilutions of PNP-DT fusion constructs. The cells were incubated with the toxin overnight (17 h) at 37 °C. The next day, toxin-containing medium was removed, the cells were incubated with equal volume of fresh medium and Nano-Glo® Luciferase Assay Reagent (Promega). Luminescence was recorded on a SpectraMax M5e plate reader (Molecular Devices) with an integration time of 750 ms. Results were analyzed with SoftMax Pro 6.2.2. and GraphPad Prism 7.0. Protein synthesis competition experiments were performed as described above but a fixed concentration (500 nM) of a non-toxic variant of DT (dta-dtT-dtR) was also added to cells to compete with the toxic DT variant, which was added to cells using a three-fold serial dilution pattern with a starting concentration of 10 nM. The bafilomycin A1 treatment experiments were performed by incubating Vero NlucP cells with and without 0.4 µM


7

Page 9 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bafilomycin A1 for 30 min, followed by adding 200nM PNP-DT to cells and incubating for an additional 3 h and 30 min. The toxin-containing medium was removed, and the protein synthesis inhibition was determined as described above using the Nano-Glo® Luciferase Assay Reagent.

PNP-deficient cells EBV-transformed B lymphocytes from a PNP-deficient patient was a kind gift from Dr. Eyal Grunebaum. The cells were maintained in RPMI 1640, 10% FBS, 1% penicillin/streptomycin media. T lymphocytes were isolated from the spleen of 4-5 week old PNP-deficient (PNP-/-) and/or normal (PNP+/-) mice10. The Institutional Research and Ethics Committee approved all procedures and experiments.

PNP Enzyme Activity PNP enzymatic activities of purified PNP-DT fusion constructs and PNP protein alone were determined using the Purine Nucleoside Phosphorylase Activity Assay Kit Fluorometric (Abcam, ab204706).

Western Blotting A total of 3 x 105 treated PNP-deficient B lymphocytes were washed with PBS, then resuspended in 90 µl of 1X RIPA buffer (Abcam, ab156034). Thirty microliters of lysate were separated by SDS-PAGE and transferred to nitrocellulose (Amersham) using the Bio Rad Trans-Blot Turbo system. Nitrocellulose membranes were blocked overnight at 4 °C in 5% (w/v) powdered milk diluted in Tris-buffered saline (TBS). Immunodetection of proteins was conducted using primary anti-PNP antibody (rabbit pAb 1:1,000) generated by the Grunebaum laboratory and secondary anti-rabbit antibody conjugated to horseradish peroxidase (NA934V GE Healthcare, 1:5,000). SuperSignal West Femto chemiluminescenet reagents (Thermo Scientific) were used. For detection of tubulin-loading controls from the same nitrocellulose


8


Page 10 of 33

membrane, membranes were washed in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 10 min and then stripped of antibody by washing the membrane for 10 min with stripping buffer (Thermo Scientific #46430). After two more 10-min washes with TBS-T, the membrane was re-probed for tubulin using anti-tubulin antibody (Thermo Scientific, 1:5,000) and antimouse antibody (NXA931V, GE Healthcare, 1:5,000).

Mass Spectrometry-based Hypoxanthine Detection Hypoxanthine extraction from samples and operation of mass spectrometry were performed by the Analytical Facility for Bioactive Molecules (The Hospital for Sick Children, Toronto). Briefly, a total of 3 x 105 treated PNP-deficient B lymphocytes or PNP-deficient, iPSC neurons were washed with PBS and centrifuged at 200 x g for 5 mins at 4 °C. Ultra-pure water was added to cell pellets and sonicated for 1 min on ice using a 550 sonic dismembrator (Fisher Scientific). 20 ng of hypoxanthine-d4 was added to each sample to serve as an internal standard. A standard curve using 0.1 to 100 ng hypoxanthine was prepared in the same conditions. Hypoxanthine from the samples was extracted with methanol, followed by centrifugation at 20,000 x g for 10 min at 4 °C. Supernatants were dried under nitrogen gas and reconstituted in 0.2% formic acid in water. The products were then submitted to LC-MS-MS analysis. Mass spectrometry analyses were performed on an API 4000 triple-quadruple mass spectrometer (Applied Biosystems/MDS SCIEX, Concord, ON) coupled with electrospray ionization (ESI) interface operated in the multiple-reaction monitoring positive mode using nitrogen as sheath gas. The Analyst 1.6 software package (Applied Biosystems/MDS SCIEX) was used for quantification of hypoxanthine levels in samples.

CFSE-based T Cell Proliferation Assay Cells (2 x 105), isolated from the spleen of PNP-/- or PNP+/- littermates were stimulated with 1% v/v PHA (ThermoFisher Cat. 10576015), with or without 20 nM PNP-dta-dtT-scFv08-scFv08, in


9

Page 11 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the presence of 5ng/ml of CFSE (BD Horizon). Cells were harvested after 4 days and CFSE content in cells was detected by flow cytometry using CytoFlex (Beckman Coulter). FlowJo v 10.3 (Treestar) was used to analyze the results and to generate the proliferation index, which is the average number of divisions of responding cells. A paired T test was used to determine the statistical significance of proliferation index between the PNP-dta-dtT-scFv08-scFv08 treated cells and the negative and positive controls. “Negative” and “Positive” controls were cells from PNP-/- and PNP+/- mice, respectively, stimulated with phytohemagglutinin (PHA).

Differentiation of human iPSCs to neurons EBV-transformed lymphocytes from a PNP-deficient patient and healthy controls were used to generate iPSC lines by the Canadian Center for Regenerative Medicine (Toronto, Ontario) using Sendai viruses, as described previously 26. PNP deficiency in the cells was confirmed by demonstrating less than 1% activity, determined by conversion of [8-14C]inosine (50 mCi/mmol; Moravek Biochemicals, Brea, CA, U.S.A.) to hypoxanthine using cellulose TLC, as described previously 27. Differentiation of iPSC through the formation of embryoid bodies was achieved by dissociating iPSC and plating 2 × 106 cells/well in Aggrewell 800 plates (STEMCELL technologies, Vancouver, BC). After 4 days, embryoid bodies were dissociated and plated onto Laminin and Poly-L-ornithine coated 6-well plates for additional 7 days. Following formation of neural rosette, rosettes were detached using STEMdiff Neural Rosette Selection Reagent (STEMCELL) and plated onto Laminin and Poly-L-ornithine coated plates at a minimum density of 2 × 106 cells/well. The neural progenitor cells were then cultured to passage 3 and differentiated into neurons by plating 1 × 105 cells/well into chamber-slides. STEMdiff Neural Induction Medium (STEMCELL), which is serum free and devoid of PNP activity was utilized throughout the entire differentiation.

Generation of scFv08-scFv08 that targets rodent HBEGF


10


Page 12 of 33

Recombinant, untagged human (ProSpec CTY-119) and mouse (ProSpec CYT-068) HBEGF protein and human and mouse HBEGF-SUMO protein chimeras were used as antigens in Fabphage selections with Library F 28 using our standard selection protocol 29. After four rounds of selection, 95 colonies were tested for binding specificity to HBEGF by phage ELISA 30. Positive colonies were sequenced, and unique Fab-phage clones were sub-cloned into single chain variable fragment (scFv) expression vectors. Briefly, VL and VH gene segments amplified from selected phagemids were fused in order to produce a single open reading by the addition the linker 5’ GGTACTACTGCCGCTAGTGGTAGTAGTGGTGGCAGTAGCAGTGGTGCC ‘3. The VL and VH fusions were cloned alone or tandem in frame into the Champion pET-SUMO vector downstream of the DNA sequences corresponding to dtA-dtT to produce chimeric constructs, dtA-dtT-VL-VH or dtA-dtT-VL-VH-VL-VH, using In-fusion HD cloning kit (Clontech). Similarly, the tandem repeats of VL-VH were cloned in frame into the DNA sequences corresponding to PNPdta-dtT to produce PNP-dta-dtT-VL-VH-VL-VH (i.e., PNP-dta-dtT-scFv08-scFv08). Sequences of scFv08 VL and VH are as follows: VL = GATATCCAGATGACCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACC ATCACCTGCCGTGCCAGTCAGTCCGTGTCCAGCGCTGTAGCCTGGTATCAACAGAAACCA GGAAAAGCTCCGAAGCTTCTGATTTACTCGGCATCCAGCCTCTACTCTGGAGTCCCTTCTC GCTTCTCTGGTAGCCGTTCCGGGACGGATTTCACTCTGACCATCAGCAGTCTGCAGCCGG AAGACTTCGCAACTTATTACTGTCAGCAATACTTCTCTTGGTGGTACTCTCCGTTCACGTTC GGACAGGGTACCAAGGTGGAGATCAAA; VH = GAGGTTCAGCTGGTGGAGTCTGGCGGTGGCCTGGTGCAGCCAGGGGGCTCACTCCGTTT GTCCTGTGCAGCTTCTGGCTTCAACATCTCTTCTTCTTCTATACACTGGGTGCGTCAGGCC CCGGGTAAGGGCCTGGAATGGGTTGCATCTATTTCTTCTTCTTATGGCTATACTTATTATGC CGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTA


11

Page 13 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCACTGTTCGTG GATCCAAAAAACCGTACTTCTCTGGTTGGGCTATGGACTACTGGGGTCAAGGAACCCTGGT CACCGTCTCCTCG.


12


Page 14 of 33

Results Generation and characterization of the diphtheria toxin-based delivery platform To study intracellular PNP delivery by DT, human PNP was genetically fused, via an intervening (G4S)2 flexible linker, to the amino-terminus of two forms of DT: a toxic form of DT, with a catalytically active A-domain (viz. PNP-dtA-dtT-dtR); and a non-toxic, catalytically inactive form of DT, denoted with a lowercase ‘a’ (viz. PNP-dta-dtT-dtR). The resulting constructs were expressed in E. coli and purified to homogeneity using two affinity columns (Fig. 2a). PNP alone, without DT fusion, was similarly produced and purified. To show that structure and activity of PNP was unaffected by fusion to DT fragments, we assessed the oligomeric state and activity of PNP fused to full-length nontoxic DT and to the nontoxic A-domain, PNP-dta, that is delivered into the cytosol (Fig. 1). As expected, the DT platform eluted at a molecular weight consistent with a monomer by gel filtration, while both PNP-dta-dtT-dtR and PNP-dta eluted as a mixture of dimers and trimers, driven by the oligomerization of PNP that is required for its activity (Fig. 2b). These results were consistent with previous reports where both dimeric and trimeric structures of human PNP were purified and determined to be active31-33. The specific activity of free PNP and two different PNP chimeras used in this study were measured and found to be equivalent, as assessed by their ability to hydrolyze inosine to hypoxanthine (Fig. 2c, Supplementary Figure 2), confirming that the fusion with DT did not alter the activity of PNP.

Biochemical evidence of intracellular delivery of PNP by DT To demonstrate intracellular delivery of PNP, we used a combination of established techniques for showing intracellular delivery, and methods that we developed here to demonstrate that PNP was active and could restore function in deficient cells (summarized in Fig. 1). First, we used the toxic fusion construct to show that dtA, fused to PNP, was able to inhibit protein synthesis through dtA-mediated inactivation of eEF-2 as evidence for entry into the cytosol. The use of protein synthesis inhibition as a surrogate for delivery is well established


13

Page 15 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and provides a robust and sensitive readout23-24, 34-38. To measure protein synthesis without the need for using radioactive tracers, we generated a luciferase-based reporter cell line, in which Vero cells were transduced to stably express NanoLuc-PEST luciferase (Vero NlucP). Vero NlucP cells were then treated with the chimeric construct overnight and the intracellular action of the co-delivered PNP-dtA to catalyze the ADP-ribosylation of eEF-2 and inhibit NlucP luciferase synthesis was measured. PNP-dtA-dtT-dtR dose-dependently inhibited NlucP luciferase expression, indicating that dtA—and the fused PNP enzyme—was delivered in the cytosol (Fig. 3a). This process was shown to be receptor-mediated, as the toxicity of PNP-dtA-dtT-dtR was inhibited by co-dosing with excess nontoxic DT (500nM) (Fig. 3b). Moreover, this process was translocation-dependent as it could be blocked both by bafilomycin A1, which inhibits vATPasemediated endosomal acidification (Fig. 3c), and by introducing the translocation-defective point mutation (L350K) into DT (Supplementary Figure 1). As expected, PNP fused to the catalytically inactive, full length DT (PNP-dta-dtT-dtR) did not inhibit protein synthesis when added to cells (Fig. 3a). To ensure that the observed inhibition of protein synthesis by dtA in the context of PNP-dtA-dtT-dtR was not due to small contaminating amounts of amino-terminal truncations lacking PNP, we generated a new construct, dtA-PNP-dta-dtT-dtR. Because translocation proceeds from the C- to N-terminus39, (i.e., dta first, then PNP, then dtA in this context), there would only expected to be inhibition of protein synthesis if the entire cargo was delivered into the cytosol. Indeed, dtA-PNP-dta-dtT-dtR, dose-dependently inhibited protein synthesis, providing further evidence that PNP was delivered into the cytosol (Fig. 3d). Next, we used patient-derived PNP-deficient lymphocytes, which provided a PNP-null background, to directly detect exogenously introduced PNP in cells. Western blot analysis performed 1, 3, 5 and 7 hour(s) after incubating PNP-deficient cells with PNP-dta-dtT-dtR, detected the full-length fusion protein in the cell fraction while non-fused PNP was absent from this fraction (Fig. 3e), indicating that only the PNP protein fused to the delivery vector was able to bind and remain associated with the cells. Further, a band of 52 kDa, which corresponds to


14


Page 16 of 33

released PNP-dta, was detected only in the PNP-dta-dtT-dtR-treated cells, implying that the chimera was processed by furin. Taken together, these biochemical studies show that PNP-dta is able to be delivered into target cells in a receptor-mediated manner, and that the dta fragment is folded and active.

DT-delivered PNP is active in target cells To demonstrate that the intracellularly-delivered PNP fusion protein was folded and functional, we developed a mass spectrometry-based method to directly measure PNPmediated generation of hypoxanthine in cells. Patient-derived PNP-deficient B lymphocytes were incubated with varying concentrations of PNP-dta-dtT-dtR for 5 h, after which the cell pellets were collected and subjected to hypoxanthine extraction. The products were then submitted to LC-MS-MS analysis to obtain quantitative hypoxanthine values. In PNP-deficient cells, extremely low levels of hypoxanthine are expected. Indeed, whereas in normal cells, we detect 1320 ng/mg hypoxanthine, in PNP-deficient cells, the hypoxanthine levels are 0.6 ng/mg (Fig. 4a). This large window provided an opportunity to detect PNP activity in cells and benchmark these levels to levels seen in normal cells with a full complement of PNP. We found that with increasing concentration of the PNP-DT fusion, the hypoxanthine levels in the cells increased in a dose-dependent manner (Fig. 4a). The highest hypoxanthine level achieved within these cells was similar to the level found in normal control cells. Even with the lowest PNP-dta-dtT-dtR treatment dose, hypoxanthine level was still higher than the 5% of the control level thought to allow normal immune function40. Importantly, treating deficient cells with PNP alone had no effect on hypoxanthine levels (Fig. 4b), further reinforcing the importance of targeted delivery.

Functional rescue of lymphocytes from PNP-deficient mice with a novel PNP-DT fusion


15

Page 17 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


One of the hallmarks of PNP deficiency is reduced number (and defective functioning) of T lymphocytes40. To demonstrate restoration of T lymphocyte function upon intracellular delivery of PNP by DT, splenocytes from PNP-deficient mice10 were isolated. The proliferative capacity of spleen-derived T cells was measured using a dye-based flow cytometric assay following stimulation with phytohemagglutinin (PHA), a classical T-cell mitogen. We labeled PNP-deficient splenocytes with a fluorescent CFSE dye (carboxyfluorescein diacetate succinimidyl ester), which covalently binds intracellular lysine residues and other free amines41. When a CFSElabeled cell divides, its daughter cells are endowed with half the number of CFSE-tagged molecules, and thus each cell division is assessed by measuring the corresponding decrease in cell fluorescence via flow cytometry42. Prior to attempting to demonstrate functional rescue of PNP by the DT platform, it was important to identify or develop a suitable replacement for dTR, as previous work on DT had shown that rodent HBEGF does not bind DT productively, rendering rodents resistant to DT43-44. Indeed, mouse embryonic fibroblasts were resistant to wild-type DT up to 100 nM (Fig. 5a). Thus, dta-dtT-dtR on its own would not be able to bind and deliver PNP into mouse splenocytes. To address this, we expressed and purified the mouse HB-EGF ectodomain and used it to identify high affinity binders by screening against a highly diverse (3 x 1010 unique members) synthetic antigen binding fragment (Fab)-phage library. After four rounds of screening, we identified 13 unique positive clones, from which 12 were confirmed to be mouse HBEGF (mHBEGF) binders by semi-quantitative phage-ELISA (the remaining clone bound human HBEGF but not mHBEGF). To test whether these mHBEGF binders could serve as a mechanism for delivery into mouse cells, we generated single chain variable fragments (scFvs) from the Fab clones, which were then cloned alone or tandem in place of dtR on DT. Of the resulting chimeras, the construct containing tandem repeats of scFv08 (i.e., dtA-dtT-scFv08scFv08, referred to as dtA-dtT-082) emerged as the most toxic to mouse NIH-3T3 cells (EC50 =


16


Page 18 of 33

130 pM) (Fig 5a), confirming that scFv was able to bind mHBEGF and mediate delivery of dtA, in this case. The ability to target and deliver cargo into mouse cells and the greater than 85% amino acid homology between human and mice PNP45 allowed us to deliver PNP into mouse lymphocytes to test for its ability to rescue T cell function. PNP-dta-dtT-scFv08-scFv08 (represented as PNP-dta-dtT-082 in Fig. 5), was generated, expressed and purified as before. CFSE-stained, PNP-deficient splenocytes were incubated with 20nM PNP-dta-dtT-scFv08scFv08 for 4 days and fluorescence of isolated T cells were measured. PNP-deficient splenocytes treated with 20nM PNP-dta-dtT-scFv08-scFv08 showed decreased CFSE fluorescence (from 105 to 0), indicating that PNP-deficient T cells had gained their proliferative capacity (Fig. 5b). When the fluorescence intensity results are converted to proliferative index (Fig. 5c), PNP-deficient splenocytes treated with PNP-dta-dtT-scFv08-scFv08 had approximately two times higher proliferative index than T cells stimulated with PHA alone, demonstrating that the intracellularly-delivered PNP improved PNP-deficient T cell function. These results demonstrated for the first time that DT can deliver an active human enzyme into cells and rescue functional defects.

PNP can enter and restore function in human neurons Devastating neurological abnormalities, such as ataxia, developmental delay and spasticity, are found in more than 50% of PNP-deficient patients40 and these neurological defects often persist despite temporal immune reconstruction achieved by HSCT46-47. Thus, it is important to consider both the immune system and the brain as targets for PNP delivery. We used PNP-deficient patient-derived, pluripotent stem cells and induced them to differentiate into neurons (i.e. PNP-deficient, iPSC neurons). Such PNP-deficient, iPSC-derived neurons were first treated with the catalytically active, PNP-DT fusion protein to confirm that neurons expressed HBEGF (Fig. 6a). Next, to evaluate the potential of PNP-DT fusion to rescue


17

Page 19 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


neurological defects associated with the deficiency, we measured the hypoxanthine levels on PNP-deficient iPSC neurons in the absence and presence of PNP-dta-dtT-dtR chimera using the previously described mass spectrometry-based assay. Compared to untreated PNPdeficient iPSC neurons, PNP-dta-dtT-dtR-treated neurons resulted in an increase in hypoxanthine levels (Fig. 6b). The hypoxanthine levels in treated cells were comparable to the levels found in control neurons, demonstrating that the DT-based delivery platform is capable of delivering an active, human enzyme into neurons and has the potential to correct neurological dysfunctions in PNP-deficient patients.


18


Page 20 of 33

Discussion Despite significant efforts, achieving efficacious levels of therapeutic proteins inside mammalian cells remains challenging due to the inability of proteins to cross biological membranes and reach the cytosol. Bacterial toxins, which naturally cross plasma membranes and deliver their effector proteins into the cytosolic compartment of target cells via binding to host cell surface receptors, hold great promise as platforms for delivering protein cargo into specific cells. In this study, we sought to expand the utility and demonstrate the capacity of the translocation domain of diphtheria toxin to deliver a trimeric human enzyme into deficient cells and rescue the functional defects associated with the disease. We chose PNP as an exemplar cargo to achieve proof-of-concept for a number of reasons: First and foremost, was that there is currently no effective treatment for PNP-deficiency. HSCT in patients with PNP deficiency might be complicated by rejection of the donor immune cells or graft versus host disease, resulting in poor outcome for such patients compared to those with other forms of T cell immune defects48. Also, in contrast to other forms of severe immune defects, gene therapy is currently not available for PNP deficiency49. Moreover, the devastating neurological abnormalities are often not improved by HSCT46, 50. Second, as it is an enzyme, PNP is an attractive candidate cargo as it effectively amplifies its signal once delivered. Moreover, the activity can be used to report both on its function and its delivery in different contexts. Third, PNP is functional as a trimer and thus, delivery of PNP would help demonstrate that DT translocation is not restricted to monomeric cargo. On top of these more fundamental reasons, it was also demonstrated previously that human PNP could be expressed in high yields in bacteria – a feature that facilitates generation of chimeras between protein fragments derived from disparate species. Engineering bacterial toxins to create chimeric constructs is an area that has gained significant interest, in particular with the advent of new technologies to both clone and produce large quantities of biologics. In fact, others and we have previously demonstrated intracellular delivery of peptides and model cargo proteins using toxins, such as anthrax toxin37, 51-54,


19

Page 21 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


exotoxin A55-57 and diphtheria toxin7, 34-35, 58. However, such toxin-based delivery vectors have focused on delivering either proteins with bacterial or invertebrate origin or cytotoxic payloads into specific target cells though modifications to the receptor-binding domain of toxins. None of them, to our knowledge, has successfully delivered a human enzyme in sufficient levels to achieve therapeutic efficacy in vitro. In this regard, our study demonstrates the great potential of DT as a delivery vehicle for diseases with defective or missing cytosolic enzymes for enzyme replacement therapy. The biggest bottleneck in development of any bacterial toxins as delivery vectors is immunogenicity. Although some previous evidence suggests that the intracellular delivery protects cargo proteins from neutralizing antibodies circulating in extracellular milieu27, 45 and that the development of neutralizing antibodies against the toxin carriers have no effect on clinical outcome59-60, in order for toxin carriers to transition to the clinic, the amount of neutralizing antibody development must be reduced as much as possible. Strategies to tackle the immunogenicity are actively being investigated by many groups including us. As shown in this study, the modular nature of diphtheria toxin allows replacement of dtR domain with a human scFv moiety, without affecting the activity of PNP, indicating that replacement or deletion of domains that would otherwise induce host immune response would greatly reduce immunogenicity. On-going efforts will focus on strategies to reduce or replace toxin-derived components with humanized non-immunogenic functional domains. Finally, an important finding here is that the intrinsic capability of DT to enter neurons led to restoration of metabolic functions in PNP-deficient neurons, indicating that the intracellular delivery of PNP could correct disease-associated neurological abnormalities. Moreover, the results highlight an exciting potential application of the DT delivery platform for targeting diseases affecting neurons, such as spinal muscular atrophy (SMA), where insufficient levels of SMA protein lead to degeneration of motor neurons, resulting in muscle atrophy61. In conclusion, we have demonstrated in this study that DT-based delivery platform is highly


20


Page 22 of 33

efficient in delivering a human enzyme into deficient cells and restoring missing activity. The versatility of the platform to access not only lymphocytes but also neurons provides an exciting opportunity to expand its targets for enzyme replacement therapy to include diseases affecting central nervous system.


21

Page 23 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Acknowledgments R.A.M. and E.G. were supported by a Brain Canada Multi-Investigator Research Initiative Grant. R.A.M. was supported in part by a Canadian Institutes of Health Research Project Grant. E.G. is supported in part by the Donald and Audrey Campbell Chair for Immunology Research, Hospital for Sick Children and the University of Toronto. G.L.B and S.S-M. were supported by SickKids RESTRACOMP postdoctoral fellowships.

Author Contributions Conceptualization, M.P., I.X., W.M., S.N.S., G.L.B., E.G., and R.A.M.; Methodology, M.P., I.X., W.M., S.N.S., Investigation, M.P., I.X., W.M., M; Writing – Original Draft, Writing, M.P., and R.A.M. – Review & Editing, E.G., G.L.B., S.N.S.; Funding Acquisition, R.A.M., E.G.; Resources, M.P., I.X., W.M., S.N.S., G.L.B., and S.M.S. Supervision, E.G., R.A.M..

Supporting Information: Supplementary Figure 1. Delivery of PNP chimeras with translocation-defective mutants; Supplementary Figure 2. Activity of PNP chimeras.


22


Page 24 of 33

References

1. Leader, B.; Baca, Q. J.; Golan, D. E., Protein therapeutics: a summary and pharmacological classification. Nat Rev Drug Discov 2008, 7 (1), 21-39. 2. Evens, R. P., Pharma Success in Product Development-Does Biotechnology Change the Paradigm in Product Development and Attrition. AAPS J 2016, 18 (1), 281-5. 3. Uhlen, M.; Fagerberg, L.; Hallstrom, B. M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, A.; Kampf, C.; Sjostedt, E.; Asplund, A.; Olsson, I.; Edlund, K.; Lundberg, E.; Navani, S.; Szigyarto, C. A.; Odeberg, J.; Djureinovic, D.; Takanen, J. O.; Hober, S.; Alm, T.; Edqvist, P. H.; Berling, H.; Tegel, H.; Mulder, J.; Rockberg, J.; Nilsson, P.; Schwenk, J. M.; Hamsten, M.; von Feilitzen, K.; Forsberg, M.; Persson, L.; Johansson, F.; Zwahlen, M.; von Heijne, G.; Nielsen, J.; Ponten, F., Proteomics. Tissue-based map of the human proteome. Science 2015, 347 (6220), 1260419. 4. Shah, D. A.; Kwon, S. J.; Bale, S. S.; Banerjee, A.; Dordick, J. S.; Kane, R. S., Regulation of stem cell signaling by nanoparticle-mediated intracellular protein delivery. Biomaterials 2011, 32 (12), 3210-9. 5. Cox, A. D.; Fesik, S. W.; Kimmelman, A. C.; Luo, J.; Der, C. J., Drugging the undruggable RAS: Mission possible? Nat Rev Drug Discov 2014, 13 (11), 828-51. 6. Khoo, K. H.; Verma, C. S.; Lane, D. P., Drugging the p53 pathway: understanding the route to clinical efficacy. Nat Rev Drug Discov 2014, 13 (3), 217-36. 7. Auger, A.; Park, M.; Nitschke, F.; Minassian, L. M.; Beilhartz, G. L.; Minassian, B. A.; Melnyk, R. A., Efficient Delivery of Structurally Diverse Protein Cargo into Mammalian Cells by a Bacterial Toxin. Mol Pharm 2015, 12 (8), 2962-71. 8. Grunebaum, E.; Zhang, J.; Roifman, C. M., Novel mutations and hot-spots in patients with purine nucleoside phosphorylase deficiency. Nucleosides Nucleotides Nucleic Acids 2004, 23 (8-9), 1411-5. 9. Grunebaum, E.; Cohen, A.; Roifman, C. M., Recent advances in understanding and managing adenosine deaminase and purine nucleoside phosphorylase deficiencies. Curr Opin Allergy Clin Immunol 2013, 13 (6), 630-8. 10. Arpaia, E.; Benveniste, P.; Di Cristofano, A.; Gu, Y.; Dalal, I.; Kelly, S.; Hershfield, M.; Pandolfi, P. P.; Roifman, C. M.; Cohen, A., Mitochondrial basis for immune deficiency. Evidence from purine nucleoside phosphorylase-deficient mice. J Exp Med 2000, 191 (12), 2197-208. 11. Somech, R.; Lev, A.; Grisaru-Soen, G.; Shiran, S. I.; Simon, A. J.; Grunebaum, E., Purine nucleoside phosphorylase deficiency presenting as severe combined immune deficiency. Immunol Res 2013, 56 (1), 150-4. 12. Rich, K. C.; Majias, E.; Fox, I. H., Purine nucleoside phosphorylase deficiency: improved metabolic and immunologic function with erythrocyte transfusions. N Engl J Med 1980, 303 (17), 973-7. 13. Greenfield, L.; Bjorn, M. J.; Horn, G.; Fong, D.; Buck, G. A.; Collier, R. J.; Kaplan, D. A., Nucleotide sequence of the structural gene for diphtheria toxin carried by corynebacteriophage beta. Proc Natl Acad Sci U S A 1983, 80 (22), 6853-7.


23

Page 25 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


14. Naglich, J. G.; Metherall, J. E.; Russell, D. W.; Eidels, L., Expression cloning of a diphtheria toxin receptor: identity with a heparin-binding EGF-like growth factor precursor. Cell 1992, 69 (6), 1051-61. 15. Moya, M.; Dautry-Varsat, A.; Goud, B.; Louvard, D.; Boquet, P., Inhibition of coated pit formation in Hep2 cells blocks the cytotoxicity of diphtheria toxin but not that of ricin toxin. J Cell Biol 1985, 101 (2), 548-59. 16. Donovan, J. J.; Simon, M. I.; Draper, R. K.; Montal, M., Diphtheria toxin forms transmembrane channels in planar lipid bilayers. Proc Natl Acad Sci U S A 1981, 78 (1), 172-6. 17. Donovan, J. J.; Simon, M. I.; Montal, M., Insertion of diphtheria toxin into and across membranes: role of phosphoinositide asymmetry. Nature 1982, 298 (5875), 669-72. 18. Donovan, J. J.; Simon, M. I.; Montal, M., Requirements for the translocation of diphtheria toxin fragment A across lipid membranes. J Biol Chem 1985, 260 (15), 8817-23. 19. Lai, B.; Zhao, G.; London, E., Behavior of the deeply inserted helices in diphtheria toxin T domain: helices 5, 8, and 9 interact strongly and promote pore formation, while helices 6/7 limit pore formation. Biochemistry 2008, 47 (15), 4565-74. 20. Olsnes, S.; Falnes, P. O., Probing pores with peptide plugs. Topology of membraneinserted diphtheria toxin. J Gen Physiol 2000, 115 (4), 417-20. 21. Sharpe, J. C.; London, E., Diphtheria toxin forms pores of different sizes depending on its concentration in membranes: probable relationship to oligomerization. J Membr Biol 1999, 171 (3), 209-21. 22. Sandvig, K.; Olsnes, S., Rapid entry of nicked diphtheria toxin into cells at low pH. Characterization of the entry process and effects of low pH on the toxin molecule. J Biol Chem 1981, 256 (17), 9068-76. 23. Collier, R. J.; Pappenheimer, A. M., Jr., Studies on the Mode of Action of Diphtheria Toxin. Ii. Effect of Toxin on Amino Acid Incorporation in Cell-Free Systems. J Exp Med 1964, 120, 1019-39. 24. Collier, R. J., Effect of diphtheria toxin on protein synthesis: inactivation of one of the transfer factors. J Mol Biol 1967, 25 (1), 83-98. 25. Fu, H.; Blanke, S. R.; Mattheakis, L. C.; Collier, R. J., Selection of diphtheria toxin active-site mutants in yeast. Rediscovery of glutamic acid-148 as a key residue. Adv Exp Med Biol 1997, 419, 45-52. 26. Patel, M.; Yang, S., Advances in reprogramming somatic cells to induced pluripotent stem cells. Stem Cell Rev 2010, 6 (3), 367-80. 27. Toro, A.; Paiva, M.; Ackerley, C.; Grunebaum, E., Intracellular delivery of purine nucleoside phosphorylase (PNP) fused to protein transduction domain corrects PNP deficiency in vitro. Cell Immunol 2006, 240 (2), 107-15. 28. Persson, H.; Ye, W.; Wernimont, A.; Adams, J. J.; Koide, A.; Koide, S.; Lam, R.; Sidhu, S. S., CDR-H3 diversity is not required for antigen recognition by synthetic antibodies. J Mol Biol 2013, 425 (4), 803-11. 29. Fellouse, F. A.; Sidhu, S., Synthetic Antibody Libraries. In Phage display in drug discovery and Biotechnology, Second Edition, Geyer, S. S. S. C. R., Ed. CRC Press: Boca Raton, FL, 2015; pp 495-520. 30. Fellouse, F. A.; Sidhu, S. S., Synthetic Antibody Libraries. In Phage display in drug discovery and Biotechnology, CRC Press: Boca Raton, FL, 2015; pp 495-520.


24


Page 26 of 33

31. Lewis, A. S.; Lowy, B. A., Human erythrocyte purine nucleoside phosphorylase: molecular weight and physical properties. A Theorell-Chance catalytic mechanism. J Biol Chem 1979, 254 (19), 9927-32. 32. Agarwal, R. P.; Parks, R. E., Jr., Purine nucleoside phosphorylase from human erythrocytes. IV. Crystallization and some properties. J Biol Chem 1969, 244 (4), 644-7. 33. Edwards, Y. H.; Edwards, P. A.; Hopkinson, D. A., A trimeric structure for mammalian purine nucleoside phosphorylase. FEBS Lett 1973, 32 (2), 235-7. 34. Madshus, I. H.; Olsnes, S.; Stenmark, H., Membrane translocation of diphtheria toxin carrying passenger protein domains. Infect Immun 1992, 60 (8), 3296-302. 35. Klingenberg, O.; Olsnes, S., Ability of methotrexate to inhibit translocation to the cytosol of dihydrofolate reductase fused to diphtheria toxin. Biochem J 1996, 313 ( Pt 2), 647-53. 36. Wiedlocha, A.; Madshus, I. H.; Mach, H.; Middaugh, C. R.; Olsnes, S., Tight folding of acidic fibroblast growth factor prevents its translocation to the cytosol with diphtheria toxin as vector. EMBO J 1992, 11 (13), 4835-42. 37. Rabideau, A. E.; Pentelute, B. L., Delivery of Non-Native Cargo into Mammalian Cells Using Anthrax Lethal Toxin. ACS Chem Biol 2016, 11 (6), 1490-501. 38. Milne, J. C.; Blanke, S. R.; Hanna, P. C.; Collier, R. J., Protective antigen-binding domain of anthrax lethal factor mediates translocation of a heterologous protein fused to its aminoor carboxy-terminus. Mol Microbiol 1995, 15 (4), 661-6. 39. Murphy, J. R., Mechanism of diphtheria toxin catalytic domain delivery to the eukaryotic cell cytosol and the cellular factors that directly participate in the process. Toxins (Basel) 2011, 3 (3), 294-308. 40. Markert, M. L., Purine nucleoside phosphorylase deficiency. Immunodefic Rev 1991, 3 (1), 45-81. 41. Parish, C. R., Fluorescent dyes for lymphocyte migration and proliferation studies. Immunol Cell Biol 1999, 77 (6), 499-508. 42. Lyons, A. B.; Parish, C. R., Determination of lymphocyte division by flow cytometry. J Immunol Methods 1994, 171 (1), 131-7. 43. Middlebrook, J. L.; Dorland, R. B., Response of cultured mammalian cells to the exotoxins of Pseudomonas aeruginosa and Corynebacterium diphtheriae: differential cytotoxicity. Can J Microbiol 1977, 23 (2), 183-9. 44. Buch, T.; Heppner, F. L.; Tertilt, C.; Heinen, T. J.; Kremer, M.; Wunderlich, F. T.; Jung, S.; Waisman, A., A Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration. Nature methods 2005, 2 (6), 419-26. 45. Toro, A.; Grunebaum, E., TAT-mediated intracellular delivery of purine nucleoside phosphorylase corrects its deficiency in mice. J Clin Invest 2006, 116 (10), 2717-26. 46. Baguette, C.; Vermylen, C.; Brichard, B.; Louis, J.; Dahan, K.; Vincent, M. F.; Cornu, G., Persistent developmental delay despite successful bone marrow transplantation for purine nucleoside phosphorylase deficiency. J Pediatr Hematol Oncol 2002, 24 (1), 69-71. 47. Myers, L. A.; Hershfield, M. S.; Neale, W. T.; Escolar, M.; Kurtzberg, J., Purine nucleoside phosphorylase deficiency (PNP-def) presenting with lymphopenia and developmental delay: successful correction with umbilical cord blood transplantation. J Pediatr 2004, 145 (5), 710-2.


25

Page 27 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


48. Grunebaum, E. Purine nucleoside phosphorylase deficiency. https://www.uptodate.com/contents/purine-nucleoside-phosphorylase-deficiency (accessed 2018, June 27). 49. Xu, X.; Tailor, C. S.; Grunebaum, E., Gene therapy for primary immune deficiencies: a Canadian perspective. Allergy Asthma Clin Immunol 2017, 13, 14. 50. Yeates, L.; Slatter, M. A.; Gennery, A. R., Infusion of Sibling Marrow in a Patient with Purine Nucleoside Phosphorylase Deficiency Leads to Split Mixed Donor Chimerism and Normal Immunity. Front Pediatr 2017, 5, 143. 51. Ballard, J. D.; Collier, R. J.; Starnbach, M. N., Anthrax toxin-mediated delivery of a cytotoxic T-cell epitope in vivo. Proc Natl Acad Sci U S A 1996, 93 (22), 12531-4. 52. Leppla, S. H.; Arora, N.; Varughese, M., Anthrax toxin fusion proteins for intracellular delivery of macromolecules. J Appl Microbiol 1999, 87 (2), 284. 53. Bachran, C.; Morley, T.; Abdelazim, S.; Fattah, R. J.; Liu, S.; Leppla, S. H., Anthrax toxin-mediated delivery of the Pseudomonas exotoxin A enzymatic domain to the cytosol of tumor cells via cleavable ubiquitin fusions. MBio 2013, 4 (3), e00201-13. 54. Liao, X.; Rabideau, A. E.; Pentelute, B. L., Delivery of antibody mimics into mammalian cells via anthrax toxin protective antigen. Chembiochem : a European journal of chemical biology 2014, 15 (16), 2458-66. 55. Lippolis, J. D.; Denis-Mize, K. S.; Brinckerhoff, L. H.; Slingluff, C. L., Jr.; Galloway, D. R.; Engelhard, V. H., Pseudomonas exotoxin-mediated delivery of exogenous antigens to MHC class I and class II processing pathways. Cell Immunol 2000, 203 (2), 75-83. 56. Verdurmen, W. P.; Luginbuhl, M.; Honegger, A.; Pluckthun, A., Efficient cell-specific uptake of binding proteins into the cytoplasm through engineered modular transport systems. J Control Release 2015, 200, 13-22. 57. Kim, H. Y.; Kang, J. A.; Ryou, J. H.; Lee, G. H.; Choi, D. S.; Lee, D. E.; Kim, H. S., Intracellular Protein Delivery System Using a Target-Specific Repebody and Translocation Domain of Bacterial Exotoxin. ACS Chem Biol 2017, 12 (11), 2891-2897. 58. Stenmark, H.; Moskaug, J. O.; Madshus, I. H.; Sandvig, K.; Olsnes, S., Peptides fused to the amino-terminal end of diphtheria toxin are translocated to the cytosol. J Cell Biol 1991, 113 (5), 1025-32. 59. Foss, F. M., DAB(389)IL-2 (ONTAK): a novel fusion toxin therapy for lymphoma. Clin Lymphoma 2000, 1 (2), 110-6; discussion 117. 60. Kreitman, R. J.; Pastan, I., Antibody fusion proteins: anti-CD22 recombinant immunotoxin moxetumomab pasudotox. Clin Cancer Res 2011, 17 (20), 6398-405. 61. Burghes, A. H.; Beattie, C. E., Spinal muscular atrophy: why do low levels of survival motor neuron protein make motor neurons sick? Nat Rev Neurosci 2009, 10 (8), 597-609. 62. Eckert, C.; Emirian, A.; Le Monnier, A.; Cathala, L.; De Montclos, H.; Goret, J.; Berger, P.; Petit, A.; De Chevigny, A.; Jean-Pierre, H.; Nebbad, B.; Camiade, S.; Meckenstock, R.; Lalande, V.; Marchandin, H.; Barbut, F., Prevalence and pathogenicity of binary toxinpositive Clostridium difficile strains that do not produce toxins A and B. New Microbes New Infect 2015, 3, 12-7.


26


Page 28 of 33

FIGURES

Figure 1. Concept for delivery of passenger protein (PNP) fused to diphtheria toxin. (top) Schematic of a chimeric fusion of PNP to the amino terminus of diphtheria toxin (DT) via a (G4S)2 linker. The enzymatic a domain (dta) and translocation/receptor-binding domain (dtT-dtR) have an intervening furin-like recognition site (black triangle) and are further joined by an intramolecular disulfide bond. (bottom) DT is endocytosed into endocytic vesicles by a receptor-mediated process. Within endosomes, a furin-like protease cleaves between dta and dtT-dtR. Upon exposure to low pH in the endosomes, dtT undergoes a major conformational change, resulting in the formation of a membrane-spanning pore, allowing dta (and any associated passenger protein) to translocate into the cytosol. Translocation starts with dta, followed by any amino-terminal passenger protein. The reducing environment of the cytosol reduces the disulfide bond releasing dta (and any associated passenger protein) into the cytosol. To demonstrate intracellular delivery of PNP, four different approaches were used. First, by using catalytically active dtA and its fusion with PNP (i.e., PNP-dtA-dtT-dtR), the activity of the co-delivered dtA (i.e., inhibition of protein synthesis) was measured as a surrogate marker for PNP delivery. Second, the released PNP-dta was detected on western blot using anti-PNP antibodies. Third, by using catalytically inactive dta and its fusion with PNP (i.e., PNP-dta-dtTdtR), hypoxanthine levels inside cells were measured using mass spectrometry. Fourth, the ability of PNP-deficient T cells to restore its proliferative capability upon PNP-dta-dtT-dtR treatment was measured using flow cytometry.


27

Page 29 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Purification and characterization of PNP-DT fusion construct. (A) Coomassie stained SDS-PAGE gel demonstrating purification of PNP-dta-dtT-dtR using two affinity columns, Ni and StrepTrap columns. Sup = supernatant of cell lysate, Ni F/T = Ni column flow-through, Ni Elut = Ni column elution, Strep F/T = StrepTrap column flow-through, Strep elut = StrepTrap column elution. (B) Molecular weights of dta-dtT-dtR, PNP-dta-dtT-dtR and PNP-dta based on size exclusion column elution volumes. (C) Specific PNP activity of purified PNP proteins with and without DT fusion. The activity of PNP-dta-dtT-dtR fusion is similar to the activity of non-fused PNP, indicating that the fusion with DT did not alter the function of PNP.


28


Page 30 of 33

Figure 3. Biochemical evidence of intracellular delivery of PNP by DT. (A) Dose titration curves of chimeric constructs on Vero NlucP cells with PNP-dtA-dtT-dtR (contains enzymatically active “toxic” dtA domain) in closed black circles, PNP-dta-dtT-dtR (contains enzymatically inactive “dead” dta domain) in open black circles, and PNP alone without the DT fusion in black triangles. (n = 3). (B) A fixed concentration (500 nM) of enzymatically inactive, full length DT (dta-dtT-dtR) was added to cells to compete with PNP-dtA-dtT-dtR, which was added to cells using a three-fold serial dilution with a starting concentration of 10 nM. This competition assay confirms that PNP delivery is receptor-dependent. (n = 3). (C) Pretreatment of Vero NlucP cells with and without 0.4 µM bafilomycin A1 for 30 min, followed by incubation with 200 nM PNPdtA-dtT-dtR for an additional 3 h and 30 min demonstrated that bafilomycin A1 treatment inhibited PNP delivery by inhibiting acidification of endosomes. (n = 3). (D) Dose titration curve of dtA-PNP-dta-dtT-dtR on Vero NlucP cells. Inhibition of protein synthesis is attributed to the activity of the “toxic” dtA domain at the very N-terminus of the construct, indicating intracellular delivery of PNP. (n = 3). (E) Western blot probed with anti-PNP antibodies on EBV transformed lymphocytes from a PNP-deficient patient incubated with 2 µM PNP-dta-dtT-dtR or PNP alone for the indicated times. Equal loading was demonstrated by re-blotting with antibodies to tubulin. For comparison, blotting of PNP-dta-dtT-dtR and PNP (5 ng) is also presented.


29

Page 31 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Intracellularly-delivered PNP remains active in target cells. (A) Hypoxanthine levels, determined by LC-MS-MS, measured in EBV transformed B lymphocytes from a PNP-deficient patient after incubation with 0 to 2 µM PNP-dta-dtT-dtR for 5 hours. Hypoxanthine level in lymphocytes from normal control was similarly determined. Results (mean ± SD) are representative of three independent experiments. (B) Hypoxanthine levels, determined by LSMS-MS, measured in EBV transformed B lymphocytes from a PNP-deficient patient after incubation with 2 µM PNP-dta-dtT-dtR or PNP for 5 min and remained in fresh medium for 5 h. PNP alone without the DT delivery vector did not produce hypoxanthine as it was unable to translocate into cells.


30


Page 32 of 33

Figure 5. Effect of PNP-dta-dtT-scFv08-scFv08 on proliferation of PNP-deficient mouse CD3+ T cells. scFv08-scFv08 is represented as 082 in short form. (A) Dose-titration curves of wild-type DT (dtA-dtT-dtR) in closed black circles, and DT with scFv08-scFv08 on the C-terminus in place of dtR (dtA-dtT-scFv08-scFv08) in open black circles on mouse embryonic fibroblasts (NIH3T3 NlucP). (B) Fluorescence intensity is displayed on the X axis and the relative proportion of cells that have undergone proliferation under each treatment condition is displayed on the Y axis. (C) Results in Figure 5B are converted to proliferation index. Proliferation index of PNP-deficient (PNP-/-) cells stimulated with PHA and treated with or without 20 nM PNP-dta-dtT-scFv08scFv08, in comparison to PNP-proficient (PNP+/-) cells stimulated with PHA. Results (mean ± SD) are representative of three independent experiments. *p

Intracellular delivery of human purine nucleoside phosphorylase by

Recommend Documents