Investigating the Potential of Amnion-Based Scaffolds as a Barrier

Jul 9, 2015 - E-mail: [email protected]., *Phone: (662) 325-5987. E-mail: [email protected]., *Phone: (312) 503-3698. E-mail: bo.wang@northwestern...
1 downloads 5 Views 2MB Size
Download PDF
Page 1 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Investigating the Potential of Amnion-based Scaffolds as a Barrier Membrane for Guided Bone Regeneration Wuwei Li1*, Guowu Ma1, Bryn Brazile2, Nan Li1, Wei Dai3, J. Ryan Butler2, Andrew A. Claude2, Jason A. Wertheim4, Jun Liao2*, Bo Wang1,4* 1 Department of Oral and Maxillofacial Surgery, School of Stomatology, Dalian Medical University, Liaoning 116001, China. 2 Department of Biological Engineering and College of Veterinary Medicine, Mississippi State University, Mississippi State, MS 39762, USA. 3 Department of Operation Room，The First Affiliated Hospital, Dalian Medical University, Liaoning 116001, China. 4 Comprehensive Transplant Center and Department of Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611, USA.

Running Title: An Amnion-based Barrier Membrane for Guided Bone Regeneration

* Co-corresponding authors: Bo Wang, Ph.D. Department of Oral and maxillofacial surgery, School of Stomatology, Dalian Medical University, 9 West, Lvshun South Road, Dalian, Liaoning 116001, China Comprehensive Transplant Center and Department of Surgery Northwestern University Feinberg School of Medicine, Northwestern University 300 E Superior Street, Chicago, IL 60611, USA Phone: (312) 503-3698 E-mail: [email protected] Wuwei Li, D.D.S Department of Oral and maxillofacial surgery, School of Stomatology, Dalian Medical University, 9 West, Lvshun South Road, Dalian, Liaoning 116001, China Phone: 086-13998698869 E-mail: [email protected] Jun Liao, Ph.D., FAHA Department of Biological Engineering, Mississippi State University 130 Creelman Street, Box 9632 Mississippi State, MS 39762, USA Phone: (662) 325-5987 E-mail: [email protected]

1 ACS Paragon Plus Environment

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 34

Abstract: Guided bone regeneration is a new concept of large bone defect therapy, which employs a barrier membrane to afford a protected room for osteogenesis and prevent the invasion of fibroblasts. In this study, we developed a novel barrier membrane made from lyophilized multilayered acellular human amnion membranes (AHAM). After decellularization, the AHAM preserved the structural and biomechanical integrity of the amnion extracellular matrix (ECM). The AHAM also showed minimal toxic effects when cocultured with mesenchymal stem cells (MSCs), as evidenced by high cell density, good cell viability, and efficient osteogenic differentiation after 21-day culturing. The effectiveness of the multilayered AHAM in guiding bone regeneration was evaluated using an in vivo rat tibia defect model. After 6 weeks of surgery, the multilayered AHAM showed great efficiency in acting as a shield to avoid the invasion of the fibrous tissues, stabilizing the bone grafts, and inducing the massive bone growth. We hence concluded that the advantages of the lyophilized multilayered AHAM barrier membrane are as follows: preservation of the structural and mechanical properties of the amnion ECM, easiness for preparation and handling, flexibility in adjusting the thickness and mechanical properties to suit the application, and efficiency in inducing bone growth and avoiding fibrous tissues invasion.

Key Words: Barrier Membrane, Amnion Membrane, Decellularization, Interface, Guided bone regeneration, Tibia Defect Rat Model

Abbreviations: acellular human amnion membrane (AHAM), guided bone regeneration (GBR), extracellular matrix (ECM), mesenchymal stem cells (MSCs), sprague-dawley (SD), sodium dodecyl sulfate (SDS), hematoxylin and eosin (H&E), phosphate-buffered saline (PBS), scanning electron microscopy (SEM), alkaline phosphatase, quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR), glyceraldehyde-32 ACS Paragon Plus Environment

Page 3 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

phosphate dehydrogenase (GAPDH), osteocalcin (OCN), threshold cycle (Ct), fiber preferred direction , cross preferred direction (XD), Geistlich Bio-Oss Granulate cancellous bone granules (Bio-oss), microcomputed tomography (micro-CT), bone volume per total volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), one way analysis of variances (ANOVA)

1.

Introduction: Barrier membranes have been wildly used in dental peri-bone implanting [1, 2] and other bone

fractures with large bone loss or with poor healing potential [3]. The main role of applying the barrier membrane in bone surgery is to prevent the invasion of fibroblasts, provide stability for bone grafts and blood clots, and ensure a protected room for osteogenesis (also known as guided bone regeneration (GBR)) [4, 5]. As an example in the dental field, patients with serious periodontal defects, dehiscences, and fenestrations around the region of implant or patients requiring bone augmentation generally need peri-bone implanting treatment with sufficient high quality bone grafts as well as a barrier membrane covering on top of the implanting site [6-8]. Two major types of the barrier membranes that are commonly used in clinical treatment are resorbable and non-resorbable membranes. Non-resorbable membranes are better at space-maintaining when compared with the resorbable membranes, but these materials have high risk of infection and need a second removal operation [9, 10]. Collagen barrier membrane, a type of natural resorbable membrane that is widely used as a commercial product, has a bi-layered structure consisting of a porous layer and a dense layer [11]. Clinically in dental application, after filling the bone grafts into the defect region, the collagen barrier membrane is usually placed directly over the grafted material, with the porous layer facing the bone grafts to permit bone ingrowth, and the dense layer facing the mucosa to avoid the invasion of fibrous tissues [12]. However, there are still some drawbacks existing in the application of the collagen barrier membrane in bone implantation [13]. Collagen membranes are animal derived biomaterials, thus they face the risk of disease transmission from animals to humans [14]. Moreover, during the surgical and postoperative healing phases, this approach 3 ACS Paragon Plus Environment

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 34

is still faced with challenges such as inflammatory response, weak mechanical strength, and control of the degradation rate [15, 16]. An ideal barrier membrane should have the advantages of preventing the fibrous tissue invasion, promoting bone regeneration, maintaining the bone defect margins, reducing the associated complications and the healing time, and being absorbed in an appropriate manner [17]. Human amnion membrane (HAM) is the interior part of human fetal membranes, which consists of an epithelial layer, a basement membrane, and a collagen stromal layer [18]. The extracellular matrix (ECM) components of the HAM include collagen, elastin, laminins, nidogen, fibronectin [19], proteoglycans [20, 21], and numerous growth factors such as EGF, KGF, HGF and bFGF [22]. HAM is found to have favorable biological properties such as anti-microbial, antiinflammatory, scar inhibiting, low immunogenicity, stimulating epithelialization, and wound healing [19, 23]. In regenerative medicine, HAM has been used in ocular surface reconstruction [24-26], partial-thickness burn wounds covering [27-29], and as scaffold materials in tissue engineering [30, 31]. Moreover, HAM has recently been reported as a suitable platform in facilitating osteogenic differentiation for both stem cells [32] and apical papilla cells [33]. When covering over the defects on maxillary and mandibular bone, the acellular HAM was found to promote injury healing and improve bone induction [34]. In this study, we created a barrier membrane made from lyophilized multilayered acellular human amnion membranes (AHAM) and evaluated the potential of AHAM barrier membrane in assisting bone implanting treatment. AHAM was characterized to understand its ECM composition and biomechanical properties, in vitro interaction with bone marrow mesenchymal stem cells (MSCs), and osteogenic capability. The effectiveness of the AHAM barrier membrane in guiding bone growth was evaluated via an in vivo rat tibia defect model.

2. 2.1

Materials and Methods: HAM Decellularization and AHAM Barrier Membrane Preparation:

4 ACS Paragon Plus Environment

Page 5 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Fresh full-thickness HAM was collected after caesarian delivery from uncomplicated singleton pregnancy in the First Affiliated Hospital of Dalian Medical University (Liaoning, China). All mothers were seronegative for human immunodeficiency virus types I and II, human hepatitis B and C, and syphilis. Informed consents were obtained from the mothers, and the IRB protocol was approved by the Research Ethics Board of Dalian Medical University. The HAM was dissected from the periplacental region, trimmed into 1.5 cm ×1.5 cm square pieces, and treated with 1% Triton X-100 (200 ml) for 2 hours, distilled water (200 ml) for 15 minutes for two times, and 0.1% Sodium dodecyl sulfate (SDS) (200 ml) for 10 hours on a horizontal shaker (Thomas Scientific Inc., Swedesboro, NJ), followed by thorough PBS washing. To prepare single-layered lyophilized AHMA for structural characterizations and in vitro cell culture studies, a piece of AHMA (1.5 cm ×1.5 cm) was spread and fixed with surgical sutures on a custom-made, square-shaped plastic frame (Fig.1C) and completely dehydrated with a Freeze Dryer System (Cole-Parmer, Vernon Hills, IL) at -54 ºC. To prepare the multi-layered lyophilized AHAM for the in vivo rat experiments, eight pieces of the AHAM scaffolds were stacked into a multilayered patch. We then removed the air bubbles that were trapped among the membrane layers with a roller. Similarly, the multi-layered patch was sutured onto the custom-made, square-shaped plastic frame, and completely dehydrated with the Freeze Dryer System.

2.2

Histology, Immunohistology, and SEM Samples for histology staining were fixed in 4% paraformaldehyde, subjected to sectioning, and stained

with hematoxylin and eosin (H&E) and Movat's Pentachrome. For immunofluorescence staining, after deparaffin, rehydration, and antigen retrieval, sample sections were incubated with anti-collagen type I, anticollagen type IV, and anti-fibronectin primary antibodies (1:200, Abcam, Cambridge, MA) at 4°C overnight. Secondary antibodies of goat anti-mouse IgG-FITC (1:500, Santa Cruz Biotechnology, Santa Cruz, CA) were incubated at room temperature for 60 minutes. The sections were then stained with 1 µg/ml DAPI (Invitrogen) for cell nuclei. The immunofluorescence slides were observed with a fluorescence microscope (Olympus 5 ACS Paragon Plus Environment

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 34

BX43). For Scanning Electron Microscopy (SEM), the samples were fixed in 2.5% glutaraldehyde, dehydrated, critical point dried (Polaron E 3000 CPD), and sputter coated with gold-palladium for SEM observation (JEOL JSM-6500 FE-SEM).

2.3

In Vitro Cell Culture Well-characterized bone marrow MSCs (third passage) derived from Sprague-Dawley (SD) rats

(Product No.: RASMX-01201, Cyagen Biosciences Inc., China) were re-suspended and seeded in 75-mm flasks at a density of 2 × 103 cells/cm2 with MSC medium (L-DMEM, 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin). MSCs were expanded, and the cells at the fifth passage were used for AHAM recellularization and osteogenic differentiation studies. All cell culture was performed in the incubator at 37ºC and 5% CO2 atmosphere by following the instruction provided by Cyagen Biosciences Inc.. Osteogenic Differentiation in MSCs-AHAM Scaffold Complex (AHAM Group). Singe-layered lyophilized AHAM scaffold was trimmed into a circular shape (1 cm in diameter), sterilized with UV light for 10 minutes, and pressed onto the bottom of the 24-well cell culture plate (BD Biosciences, San Jose, CA). The AHAM scaffolds were rinsed with MSC medium to allow the uniform attachment to the bottom of the wells and air dried for 10 minutes at room temperature. Then, the scaffold was gently pipetted with 1 × 105 MSCs mixed in 0.1 ml MSC medium and maintained under a dynamic culture condition to allow cell attachment; 0.4 ml MSC medium was added into each well after half an hour. At day 3, the medium in each well was changed into 0.5 ml osteogenic differentiation medium (DMEM, 10% FBS, 1% penicillin, streptomycin and dexamethasone (0.1 uM), b-glycerophosphate (10 mM), and ascorbic acid (50 uM)). The reseeded scaffolds were then cultured under static culture condition until day 21. Osteogenic Differentiation on 2D Cell Culture Plate (2D Differentiation Group). 1 × 105 MSCs were seeded onto the bottom surface of the 24-well cell culture plate and cultured with 0.5 ml MSC medium for 3 days. At day 3, the medium was switched to 0.5 ml osteogenic differentiation medium and cultured until day 21. The cells were cultured under static condition during the 21-day cell culture. 6 ACS Paragon Plus Environment

Page 7 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

MSCs on 2D Surface without the delivery of Osteogenic Medium (2D Control Group): 1 × 105 MSCs were seeded in the 24-well cell culture plate and cultured with 0.5 ml MSC medium for 21 days. The cells were cultured under static condition during the 21-day cell culture. The medium of all three groups was changed on the second day after cell reseeding and every other day afterwards until day 21.

2.4

DNA Assay, Cell Viability, Cell Proliferation, ALP Activity, and Mineralization Assessment DNA Assay. DNA assay was performed to evaluate the extent of decellularization. Native HAMs and

AHAMs (n=6 for each group) were lyophilized, followed by dry weight measurement. DNA was extracted and purified using a standard kit (Qiagen, Gaithersburg, MD). DNA concentration was then quantified by reading absorbance at 260 nm, and the results were expressed in ng DNA/mg dry weight of the sample. Cell Viability, Proliferation, and ALP Activity. Cell viability was quantified with a Filmtracer™ LIVE/DEAD® Biofilm Viability Kit (Invitrogen). To analyze cell proliferation and ALP activity of the three in vitro culture groups, the MSCs-AHAM scaffold complex and the dissociated cells in both the 2D differentiation group and 2D control group were treated with 1 ml lysis buffer (10 mM Tris, 1 mM EDTA, and 0.2 % (v/v) Triton X-100) for half an hour on ice along with 10 seconds of sample vortexing every five minutes. DNA within the resultant cell lysate solution was then measured using a Quant-iTTM PicoGreen kit (Life Technologies, Grand Island, NY). ALP activity in the resultant cell lysate solution was determined via a QUANTI-Blue kit (InvivoGen, San Diego, CA) by reading optical density (OD) at 620-655 nm, and the results were expressed in OD ALP/µg DNA of the tested sample. The time points subjected to analyses were day 3, 7, 14, and 21 (n=4 for each group). Mineralization Assessment. The samples for alizarin red staining (n=4 for each group) were fixed in 4% paraformaldehyde for 15 minutes and stained with 1x alizarin red S solution (Millipore, Billerica, MA) for 30 minutes at room temperature. Non-specific staining was removed by four-time washes with distilled water. Images of the samples were then captured with a light microscope (Olympus BX43).

7 ACS Paragon Plus Environment

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2.5

Page 8 of 34

qRT-PCR Total RNA of MSCs cultured in the three in vitro culture groups at day 7 and day 21 (n=4 each) was

extracted with TRIzol® RNA isolation reagents and reverse transcription (RT) was performed using the High Capacity RNA-to-cDNA Kit (Life Technologies, Grand Island, NY). Real-time polymerase chain reaction (qPCR) was performed with iQ™ SYBR® Green Supermix and detected with iQ™5 Optical System (Bio-Rad, Des Plaines, IL). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the house keeping gene. Primer sequences design (5’-3’) was as follows: GAPDH: F-CTGGGAATCTGTCCCGTTAAG; RCAGGAAGTCTCTGGGAAGAATG; GCAGGGTCTGGAGAGTATATTTG; TGATGCAGGACAGAGAGAGA; CCGTTCCTCATCTGGACTTTAT;

ALP: Collagen Osteocalcin

F-GACACGTTGACTGTGGTTACT; type

I:

(OCN):

Runx2:

R-

F-CGGACTATTGAAGGAGCCTAAC;

R-

F-GGGCAGTAAGGTGGTGAATAG;

R-

F-CCAAGAAGGCACAGACAGAA;

R-

GTAAGTGAAGGTGGCTGGATAG. The thermal profile was 50ºC 2min, 95ºC 10min, then 40 amplification cycles consisting of 95ºC 60s, and 58ºC 60s. Relative quantification of genes was calculated using the 2^(Ct gene 2 – Ct GAP 2)-(Ct gene 1 – Ct GAP 1) equation,

where ‘‘Ct gene 1’’ represented the threshold cycle (Ct) of the target gene in

2D control group and ‘‘Ct gene 2’’ was the Ct of the target gene in either AHAM group or the 2D differentiation group. ‘‘Ct GAP 1’’ and ‘‘Ct GAP 2’’ were for the GAPDH housekeeping gene in each of the respective conditions.

2.6

Biomechanical Evaluation of Membrane Materials The uniaxial mechanical properties of the multilayered AHAM (8 layers) and collagen membrane (Bio-

Gide, porcine derived, Osteohealth, Shirley, NY) (15 mm x 3 mm, n=4 for each) were characterized by a uniaxial testing machine (Mach-1, Biosyntech, MN) along the fiber-preferred direction. After 10 cycles of preconditioning, the sample was elongated to failure at the ramp speed of 0.1 mm/s. The stress was calculated by normalizing the force to the initial cross-sectional area, and the strain was calculated by dividing the displacement with the initial grip-to-grip distance (gauge length at 1 g preload). The biaxial 8 ACS Paragon Plus Environment

Page 9 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

mechanical properties were assessed with a custom-made biaxial mechanical testing system [35]. The membranes (n=4 for each) were cut into square samples with one edge of the sample aligned along the fiberpreferred direction and the other edge along the cross fiber-preferred direction (XD) (15 mm x 15 mm). After 10 cycles of preconditioning, the sample was subjected to an equibiaxial tension at TPD:TXD = 30:30 N/m. Membrane extensibility were characterized by the maximum stretches along PD (λPD) and XD (λXD) at equibiaxial tension of 30 N/m. All samples were tested in a PBS bath.

2.7

Animal Experiments The animal experiment protocol was approved by the Animal Welfare Committee of Dalian Medical

University. 30 female Sprague-Dawley (SD) rats (9-week old) weighing at 240 ± 20 g (Laboratory Animal Center of Dalian Medical University) were used for the animal experiments. Rats were anesthetized by intraperitoneal injections with pentobarbital sodium (35 mg/kg body weight). Then, a 2-cm long fullthickness incision was made on the right leg to expose the cranio-medial portion of the tibia. The rats were randomly selected and assigned as the following experimental groups (n=6 for each group): Group I (control group): After the periosteum was removed from the surgical site, a cylinder hole (2 mm in diameter, 2.5 mm in length) was drilled in the middle portion of the tibia below the knee joint using a surgical micromotor (1,000 rpm) while irrigated with cold 0.9% sterile saline solution. Then, a sterilized threaded cylindrical titanium screw (2 mm in diameter, 2.5 mm in length, Northwest Institute for Nonferrous Metal Research, China) was implanted into the cylinder hole. Group II (defect group): A cuboid defect (2 mm width × 2 mm length × 2.5 mm depth) was created adjacent to the cylinder hole and reaching to the external edge of the tibia. Only the titanium screw was implanted into the cylinder hole, and the cuboid defect was untreated. Group III (Bio-oss only group): After the cuboid defect creation and the titanium screw implantation following the same procedures described in Group II, the cuboid defect region was fully filled with Bio-oss bone particles (bovine derived, diameter: 0.25-1.00 mm, Osteohealth, Shirley, NY). 9 ACS Paragon Plus Environment

Langmuir

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 34

Group IV (Collagen group): After the implantation of the titanium screw and the Bio-oss bone particles following the same procedures described in Group III, a collagen membrane (6 mm × 10 mm, BioGide, Osteohealth, Shirley, NY) was used as the barrier membrane to cover the top of the surgical site; note that the edges of the membrane were at least 2 mm beyond the borders of the surgical site. Group V (AHAM group): the same procedure was performed as what described in group IV, except our lyophilized multilayered AHAM (8-layer, 6 mm × 10 mm) was used as the barrier membrane. The incision was closed after the above described surgical procedures.

2.8

X-ray, Micro-CT, and Histological Analyses X-ray assessment. Tibias retrieved from the rats 6 weeks post-surgery were randomly selected and

subjected to X-ray assessment (n=4 for each group). The digital radiographs of the tibias were obtained with a SOREDEX DIGORA® Optime X-ray machine (Instrumentarium Dental Inc., Finland). The imaging parameters were set at 60 kV, 8 mA, and 0.06 s, and the gray level of the bone was analyzed with the machine software. The greater mineralization density was represented by the higher degree of imaging gray level. Micro-CT Imaging. After X-ray assessment, tibias (n=4 for each group) were scanned with a highresolution micro-computed tomography (micro-CT) system (50 kV, 220 µA, Xradia MicroXCT-400) at a section interval of 18.25 µm, 3 s integration time, and an isotropic resolution of 18.676 µm. Moreover, the Biooss bone grafts were scanned separately to get the original graft density. Evaluation of new bone formation was based on the difference between the density of the Bio-oss grafts (as the baseline) and the bone density in the cuboid defect site. The region of interest was chosen in adjacent to 3-6 screw threads in the cuboid defect site (length 2.5 mm x width 1 mm x height 0.8 mm), and the total area of the defect, trabecular bone volume/total defect volume (BV/TV), newly formed trabecular thickness (Tb.Th), and trabecular number (Tb.N) were measured with the CTAN software (Skyscan, Bruker, Belgium).

10 ACS Paragon Plus Environment

Page 11 of 34

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Histology. After micro-CT scanning, tibias were fixed with 10% neutral buffered formalin for 48 hours, subjected to dehydration, and then embedded in methacrylate. Cross sections of the tibia (200–300 µm) were then cut using a diamond-precision parallel saw (EXAKT300CP, Norderstedt Germany). The region of the implantation and cuboid defect site was then reduced to a thickness of 10-15 µm by micro-grinding and polishing. The sections were stained with the toluidine blue and Methylene blue-basic fuchsin (Sigma, St. Louis, Missouri). The total percentage of the new bone coverage along the titanium screw surface and the total percentage of the matured bone inside the surgical site were measured with Image J software and listed in Table 3.

2.9

Statistical Analysis The experimental data were presented as mean ± standard deviation. One Way Analysis of Variances

(ANOVA) was used for statistical analysis, with Holm-Sidak test being used for post hoc pair wise comparisons and comparisons versus the control group; the Student’s t-test was applied for two-group comparison (SPSS, Chicago, IL). The differences were considered statistically significant when p