Key Odorants from the Fermentation Broth of the Edible Mushroom

Feb 8, 2019 - ... (OAV; 1639), vanilla-smelling 3,4-dimethoxybenzaldehyde (OAV; 51), and cherry-smelling benzaldehyde (OAV; 14) as key contributors to...
0 downloads 0 Views 657KB Size
Download PDF
Article Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/JAFC

Key Odorants from the Fermentation Broth of the Edible Mushroom Ischnoderma resinosum Purni C. K. Wickramasinghe and John P. Munafo, Jr.*

Downloaded via TULANE UNIV on February 9, 2019 at 12:10:46 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Department of Food Science, The University of Tennessee Institute of Agriculture, Knoxville, Tennessee 37996, United States ABSTRACT: Eighteen odorants were identified by applying aroma extract dilution analysis in the liquid fermentation broth of the edible mushroom Ischnoderma resinosum (P. Karst). Eight compounds with flavor dilution factors ≥16 were quantitated in a 16-day sample using stable isotope dilution assays. Odor activity values (OAV) revealed anise-smelling 4-methoxybenzaldehyde (OAV; 1639), vanilla-smelling 3,4-dimethoxybenzaldehyde (OAV; 51), and cherry-smelling benzaldehyde (OAV; 14) as key contributors to the pleasant “candy-like” odor of the fermentation broth. Odor simulation experiments revealed a mixture of five compounds in their natural concentrations mimicked the odor of a 16-day-old fermentation broth. A 30-day time course study was conducted to monitor the production of three odorants in the fungal fermentation broth, where it was revealed that both 3,4-dimethoxybenzaldehyde (10.7 ± 1.0 mg/kg) and benzaldehyde (4.5 ± 0.1 mg/kg) peaked on day 16, whereas 4methoxybenzaldehyde peaked on day 24 (104.9 ± 4.9 mg/kg). KEYWORDS: 3,4-dimethoxybenzaldehyde, solvent-assisted flavor evaporation, aroma extract dilution analysis, stable isotope dilution assay, Ischnoderma resinosum

■

INTRODUCTION Flavor compounds, both odorants and tastants, are very important in the food, beverage, and pharmaceutical industries. Global flavor markets are estimated to reach a value of 15.2 billion U.S. dollars by the year 2020, according to a recent flavor market analysis.1 Historically, plant materials have been considered the leading source of natural flavor compounds.2−4 However, low levels of odorants along with a limited supply of plant materials, seasonal variation, plant disease, and sociopolitical trade restrictions have made the utilization of plant materials to extract natural flavors increasingly expensive. Furthermore, the increase in availability of less expensive synthetic odorants has not met the demand for consumers’ preference for natural flavors, thus presenting an opportunity to use microorganisms such as fungi for the sustainable production of natural flavor compounds identical to those isolated from plants.5,6 Natural flavors are compounds obtained from living cells, including food-grade microorganisms and their enzymes in both the U.S. and Europe, allowing for the use of fungi in the production of natural flavor compounds as a viable economical alternative to traditional plant-based sources.7,8 The mushroom widely known as the late-fall polypore Ischnoderma resinosum (P. Karst) is a member of the order Polyporales belonging to the family Ischnodermataceae Jülich9 and is commonly found in North American hardwood forests. The fungal fruitbody, basidiocarp, is dark brown in color and has a velvety texture. The polypore has white flesh and is soft when young, darkening to brown and becoming tougher with maturity. The fungal flesh has a distinct mild anise-like odor and produces an amber-colored exudate.7 Fungal spores are 5− 7 × 1.5−2 μm, smooth, cylindrical, and inamyloid.10 Ischnoderma resinosum is consumed as an edible mushroom when young and has a history of consumption due to its purported medicinal properties. For example, Native Ameri© XXXX American Chemical Society

cans from the Canadian boreal forest used a tea prepared from I. resinosum fruitbodies as a treatment for cough.10 Although traditionally used for this purpose, its putative medicinal properties have not been investigated to date. Because of its reported use in indigenous applications and interesting odor profile, I. resinosum may be a promising candidate for use in food applications, including the production of natural flavor compounds. In addition to its historical consumption as food, the industrial use of I. resinosum has also been documented, including its decolorization of synthetic dyes such as orange G and Remazol Brilliant blue R. These characteristics resulted in investigations for its use in water treatment systems of industrial chemical dye factories.10 Further studies have shown that the fungus is efficient in decolorizing other environmental pollutants, including Cu-phthalocyanin and Poly R-478.11−13 Other studies have demonstrated that I. resinosum is able to biotransform xenobiotic compounds, including polycyclic aromatic hydrocarbons, polychlorinated biphenyls, and pesticides.11 As a white-rot fungus, enzymatic systems of I. resinosum are known to be involved in lignin conversion via a lignin degradation complex leading to the production of extracellular enzymes such as laccase, manganese peroxidase, and lignin peroxidase. Upon lignin degradation, these extracellular enzymes lead to the production of a wide variety of promising compounds.14 Research has shown that aromatic aldehydes, including benzaldehyde, 4-methoxybenzaldehyde, and 3,4-dimethoxybenzaldehyde, as well as other aromatic precursors such as vanillic and ferulic acids, are also produced as part of lignin degradation when colonized by Received: December 5, 2018 Revised: January 22, 2019 Accepted: January 23, 2019

A

DOI: 10.1021/acs.jafc.8b06766 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Odorants Identified in the SAFE Distillate from a 16-day-old I. resinosum Fermentation Broth RId on no.

a

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

b

odorant

odor quality

c

FFAP

DB-5

FDe

fractionf

2-methylpropan-1-ol 3-methylbutan-1-ol oct-1-en-3-ol methoxybenzene acetic acid 3-methylsulfanylpropanal 2-methylpropanoic acid benzaldehyde (E)-non-2-enal (2E,6Z)-nona-2,6-dienal butanoic acid 3-methylbutanoic acid (2E,4E)-nona-2,4-dienal (2E,4E)-deca-2,4-dienal 2-methoxyphenol γ-octalactone 4-methoxybenzaldehyde 3,4-dimethoxybenzaldehyde

malty malty mushroom fruity vinegar potato sweaty/rancid cherry fatty green sweaty/rancid sweaty/rancid fatty fatty smoky coconut anise vanilla

1082 1199 1440 1339 1439 1454 1497 1522 1531 1581 1621 1664 1699 1808 1859 1895 2028 2403

647 736 979 915 600 909 685 960 1161 1154 820 877 1217 1284 1187 1261 1263 1479

1 4 1 1 1 1 16 16 16 1 4 16 4 4 16 256 1024 256

F F E E

D B E F E E E E E F

a

Odorants numbered per retention time on the FFAP column. bIdentified by comparing retention indices on FFAP column, mass spectra, odor quality, and intensity, in comparison to data from authentic reference standards analyzed in parallel. cOdor quality as perceived during GC-O. d Linear retention index (RI). eFD factor. fFraction(s) in which odorant was detected by GC-MS after SPE fractionation; where SPE fractions are not listed, odorants were identified in the unfractionated isolate. °C and 125 rpm for 16 days on an advanced digital shaker (VWR, Radnor, PA). Reference Odorants. Reference odorants 1−18 (Table 1) along with 4-hydroxy-3-methoxybenzaldehyde, (2E,4E)-nona-2,4-dienal, and 1-octen-3-one were purchased from Sigma-Aldrich (St. Louis, MO). Isotopically Labeled Internal Standards. (2H2)-9, (2H9)-12, (2H7)-16, and (2H6)-18 were purchased from aromaLAB (Planegg, Germany) and (2H4)-7, (2H5)-8, (2H5)-19, (2H7)-15, and (2H3)-17 were purchased from C/D/N Isotopes (Quebec, Canada). Each of the isotopically labeled compounds was dissolved in freshly distilled diethyl ether or pentane in 5 mL volumetric flasks at known concentrations or quantitated using isotopically unmodified compounds as reference standards. Solvents. Chromatographic-grade diethyl ether and n-pentane were obtained from Sigma-Aldrich and freshly distilled in-house using a 250 mL CG-1233 series distillation head from Chemglass Life Sciences (Vineland, NJ) prior to use. A mixture of n-alkanes C9−C18 was obtained from Phenomenex (Torrance, CA) and n-alkanes C19− C26 were individually obtained from Sigma-Aldrich. Internal Transcriber Spacer (ITS) Sequencing, Alignment, and Species Identification. Species identity of the I. resinosum isolate was confirmed by sequencing the ITS region I, 5.8S rDNA, ITS region II, and a portion of the 28S rDNA using VersaTaq Direct PCR Polymerase (Affymetrix, Santa Clara, CA).18 ITS 4 (5′TCCTCCGCTTATTGATATGC)19 and ITS 5 (5′-GGAAGTAAAAGTCGTAACAAGG)19 primers were used to amplify the I. resinosum target region, yielding a 621 bp product. Purified DNA for PCR was prepared using a 5-day culture on PDA. PCR was conducted in 25 μL reaction volumes with the reaction tube containing 1 μL of a 10 ng/μL DNA template, 11.5 μL of 10× PCR buffer (Affymetrix), 9.5 μL of sterile distilled water, 1 μL each of 10 μM forward and reverse primers, and 1 μL of VersaTaq Direct PCR Polymerase (Affymetrix). Thermal cycling conditions included the following: 1 cycle of 95 °C for 10 min; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; 1 cycle of 72 °C for 10 min, followed by a 4 °C hold. Amplification of PCR products was confirmed by gel electrophoresis, and PCR products were purified with the ExoSAP (Affymetrix). Sanger sequencing with ITS 4 and 5 primers was performed at Molecular Cloning Lab (San Francisco, CA) using the

common white-rot fungi such as Ischnoderma benzoinum and Bjerkandera adusta.2,15 Interestingly, a European relative, I. benzoinum, has been investigated as a source of natural odorants. However, to date, the key odorants produced by I. resinosum have not been studied.14−17 The aim of this study was to evaluate the key odorants responsible for the pleasant “candy-like” odor of the I. resinosum fermentation broth. Accordingly, the objectives were to; (1) isolate and identify the key odorants present in I. resinosum using solvent-assisted flavor evaporation (SAFE) and aroma dilution extract analysis (AEDA), (2) quantitate the odorants with high flavor dilution (FD) factors by stable isotope dilution assays (SIDAs), (3) simulate the odor of I. resinosum using the quantitative results in combination with sensory experiments, and (4) quantitate the production of selected key odorants in a liquid fermentation broth over a 30day time period.

■

MATERIALS AND METHODS

Microorganism. The I. resinosum strain, UT-PW019, was isolated from a mature basidiocarp collected from Cumberland County, Tennessee. The I. resinosum isolate was decontaminated using an initial wash step with a 10% bleach solution for 10 min followed by another 15 min wash step with sterile deionized water. The fungal isolate was then cultured and maintained on petri dishes containing potato dextrose agar (PDA) consisting of potato starch (4 g/L) and dextrose (20 g/L) (BD Difco, Franklin Lakes, NJ) at 25 °C using a Panasonic MIR-254 Cooled Incubator (Panasonic Healthcare Co., Ltd., Japan). The I. resinosum isolate was cryo-preserved as multiple frozen agar plugs in 2× potato dextrose broth (PDB) consisting of potato starch (200 g/L) and dextrose (20 g/L) (Himedia, India) supplemented with glycerol (10%, v/v) using a Mr. Frosty Freezing Container (Thermo Fisher Scientific, Fair Lawn, NJ) and stored in −80 °C for future use at the University of Tennessee, Knoxville. Medium and Culture Conditions. Erlenmeyer flasks containing 85 mL of PDB were inoculated with 1 mL of homogenized 7-day-old I. resinosum mycelia grown on PDA and were grown aerobically at 25 B

DOI: 10.1021/acs.jafc.8b06766 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA). The DNA sequences were then assembled, and high-quality, doublestranded sequence data were queried against ITS region sequences in the UNITE and NCBI GenBank databases for species identification. Preparation of Odor Isolates. Sixteen-day-old I. resinosum fermentation broth (75 g) was sequentially extracted with freshly distilled diethyl ether (150 mL) on an auto shaker (VWR) at ambient temperature for 10 min. After centrifugation (2489g, 5 min) using a Sorvall RC5B plus refrigerated centrifuge (Marshall Scientific, Hampton, NH), supernatants were combined and the residue was discarded. The organic layer was isolated using a separatory funnel. The diethyl ether extract was then subjected to high-vacuum distillation using SAFE. The SAFE distillation apparatus was kept under high vacuum (10−3 Pa) and was temperature-controlled at 41 °C and the sample was gradually released into the evaporation flask over 30 min. Upon completion, the vacuum was broken, and the distillate was thawed at room temperature and dried over anhydrous sodium sulfate. The resulting sample was then concentrated to ∼2 mL using a Vigreux column (50 × 1 cm) and to 200 μL under a gentle stream of nitrogen. Gas Chromatography-Olfactometry (GC-O). A 7820A series gas chromatograph (Agilent Technologies, Santa Clara, CA) equipped with a Zebron ZB-FFAP GC capillary column (30 m × 0.32 mm o.d. × 0.25 μm film thickness) acquired from Phenomenex and a flame ionization detector (FID) was used for GC-O analysis. I. resinosum odor isolate (1 μL) was injected on-column at 35 °C. Helium was used as the carrier gas at 1.5 mL/min. The initial oven temperature was held for 1 min and then increased to 60 °C at 60 °C/min followed by an increase to 240 °C at 6 °C/min and held for 10 min. A FFAP capillary column (30 m × 0.32 m × 0.25 μm) was used for chromatographic separations and a Y-type splitter was used to split the effluent by volume (1:1) into two sections of 50 cm uncoated deactivated fused silica capillaries. One capillary section was directed toward the FID set at 250 °C and the other toward a sniffing port consisting of a custom-made aluminum cylindrical cone heated to 250 °C, housing the capillary. In parallel, the FID was maintained at 250 °C with air, hydrogen, and makeup flow rates of 450, 40, and 45 mL/ min, respectively. Upon detection by two trained panelists, the odor quality of odorants present in the effluent were recorded and the retention times per odorant were reported as averages. These retention times and those of flanking n-alkanes were used to calculate the linear retention indices (RI) using linear interpolation. Aroma Extract Dilution Analysis (AEDA). An I. resinosum SAFE isolate from a 16-day-old fermentation broth was diluted to obtain serial dilutions of 1:2, 1:4, 1:8 through 1:1024 and were analyzed on GC-O using a FFAP capillary column to obtain flavor dilution (FD) factors. FD factors corresponding to the dilution factors of the highest diluted sample in which the odor was detectable were assigned for each odorant. Gas Chromatography-Mass Spectrometry (GC-MS). GC-MS was performed on an Agilent 7820A series gas chromatograph coupled with an Agilent 5977B mass spectrometer detector. Column separation was done using a Zebron ZB-FFAP GC capillary column (30 m × 0.25 mm o.d. × 0.25 μm film thickness) from Phenomenex. An on-column injection of concentrated SAFE isolate (1 μL) was made using an auto sampler with a 5 μL syringe. Helium at a constant flow rate of 1 mL/min was used as the carrier gas. After the sample injection, the oven temperature was increased to 60 °C with a 60 °C/ min rate, then heated at 6 °C/min to 250 °C, and held for 5 min. MS was operated in electron impact (EI) ionization mode at 70 eV and a scan range of m/z 50−350. Fractionation of I. resinosum Volatile Isolate by Solid-Phase Extraction (SPE). A SAFE isolate from a 16-day-old I. resinosum fermentation broth (75 g) was prepared using freshly distilled npentane as a solvent. The silica gel SPE cartridge (Strata SI-1 Silica (55 μm, 70 Å), 2 g/12 mL) from Phenomenex affixed to a SPE vacuum manifold and was sequentially conditioned with the solvents, pentane (100%), diethyl ether (100%), and pentane (100%) (5 mL each) prior to sample loading. The SPE fractionation procedure was then performed under vacuum. Elution was conducted using 5 mL

each of the following: pentane (100%), fraction A; pentane/diethyl ether (98:2 v:v), fraction B; pentane/diethyl ether (95:5 v:v), fraction C; pentane/diethyl ether (90:10 v:v), fraction D; pentane/diethyl ether (50:50 v:v), fraction E; and diethyl ether (100%), fraction F. Each of the fractions was further concentrated to ∼200 μL under a gentle stream of nitrogen prior to GC-O and GC-MS analysis. Stable Isotope Dilution Assays (SIDA). Sixteen-day-old I. resinosum fungal fermentation broth (75 g) was combined with freshly distilled diethyl ether (150 mL) followed by the addition of isotopically labeled analogs to each of the target compounds as internal standards. Solvent extraction, SAFE distillation, and subsequent volatile isolate concentration were carried out as detailed above. Compound concentration for each of the eight odorants was calculated in μg/kg using the integrated area of the analyte peak, standard peak, amount of I. resinosum sample used, amount of standard added, and response factors (RF), determined using analysis of a mixture of analyte and standard in defined amounts. Characteristic m/z values from extracted ion chromatograms (EIC) were employed to obtain peak areas for analytes and standards. Response factor (RF) and m/z (analyte/standard) for each analyte were as follows: 7, m/z 73/77, RF 0.80; 8, m/z 106/110, RF 0.90; 9, m/z 70/72, RF 0.80; 12, m/z 60/63, RF 1.00; 15, m/z 109/113, RF 1.5; 16, m/z 85/90, RF 0.99; 17, m/z 135/138, RF 1.90; 18, m/z 166/172, RF 0.90. Odor Thresholds. OAVs for compounds 2-methylproponoic acid (7), benzaldehyde (8), (E)-non-2-enal (9), 3-methylbutanoic acid (12), 2-methoxyphenol (15) were calculated using odor threshold values in pure water provided by the Leibniz-Institute for Food Systems Biology at the Technical University of Munich based on methods described in American Society of Testing and Materials (ASTM).20 OAVs for compounds γ-octalactone (16) and 4methoxybenzaldehyde (17) were calculated using odor threshold values reported in a previous study,21 and orthonasal odor threshold value for 3,4-dimethoxybenzaldehyde (18) was determined in pure water according to ASTM methods at the University of Tennessee, Knoxville. Sensory Analyses. A 16-day old I. resinosum fermentation broth sample (2 g) placed in a 20 mL borosilicate glass scintillation vial (Thermo Fisher Scientific) was orthonasally evaluated and compared to the odor recombinant model by seven trained panelists with no olfactory impairments, in triplicate using a quantitative descriptive analysis (QDA) method. Prior to analysis, all seven panelists were introduced to the overall aroma characteristics of a 16-day-old I. resinosum fermentation broth and the key aroma attributes used in this study. 4-methoxybenzaldehyde (anise), 4-hydroxy-3-methoxybenzaldehyde (vanilla), (2E,4E)-nona-2,4-dienal (fatty), 1-octen-3-one (mushroom), benzaldehyde (cherry), and butyric acid (sweaty/ rancid) dissolved in deionized water were used as standard reference materials. A seven-point scale was used to rate each of the descriptors in 0.5 increments from 0 to 3, with 0 = not detectable, 1 = weak, 2 = moderate, and 3 = strong.21,22 Values were reported as means of triplicate measurements using Microsoft Excel for Office 365 MSO version 1811 (Microsoft Corporation, Redman, WA) and analyzed with two-way analysis of variance (ANOVA) using JMP Pro 13.0.0 software (SAS Institute, Cary, NC) with a significance level of 0.05. Time Course Study. I. resinosum fermentation broth (2 g) was combined with freshly distilled diethyl ether (3 mL) followed by the addition of a mixture of (2H5)-8, (2H3)-17, and (2H6)-18 (1:1:1; v/v) as internal standards and extracted for 10 min as described above. The organic fraction was dried over 1.5 g of anhydrous Na2SO4 (Waltham, MA) and analyzed using GC-MS. With use of the methods described above, compound concentrations for each of the three odorants were calculated in μg/kg every 2 days for a 30-day period in triplicate and values were reported as means of triplicate measurements and standard deviations using Microsoft Excel for Office 365 MSO version 1811. C

DOI: 10.1021/acs.jafc.8b06766 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. Flavor dilution chromatogram depicting the FD factors for each odorant and the corresponding linear RIs on a FFAP column. Numbers indicate odorants with FD ≥ 16.

■

RESULTS AND DISCUSSION Species Identificaion. The morphology of the I. resinosum specimen used in this study was consistent with the morphology of I. resinosum described in the literature.10 The basidiocarp of the specimen was conk-like in shape and had a pale brown color with a velvety surface texture. The fungal flesh was whitish in color, darkening to cinnamon brown upon bruising. Because of the maturity of the specimen, no distinctive odor or taste was detected. After morphological confirmation, the I. resinosum specimen was decontaminated as described above and cultured on PDA. These cultures were maintained at 25 °C. Transfers from each culture were made using fungal plugs acquired from the margin of the mycelium until a pure I. resinosum isolate was obtained. A 5-day-old I. resinosum isolate was used for ITS sequencing. The I. resinosum isolate sequenced in this study resulted in a 621 bp product with a sequence-based identification that correlated with known sequences on UNITE and NCBI GenBank databases. The homologue exhibited 99% identity at the nucleotide level, thus supporting a phenotypical identification for the fungal isolate (GenBank accession number, KJ140539). Sensory Characterization. The olfactory profile of a 16day-old I. resinosum fermentation broth sample displayed an overall and pronounced sweet “candy-like” odor predominantly characterized by anise, cherry, and vanilla odor notes, whereas subtle rancid, fatty, and mushroom odor notes were also detected in the 30-day-old I. resinosum fermentation broth. It was observed that the overall odor character of the fermentation broth altered over time with subtle changes arising in the intensity of each of the three main attributes (i.e., anise, cherry, and vanilla). AEDA and Compound Identification. Sixteen-day-old I. resinosum fermentation broth (75 g) was extracted with freshly distilled diethyl ether, subjected to SAFE distillation and concentrated. The odorant extractions were performed at ambient temperature and distillations were performed at 40 °C to avoid compound degradation or generation of artifacts. Subsequent AEDA resulted in the identification of 18 odorants with FD factors ranging from 1 to 1024 (Table 1, Figure 1). The highest FD factor, of 1024, was determined for 4methoxybenzaldehyde (anise; 17) whereas the second highest FD factor of 256 was determined for both γ-octalactone (coconut; 16) and 3,4-dimethoxybenzaldehyde (vanilla; 18). Compounds including 2-methylpropanoic acid (sweaty/rancid;

7), benzaldehyde (cherry; 8), (E)-non-2-enal (fatty; 9), 3methylbutanoic acid (sweaty/rancid; 12), and 2-methoxyphenol (smoky; 15) had FD factors of 16 whereas 3-methylbutan1-ol (malty; 2), butanoic acid (sweaty/rancid; 11), (2E,4E)nona-2,4-dienal (fatty; 13), and (2E,4E)-deca-2,4-dienal (fatty; 14) had FD factors of 4. The remaining 6 compounds including 2-methylpropan-1-ol (malty; 1), oct-1-en-3-ol (mushroom; 3), methoxybenzene (fruity; 4), acetic acid (vinegar; 5), 3-methylsulfanylpropanal (potato; 6), and (2E,6Z)-nona-2,6-dienal (green; 10) had FD factors of 1. The structure for each odorant identified during this study was assigned based on odor characteristics as determined by GCO, RIs on FFAP and DB-5 columns, and mass spectrum in comparison to commercially obtained authentic reference standards. Interestingly, while a strong coconut odor at (RI; 1895) was detected during AEDA of the 16-day-old I. resinosum SAFE isolate, no MS signal could be located during GC-MS analysis because of coelution with 4-methoxybenzaldehyde (anise; 17). Similarly, an odorant with a characteristic green odor (RI; 1581) was also identified during AEDA of the 16-day-old I. resinosum SAFE isolate with no identifiable MS signal because of coelution with interfering volatiles. Therefore, to aid in the identification of the unknown odorants with coconut (RI; 1895) and green (RI; 1581) odor qualities, SAFE isolates prepared in pentane were subjected to SPE fractionation. Six SPE fractions were then analyzed using GC-O and GC-MS. Both odorants with coconut odor at (RI; 1895) and a characteristic green odor (RI; 1581) were identified as γoctalactone (coconut; 16) and (2E,6Z)-nona-2,6-dienal (green; 10), respectively, in the SPE fraction E. This is the first report to identify these 18 odorants from I. resinosum, the North American Ischnoderma species. However, previous studies have documented odorants such as benzaldehyde, 4-methoxybenzaldehyde, and 3,4-dimethoxybenzaldehyde in the European Ischnoderma species, I. benzoinum. It is worth noting that because of taxonomical changes, I. benzoinum was previously referred to as I. resinosum (synonym). As a result, knowing what species was used in a given study can be confusing, and results are difficult to interpret; however, determining whether the isolate used in the study was from North America or Europe helps resolve the ambiguity.13,23,24 Further complicating the taxonomic designation, some references indicate that I. resinosum growth is D

DOI: 10.1021/acs.jafc.8b06766 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Table 2. Concentrations, Odor Thresholds, and Odor Activity Values (OAV) of Major Odorants in a 16-Day-Old I. resinosum Fermentation Broth no.

odorant

odor quality

concna (μg/kg)

odor thresholdb (μg/kg)

OAVc

17 18 8 9 16 15 12 7

4-methoxybenzaldehyde 3,4-dimethoxybenzaldehyde benzaldehyde (E)-non-2-enal γ-octalactone 2-methoxyphenol 3-methylbutanoic acid 2-methylpropanoic acid

anise vanilla cherry fatty coconut smoky sweaty/rancid sweaty/rancid

44247.7 10693.8 4488.8 1.0 14.9 1.1 10.9 6.0

27 210 320 0.19 6 19 490 8100

1639 51 14 5 2