Anal. Chem. 2004, 76, 5953-5959
Kinetics of Ion-Exchange Binding of Redox Metal Cations to Thiolate-DNA Monolayers on Gold Li Su,† Carlo G. Sankar,‡ Dipankar Sen,†,‡ and Hua-Zhong Yu*,†
Department of Chemistry and Department of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, British Columbia V5A 1S6, Canada
The ion-exchange kinetics of metal cation binding to and dissociation from thiolate-DNA monolayers on gold can be monitored by a simple electrochemical protocol. The apparent first-order rate constants were obtained by analyzing the time-dependent voltammetric behavior of the redox cation [Ru(NH3)6]3+. It was found that the binding kinetics is dominated by the structural nature of the film; i.e., the apparent first-order rate constant (kapp) decreases significantly upon increasing the surface density of DNA strands. Dissociation rate constants were obtained by transferring the incubated electrode into redox-free buffer solution. The kinetic data augment our fundamental understanding of metal ion-DNA interactions and are critical to ensure the accuracy and reliability of experimental DNA detection protocols. Electrostatic interactions with metal ions are essential to the structural stability and polymorphism of oligonucleotides.1 Without the presence of mobile cations near the DNA strands to neutralize the negative charges of the phosphate groups, the repulsion between the phosphodiester backbones would drive the double helix apart. Beyond this fundamental function and their importance as model systems for DNA-protein interactions,2 electrostatic binding of metal to DNA has also been found useful in the construction of nanometer electrical circuits and the development of DNA detection technology.3 For example, Braun et al.3a reported the templated formation of silver nanowires based on the selective localization of silver ions along the DNA strands via Ag+/Na+ exchange and the formation of complexes between silver and the DNA bases. On the basis of the binding of light-harvesting cationic conjugated polymers to surface immobilized DNA probes, Gaylord et al.3c have proposed sensitization of the emission of a dye on a specific peptide nucleic acid (PNA) sequence for the purpose of homogeneous “real-time” DNA detection. * To whom correspondence should be addressed. E-mail:
[email protected]. † Department of Chemistry. ‡ Department of Molecular Biology and Biochemistry. (1) (a) Barton, J. K.; Lippard, S. J. In Nucleic Acid-Metal Ion Interactions; Spiro, T. G., Ed.; John Wiley & Sons: New York, 1980; pp 60-88. (b) Subirana, J. A.; Soler-Lopez, M. Annu. Rev. Biophys. Biomol. Struct. 2003, 32, 27-45. (2) (a) Neidle, S. DNA structure and recognition; Oxford University Press: Oxford, 1994; pp 71-96. (b) Persson, B.; Buckle, M.; Stockley, P. G. In DNA-Protein Interactions: A Practical Approach; Travers, A., Buckle, M., Ed.; Oxford University Press: New York, 2000; pp 257-281. (3) For example, see: (a) Braun, E.; Eichen Y.; Sivan, U.; Ben-Yoseph, G. Nature 1998, 391, 775-778. (b) K’Owino, I. O.; Agarwal, R.; Sadik, O. A. Langmuir 2003, 19, 4344-4350. (c) Gaylord, B. S.; Heeger, A. J.; Bazan, G. C. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 10954-10957. 10.1021/ac0494331 CCC: $27.50 Published on Web 09/04/2004
© 2004 American Chemical Society
In the past, metal ion-DNA interactions have been investigated by NMR, X-ray diffraction, and molecular spectroscopy.1,4 The application of electrochemistry provides a useful complement to these methods,5-7 initially in the study of the interactions of chelated metal cations with calf thymus DNA in solution.6 Mikkelsen and co-workers demonstrated about a decade ago that immobilized DNA (on activated glassy carbon electrodes) can be detected voltammetrically using redox indicators ([Co(bpy)3]3+ and [Co(phen)3]3+).8 Pang and Abrun ˜a studied the binding thermodynamics between redox cations ([Co(bpy)3]3+, [Co(phen)3]3+, and benzyl viologen) and calf thymus DNA deposited on a gold electrode.9 The interaction between [Co(phen)3]3+ and DNA adsorbed on a carbon paste electrode was also examined by Erdem et al.10 Current progress in self-assembly techniques has contributed significantly to the study of metal ion-DNA interactions on surfaces, particularly via the formation of thiolate DNA monolayers on gold.11 These model systems are of special interest because they are easily prepared and molecularly modified; they have been used to study long-range electron transfer through the DNA double helix and to examine the correlation between DNA (4) For examples, see: (a) Bleam, M. L.; Anderson, C. F.; Record, T. R., Jr. Proc. Natl. Acad. Sci. U.S.A. 1980, 77, 3085-3089. (b) Rehmenn, J. P.; Barton, J. K. Biochemistry 1990, 29, 1701-1709. (c) Braunlin, W. H.; Xu, Q. W. Biopolymers 1992, 32, 1703-1711. (d) Gao, Y. G.; Sriram, M.; Wang, H.-J. Nucleic Acids Res. 1993, 21, 4093-4101. (e) Coates, C. G.; Jacquet, L.; McGarvey, J. J.; Bell, S. E. J.; Alobaidi, A. H. R.; Kelly, J. M. J. Am. Chem. Soc. 1997, 119, 7130-7136. (5) Swiatek, J. J. Coord. Chem. 1994, 33, 191-217. (6) (a) Carter, M. T.; Bard, A. J. J. Am. Chem. Soc. 1987, 109, 7528-7530. (b) Carter, M. T.; Rodriguez, M.; Bard, A. J. J. Am. Chem. Soc. 1989, 111, 8901-8911. (7) (a) Horrocks, B. R.; Mirkin, M. V. Anal. Chem. 1998, 70, 4653-4660. (b) Aslanoglu, M.; Isaac, C. J.; Houlton, A.; Horrocks, B. R. Analyst 2000, 125, 1791-1798. (8) (a) Millan, K. M.; Mikkelsen, S. R. Anal. Chem. 1993, 65, 2317. (b) Millan, K. M.; Saraullo, A.; Mikkelsen, S. R. Anal. Chem. 1994, 66, 2943. (9) (a) Pang, D. W.; Abrun ˜a, H. D. Anal. Chem. 1998, 70, 3162-3169. (b) Pang, D. W.; Abrun ˜a, H. D. Anal. Chem. 2000, 72, 4700-4706. (10) Erdem, A.; Meric, B.; Kerman, K.; Dalbasti, T.; Dalbsti, T.; Ozsoz, M. Electroanalysis 1999, 11, 1372-1376. (11) For examples of studies of thiolate-DNA monolayers on gold, see: (a) Herne, T. M.; Tarlov, M. J. J. Am. Chem. Soc. 1997, 119, 8916-8920. (b) Kelley, S. O.; Jackson, N. M.; Hill, M. G.; Barton, J. K. Angew. Chem., Int. Ed. Engl. 1999, 38, 941-945. (c) Yu, C. J.; Wan, Y. J.; Yowanto, H.; Li, J.; Tao, C. L.; James, M. D.; Tan, C. L.; Blackburn, G. F.; Meade, T. J. J. Am. Chem. Soc. 2001, 123, 11155-11161. (d) Kertesz, V.; Whittemore, N. A.; Chambers, J. Q.; McKinney, M. S.; Baker, D. C. J. Electroanal. Chem. 2000, 493, 28-36. (e) Hartwich, G.; Caruana, D. J.; de Lumley-Woodyear, T.; Wu, Y. B.; Campbell, C. N.; Heller, A. J. Am. Chem. Soc. 1999, 121, 1080310812.
Analytical Chemistry, Vol. 76, No. 19, October 1, 2004 5953
structure and its biomolecular recognition properties. Important technological advances in the DNA-based electrochemistry have been summarized in several recent review articles;12 we note that a few examples focused on the ion-exchange binding of metal ions to surface-bound DNA. Maeda et al. proposed to use gold electrodes modified with thiolate-DNA monolayers as receptive entities for sensing metal cations (e.g., Mg2+, Ca2+, Na+, and K+) and anticancer drugs (e.g., acridine orange) on the basis of the enhanced voltammetric response of [Fe(CN)6]3-/4- in the presence of cationic analytes.13 Gooding et al. reported a label-free electrochemical detection protocol for DNA hybridization based on the change in flexibility of DNA monolayers upon binding of the complementary strands.14 Tarlov and co-workers made a significant contribution by using chronocoulometry to quantitate the density of DNA probes and to monitor the heterogeneous hybridization event on the gold surface.15 In a recent publication,16 we described a simple voltammetric procedure to study DNA-modified surfaces (including DNA probe quantitation, cation binding thermodynamics, and electron-transfer kinetics) based on the electrochemical behavior of multiply charged transition metal cations bound to DNA strands. The key feature of our approach is the easy distinction of the surface waves from the signals of diffused species by using micromolar concentrations of the redox molecules.16 In comparison with other electrochemical methods,11c-d,17,18 the attractive aspects of the voltammetric studies are the experimental simplicity and the ease of interpretation of the results. Cyclic voltammetry has been a popular technique for initial electrochemical studies of new systems and has been proven useful for gathering information about complicated electrode reactions. The main advantages of our method over the chronocoulometric scheme15a are the easier application of corrections for background contribution to the charge and the more direct route to electron-transfer rate constants.16 In this paper, we demonstrate that our simple voltammetric protocol can be used to explore the kinetics of metal ion-DNA interactions on surfaces. Very little is known about the binding kinetics of metal cations to DNA either in solution or on surfaces,9b though electrochemical methods have long been used to study the kinetics of the adsorption of conventional molecules and (12) For recent reviews of DNA-based electrochemical sensors, see: (a) Drummond, T. G.; Hill, M. G.; Barton, J. K. Nat. Biotechnol. 2003, 21, 11921199. (b) Vercoutere, W.; Akeson, M. Curr. Opin. Chem. Biol. 2002, 6, 816-822. (c) Fojta, M. Electroanalysis 2002, 14, 1449-1463. (d) Wang, J. Chem.sEur. J. 1999, 5, 1681-1685. (13) (a) Maeda, M.; Nakano, K.; Uchida, S.; Takagi, M. Chem. Lett. 1994, 18051808. (b) Nakano, K.; Maeda, M.; Uchida, S.; Takagi, M. Anal. Sci. 1997, 13, 455-456. (14) Gooding, J. J.; Chou, A.; Mearns, F. J.; Wong, E.; Jericho, K. L. Chem. Commun. 2003, 1938-1939. (15) (a) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Anal. Chem. 1998, 70, 46704677. (b) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Bioconjugate Chem. 1999, 10, 419-423. (16) Yu, H. Z.; Luo, C. Y.; Sankar, C. G.; Sen, D. Anal. Chem. 2003, 75, 39023907. (17) Whittemore, N. A.; Mullenix, A. N.; Inamati, G. B.; Manoharan, M.; Cook, P. D.; Tuinman, A. A.; Baker, D. C.; Chambers, J. Q. Bioconjugate Chem. 1999, 10, 261-270. (18) (a) Patolsky, F.; Weizmann, Y.; Willner, I. J. Am. Chem. Soc. 2002, 124, 770-772. (b) Patolsky, F.; Katz, E.; Willner, I. Angew. Chem., Int. Ed. 2002, 41, 3398-3402. (c) Gore, M. R.; Szalai, V. A.; Ropp, P. A.; Yang, I. V.; Silverman, J. S.; Thorp, H. H. Anal. Chem. 2003, 75, 6586-6592. (d) Kim, E.; Kim, K.; Yang, H.; Kim, Y. T.; Kwak, J. Anal. Chem. 2003, 75, 56655672.
5954
Analytical Chemistry, Vol. 76, No. 19, October 1, 2004
molecular recognition on surfaces.19-22 Herein, we chose a multiply charged transition metal cation, [Ru(NH3)6]3+, as model system, in part because of its ideal electrochemical response.15,16 The analogous transition metal complex [Co(NH3)6]3+ has been widely used as a “biochemically inert” substitute for the alkaline earth metals (e.g., Mg2+, which interacts in the form of [Mg(H2O)6]2+ with DNA/RNA) because of similar size and octahedral geometry (although different charge) of the two molecules.23,24 EXPERIMENTAL SECTION Materials. The synthetic DNA oligonucleotide 5′TTTAGCTGACGTCAGATCGA3′ and the disulfide derivative of its complementary strand, DMT-O-C6-S-S-C6-O-5′TCGATCTGACGT CAGCTAAA3′, were purchased from Core DNA Services Inc. (Calgary, AB). The 5′-thiol modifier was from Glen Research (Sterling, VA). The DMT(dimethoxytrityl) group protects the disulfide and serves as an appropriate hydrophobic group for HPLC purification. Glass slides coated with 10 nm of titanium (to improve adhesion) and 100 nm of gold were obtained from Evaporated Metal Film (EMF) Inc. (Ithaca, NY). 6-Mercapto-1-hexanol (MCH) and hexaamine ruthenium (III) chloride (98%) were obtained from Sigma-Aldrich (Milwaukee, WI) and used as received. Deionized water (>18.3 MΩ‚cm) was from a Barnstead EasyPure UV/UF compact water system (Dubuque, IA). Different buffers were employed for specific experimental tasks. For DNA hybridization and immobilization, 10 mM Tris buffer/0.1 M MgCl2/1 M NaCl at pH 7.4 (buffer A) was used. Electrodes were rinsed successively with 10 mM Tris buffer/50 mM NaCl, pH 7.4 (buffer B) and 10 mM Tris buffer/10 mM NaCl, pH 7.4 (buffer C). Electrochemical characterizations were performed in 10 mM Tris buffer (at pH 7.4) containing different concentrations of Ru(NH3)6Cl3. DNA Purification. The disulfide-derivatized oligomer was deprotected with saturated NH3‚H2O at 55 °C for 12 h and then purified by reversed-phase HPLC on a C18 Vydac column (218TP54). The sample was then treated with 100 mM DTT (dithiothreitol) at pH 8.5 for 30 min and passed through a Pharmacia Nap-5 column (G-25 Sephadex) to yield pure thiolterminated ssDNA, HS-C6-O-5′TCGATCTGACGTCAGCTAAA3′. Surface Preparation. The gold-coated slides (2 × 2 cm2) were cleaned by immersion in a “piranha” solution (a mixture of 70% concentrated sulfuric acid and 30% hydrogen peroxide) for 5 min at about 90 °C. WARNING: Piranha solution reacts violently with organic solvents, and should be handled with extreme care. They were rinsed thoroughly with deionized water and dried under N2. Gold electrodes modified with single-stranded DNA (ssDNA/Au) were prepared by spreading 100 µL of 10 µM solution of the thiolterminated ssDNA in buffer A over the cleaned gold surface for 1 min to 24 h (in order to control the surface density of the DNA strands) at ambient conditions. After modification, the sample was rinsed with buffer B, buffer C, and 10 mM Tris buffer, immersed in a 1.0 mM MCH solution for 1 h, rinsed again with 10 mM Tris buffer, and dried under N2 before characterization. To prepare (19) Tirado, J. D.; Acevedo, D.; Bretz, R. L.; Abrun ˜a, H. D. Langmuir 1994, 10, 1971-1979. (20) (a) Campbell, J. L. E.; Anson, F. C. Langmuir 1996, 12, 4008-4014. (b) Bhugun, I. Anson, F. C. J. Electroanal. Chem. 1997, 439, 1-6. (21) Hu, K.; Bard, A. J. Langmuir 1998, 14, 4790-4794. (22) Bourdillon, C.; Demaille, C.; Moiroux, J.; Save´ant, J.-M. J. Am. Chem. Soc. 1999, 121, 2401-2408.
gold electrodes modified with double-stranded DNA (dsDNA/ Au), we first hybridized the 10 µM solution of the thiol-terminated ssDNA in deoxygenated buffer A with its complementary strand by heating to 90 °C, followed by slow cooling to room temperature, and then used the procedure described above for the preparation of ssDNA/Au. Instrumentation. Cyclic voltammetry was performed with a µAutolab II potentiostat/galvanostat (EcoChemie B. V., Utrecht, The Netherlands). A one-compartment and three-electrode Teflon cell was used for the measurements. Gold slides modified with double-stranded (dsDNA/Au) or single-stranded (ssDNA/Au) oligonucleotides were used as working electrodes and pressed against an O-ring seal at the cell bottom (with an exposed area of 0.68 cm2). A Ag|AgCl| 3 M NaCl electrode was used as reference electrode, and the counter electrode was a Pt wire. RESULTS AND DISCUSSION Preliminary Remarks. Similar to long-chain n-alkanethiols,25 thiolate DNA single strands and double strands attach to gold via strong sulfur-gold linkages and form stable high-density monolayers.11,16 To improve the quality, gold substrates modified with DNA monolayers were treated with dilute solutions of 6-mercapto-1-hexanol (MCH). It has been suggested that the stronger affinity of the thiol group of MCH for gold results in the displacement of less strongly adsorbed bases and that the net negative dipole of the alcohol terminus repels the negatively charged DNA backbone, thus helping to project the DNA strands into solution.26 Upon prolonged incubation in a solution containing multiply charged metal complexes, such as [Ru(NH3)6]3+, at low ionic strength, an ion-exchange equilibrium between these transition metal cations, and the native charge compensation ions (represented by Na+) associated with the anionic DNA backbone is established.15,16 The voltammetric response as a function of the solution concentration of [Ru(NH3)6]3+ has been analyzed in earlier studies by fitting to the Langmuir isotherm given in eq 1,15b,16
C 1 C ) + Γeq Γsat KΓsat
(1)
where Γeq ) Q/nFA is the equilibrium quantity of [Ru(NH3)6]3+ bound to the DNA monolayer from a solution at concentration C, Γsat is the saturation quantity at higher concentration, and K is the binding equilibrium constant. Q is the integrated charge of the reduction of surface-bound [Ru(NH3)6]3+, and A is the electrode area. The linearity of the plot of C/Γeq vs C indicated that the binding isotherm can be described by eq 1, and the values of the interaction equilibrium constants were thus obtained.16 On the basis of the saturation quantity of [Ru(NH3)6]3+ at higher concentration (5.0 µM), we were able to determine the surface density of DNA strands (ΓDNA/Au) from eq 2,
ΓDNA/Au ) Γsat
(mz )N
A
(2)
where m is the number of nucleotides in the DNA, z is the charge (23) Rudisser, S.; Tinoco, Jr., I. J. Mol. Biol. 2000, 295, 1211-1223. (24) Maguire, J. L.; Collins, R. A. J. Mol. Biol. 2001, 309, 45-56.
Figure 1. Cyclic voltammograms of 0.5 µM [Ru(NH3)6]3+ on ssDNA/ Au (A) and of 2.5 µM [Ru(NH3)6]3+ on dsDNA/Au (B). The dashed lines show the steady-state CVs (i.e., after prolonged incubation in the [Ru(NH3)6]3+ containing electrolyte). The electrolyte is 10 mM Tris buffer at pH 7.4, and the scan rate is 50 mV/s.
of the redox cation, and NA is Avogadro’s number. The validity of eq 2 is based on the assumption that the penetration of the DNA monolayers by [Ru(NH3)6]3+ results in ejection of monocatios on a 1:1 (charge) basis, which is certainly true when the concentration of redox metal cations is high and the incubation time is adequate. At low concentrations (
