Ligand Characteristics Important to Avidity ... - ACS Publications

Subscriber access provided by University of Colorado Boulder

Article

Ligand Characteristics Important to Avidity Interactions of Multivalent Nanoparticles Ming-Hsin Li, Hong Zong, Pascale R. Leroueil, Seok Ki Choi, and James R. Baker Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00098 • Publication Date (Web): 11 Apr 2017 Downloaded from http://pubs.acs.org on April 12, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Ligand Characteristics Important to Avidity Interactions of Multivalent Nanoparticles

Ming-Hsin Li,a,b Hong Zong,b,c Pascale R. Leroueil,b,c Seok Ki Choib,c and James R. Baker, Jr* a,b,c a

Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109, USA

b

Michigan Nanotechnology Institute for Medicine and Biological Sciences, University of

Michigan, Ann Arbor, MI 48109, USA c

Department of Internal Medicine, University of Michigan, Ann Arbor, MI 48109, USA

*

To whom correspondence should be addressed,

Email: [email protected]; Phone: (734) 647-2777; Fax: (734) 936-2990

KEYWORDS: Nanoparticle, Avidity, Heterogeneity, Multivalent Binding, Oligonucleotide

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

Abstract: Multivalent interactions involve the engagement of multiple ligand-receptor pairs and are important in synthetic biology as design paradigms for targeted nanoparticles (NPs). However, little is known about the specific ligand parameters important to multivalent interactions. We employed a series of oligonucleotides as ligands conjugated to dendrimers as nanoparticles, and used complementary oligonucleotides on a functionalized SPR surface to measure binding. We compared the effect of ligand affinity to ligand number on the avidity characteristics of functionalized NPs. Changing the ligand affinity, either by changing the temperature of the system or by substitution non-complementary base pairs into the oligonucleotides, had little effect on multivalent interaction; the overall avidity, number of ligands required for avidity per particle and the number of particles showing avidity did not significantly change. We then made NP conjugates with the same oligonucleotide using an efficient copper-free click chemistry that resulted in essentially all of the NP in the population exceeding the threshold ligand value. The particles exceeding the threshold ligand number again demonstrated high avidity interactions. This work validates the concept of a threshold ligand valence and suggests that the number of ligands per nanoparticle is the defining factor in achieving high avidity interactions.

2


Page 3 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Multivalency is an important phenomenon in synthetic biology as it can create high avidity interactions between macromolecules through the engagement of multiple ligand-receptor pairs.17

Multivalent interactions result in binding avidities between the objects that are orders of

magnitude greater than the interaction in a single ligand-receptor pair.1 Examples of avidity interactions include infectious agents binding to target cells, the facilitation of inflammatory responses and even the tight junctions that hold cells together.1-7 These interactions vary greatly in kinetics, involving actions like facilitating the efficient targeting of viruses to specific cell membranes, or promoting neutrophils to first roll, then adhere and flatten as they migrate from inflamed vascular endothelium. These interactions are ubiquitous and underlie most important biological phenomena. We recently developed a Surface Plasmon Resonance (SPR)-based analytical method that showed that avidities of multivalent nanoparticles (NPs) for targeted surfaces are modulated by the number of functionalized ligands present on the particle.8 This work showed that NPs with affinity ligands could be broadly separated into those demonstrating “weak” and “strong” adhesion to functionalized surfaces based on, respectively, fast vs. slow dissociation from the target surface. These results indicated that a threshold number of ligands per NP is required for a high avidity interaction between the particle and the surface to achieve a slow-dissociation. From a practical standpoint, it also suggested that one could design multivalent NPs with homogenously strong binding avidity by ensuring that every NP had a ligand number surpassing this threshold valence. To further evaluate these issues and determine the most important factors in achieving multivalency we employed amide and copper-free Click chemistries to conjugate two different complementary oligonucleotide ligands (for the surface functionalized sequence) to generation 5 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 28

(G5) poly(amidoamine) (PAMAM) dendrimers and then evaluated the number of “weak” and “strong” avidity NPs in each synthesized population. The present studies show that the intrinsic affinity of the oligonucleotide ligand and the conjugation chemistry has minimal influence on the number of NP exhibit ‘strong’ adhesion. The defining factor in determining whether particles achieve multivalency is the number of ligands per NPs and whether that number exceeds a threshold value necessary for high avidity surface binding. Dendrimer NP conjugated with oligonucleotide ligand. To examine the effect of temperature on NP binding kinetics, a multivalent dendrimer G5(Oligo1)6 which contains an average of six molecular copies of oligonucleotide 1 (Oligo1) per dendrimer NP was synthesized as reported previously by Li, et al. (Figure 1).8 This dendrimer conjugate and a complementary oligonucleotide result in a affinity interaction where changes in the temperature of the system around the annealing temperature of the oligonucleotides alters the strength of the interaction.9 Changes in affinity can also be achieved by altering the sequence of one of the oligonucleotides. A NP conjugated ligand, Oligo1, is an 8-mer oligonucleotide with a sequence complementary to an 8-mer sequence encoded in a longer 25-mer oligonucleotide that is immobilized on the surface of a biosensor chip (Figure S1, Supporting Information). The coupling of Oligo1 to G5 PAMAM dendrimer was performed using a surface modified dendrimer (Ac)90G5(glutaric acid)24 by amide conjugation chemistry between a primary amine terminated in the C6 spacer placed at its 5’ end and a dendritic glutaryl group (length of the spacer ~1.4 nm estimated at its extended conformation).

4


Page 5 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Structures of three types of oligonucleotide-conjugated G5 PAMAM dendrimer, G5(Oligo1)6, G5(Oligo2)6, and G5(Oct-Oligo1)13, each functionalized with a single stranded (ss) oligonucleotide (Oligo1 or Oligo2) by either an amide ligation or a cyclooctyne (Oct)-azide click method. The length given in each spacer is an estimate calculated from a 3D model constructed by MM2 simulation (Chem3D 15.0). Binding kinetics of G5(Oligo1)6 under a variable-temperature condition. A sensor chip for SPR binding experiments was prepared by treating the surface of a streptavidin (SA)-coated sensor chip with a biotinylated 25-mer oligonucleotide containing the 8-mer complement of Oligo1 (Figure S1). Thus the immobilization of the 25-mer oligonucleotide to the chip surface was based on the pseudo-irreversible SA-biotin association (KD ~ 10−15), while excess, unimmobilized free oligonucleotide molecules were washed off. The binding kinetics of Oligo1 and its multivalent conjugate G5(Oligo1)6 was investigated under a variable-temperature condition (15, 20, 25, 30, 35°C), each controlled precisely within ±0.1°C. 5



Response Unit (RU) Response Unit (RU) Fraction (slow)

Response Unit (RU)

Response Unit (RU)

Field Code Changed

RU (max)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 28

Figure 2. SPR binding curves of G5(Oligo1)6 acquired at 15°C, 20°C, 30°C and 35°C (Panels A–D, [G5(Oligo1)6]injected = 62.5 nM). The duration in the association phase varied from 2 to 10 minutes, however there was minimal binding at 2 minutes 35oC so these data are not included. During the disassociation phase, # indicates the change to the high-flow wash cycle. Also documented are the response unit (max) of total NPs bound (Panel E) and fraction of slowly dissociating (tightly bound) subpopulations (Panel F) as a function of temperature. The tightly

6


Page 7 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bound, or slow disassociating fraction = RUslow

dissociation/RUmax

(as defined in Figure 2D). The

slow binding fraction (Figure 2F) increased minimally from 0.3 to 0.5 at higher temperatures, but was not significantly different from the 15oC and 20oC temperatures in part because of the variability in baseline measures at the higher temperatures (P=0.74, repeated measures ANOVA). Effect of temperature-induced changes in affinity interactions on multivalent NP binding. Representative SPR binding (association and dissociation) curves of G5(Oligo1)6 (62.5 nM) were acquired under several different temperatures as presented in Figure 2. The values of RUmax (equivalent to the absolute amount of bound NPs; 1000 RUs ~ 1 ng/mm2) increased in response to the length of association as reported earlier,8 and the changes observed by temperature variation were in the same order of magnitude. RUmax values measured at the end of each association phase (2–10 min) show an strong, inverse correlation between temperature and RUmax, which resulted in markedly higher RUs at lower temperatures (Figure 2E); however this resulted in only a 2-3 fold difference in avidity (Figures 2E and 2F). The decrease in low affinity interactions is consistent with less stable dsDNA annealing involving hydrogen bonds and base pairing of dsDNA at higher temperatures, leading to greater dissociations between two interacting oligonucleotide strands.10 In contrast, the fractions of NP subpopulations demonstrating multivalent binding (i.e., those that remain tightly bound at the end of dissociation phase relative to total bound NP populations [fraction = RUslow

dissociation/RUmax],

Figure 2F)

increased at slightly higher temperatures, but this difference was not statistically significant (~0.45–0.5 at 30o and 35°C vs. ~0.35 at 15o or 20°C, p=0.74, ANOVA). This shows that temperature alters low affinity binding more than multivalent interactions. Quantitative analysis of binding kinetics. We performed a quantitative analysis to extract kinetic parameters for the interactions based on the SPR binding data. This analysis generated 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 28

rate constants for association (kon, M−1s−1) and dissociation (koff, s−1), and equilibrium dissociation constant (KD = koff/kon, M) of the overall interaction. The kinetic parameters for Oligo1 were extracted using a 1:1 Langmuir kinetic model while those for G5(Oligo1)6 were extracted using a dual Langmuir model in combination with the parallel initial rate analysis as described earlier (Figure S2).8 The best fit for the activity of the bound NPs was generated by a model that includes a linear combination of two subpopulations that are distinguished primarily by the rate of dissociation. These two subpopulations are referred to as having fast (monovalent-like) and slow dissociation, respectively. The fractional values of fast and slow subpopulation obtained at 25°C are 0.9 and 0.1, respectively, as shown in Table 1. Kinetic binding parameters for Oligo1 and G5(Oligo1)6 are summarized for comparison at two temperatures in Table 1(25°C and 35°C), and also plotted in Figure 3 along with the same set of parameters determined at temperatures (for the full data set, see Table S1). The estimated kinetic parameters allowed a quantitative analysis of the temperaturedependent variations in NP binding, as shown in Figure 2. First, KD values for Oligo1 and G5(Oligo1)6 are significantly larger (lower affinity) at higher temperatures, indicative of an inverse relationship between affinity and temperature. In contrast, the decrease in avidity (slow disassociation population) at higher temperatures of G5(Oligo1)6 (e.g., ratio = KD,35°C/KD,25°C = 1.5) than the changes observed with either the monovalent-like subpopulation of fast dissociation (ratio = 4.7) or monovalent Oligo1 (ratio = 34) (Table 1 and Figure 3B). Thus, these data confirm that at physiological temperatures (30-35oC) multivalent interactions are maintained while monovalent interactions are significantly reduced. This provides further evidence of the need for multivalent interactions with NPs for biological targeting1. 8


Page 9 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Kinetic parameters for SPR binding of oligonucleotide 1 (Oligo1) and G5(Oligo1)6 at two representative temperatures. Ligand

Oligo1

Temp (°C) 25

Monovalent

4.34 × 10

35

Monovalent

7.56 × 10

Fast (0.9)

4.61 × 10

Slow (0.1)

3.37 × 10

Fast (~0.5)

4.34 × 10

Slow (~0.5)

1.64 × 10

25 G5(Oligo1)6 35

a

Subpopulation k (s−1) off (Fraction)a

−1 −1

kon (M s ) −2

−1

−2

−4

−2

−4

5.36 × 10 2.71 × 10 3.31 × 10 3.10 × 10 6.67 × 10 9.96 × 10

4

4

4

4

3

3

MEFb

KD (M) −7

1

−5

1

−6

0.6

−8

74.4

−6

4.3

−8

1690.9

8.11 × 10

2.79 × 10 1.39 × 10 1.09 × 10 6.51 × 10 1.65 × 10

extracted by dual Langmuir kinetic analysis;8 bmultivalent enhancement factor (= KDoligo1/KDNP)

calculated at an identical temperature

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Oligo1

Fast, G5(Oligo1)6

Page 10 of 28

Slow, G5(Oligo1)6

(B)

(A)

Temp (oC)

Temp (oC)

(D)

(C)

Fr = 0.88 0.20 0.18 0.16 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00

Fr = 0.12

0 2 4 6 8 10 12 14 16 18 20 22 24

Temp (K)

#Oligo1 per G5(Oligo1)6

Figure 3. (Panels A–C) Values of koff, KD and free energy ∆G of binding for the two G5(Oligo1)6 nanoparticle subpopulations defined by their disassociation (fast and slow) plotted as a function of flow temperature. The values of free Oligo1 are also placed as a reference for monovalent binding. ∆G = −RTln(KA). (Panel D) Poisson distribution of oligo number in the population of G5(Oligo1)6 NPs (mean valency n = 6). The fraction of NP distributions demonstrating low affinity interactions (in green, 88% of the total) or orange (0.12) columns is close to the fraction of fast (Fr = 0.9) or slow (Fr = 0.1) subpopulations, respectively (25°C, Table 1). Threshold ligand valence. The average avidity of the slow fraction in G5(Oligo1)6 (KD = 10.9 nM) shows 74-fold and 127-fold enhancement in binding avidity over monomer Oligo1 (KD 10


Page 11 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


= 811 nM) and the fast fraction (KD = 1390 nM), respectively (25°C, Table 1). In order to identify the specific group of NP species that accounts for the slow (Fr = 0.1) dissociation subpopulations, we performed Poisson ligand distribution analysis.11 It was performed assuming a mean ligand valence of 6 and 24 available reactive sites for ligand conjugation on the dendrimer (Figure 1). The Poisson ligand distribution is shown in Figure 3D and is composed of diverse multivalent species (n = 1–11; median = mode = 6). Following a general assumption that binding avidity is positively correlated with ligand valence,1, 12-14 we examined an upper limit of ligand valency that gives a sum of distributions close to the fraction (10%) of the slowly dissociating (high avidity) subpopulation. A ligand valence of ≥9 oligos per dendrimer leads to ~12%, which is close to the observed high avidity subpopulation. Thus, we feel this value approximates the threshold oligonucleotide number per dendrimer required to achieve high avidity interactions (n = 9 at 25oC). Importantly, the multivalent, high avidity interaction of G5(Oligo1)6 with the SPR surface is minimally altered by temperature; the KD values of this interaction varies less than an order of magnitude as compared to a change of three orders of magnitude for the KD of monomeric Oligo1 over temperature range of 15–35°C (Table S1). In addition, the specific threshold oligonucleotide values required for high avidity binding were not significantly temperaturedependent (n=8 at 15oC, n=approximately 5 to 6 at 20oC, 30oC and 35oC, p=0.74, repeated measures ANOVA). Of interest, if any trend exists it is that percentage of high avidity interactions increases with increasing temperature when the affinity of a single oligonucleotide pair is decreased; however, the variability of measurements at higher temperatures made this difficult to define statistically. In addition, the change appeared to be due to a decrease in low affinity population rather than an increase in the high affinity population. The kinetic models in 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 28

Figure 3 also suggest more of a stabilization than an improvement in avidity at higher temperatures. Importantly, regardless of thermodynamic induced changes in individual, oligonucleotide annealing at higher temperatures,15 NPs exceeding a threshold number of conjugated oligonucleotides are able to make multivalent, high avidity interactions at physiological temperatures. Multivalent alterations resulting from changes in intrinsic ligand affinity. Given these prior studies, we investigated the effect of intrinsic ligand affinity on multivalent interactions. This overcomes some of the tissues with the temperature-changing system, and addresses an issue that has been incompletely defined in other studies on oligonucleotide-conjugated NPs1, 16, 17

. We hypothesized that the multivalent interactions (determined using the multivalent

enhancement factor or MEF = KDmono/KDmulti)1 might be altered by use of a monovalent ligand having a lower intrinsic affinity. While at first one might assume that reducing ligand affinity might decrease multivalent interactions, it is also possible that the lower affinity ligand may facilitate avidity by allowing NPs to roll on the surface and optimize multivalent binding with bound ligands18. This possibility was raised by the trend in Figure 2F, although this change was not significant. For this purpose, we designed Oligo2 (Figure 1) with an 8-mer sequence (H2N-C6 spacer-5’TAAGATGC-3’) complementary to an internal sequence of its target 25-mer oligomer (Figure S1). It has the same length (8-mer) as Oligo1, and its leading sequence is composed of three nucleotides (3’-CGT) in the 3’-teminus that overlapped with the ending sequence (CGT-C6-5’) of Oligo1. However, DNA annealing experiments performed with these two oligos showed that Oligo2 has an annealing temperature (Tm) of 49.6°C which is significantly lower than Oligo1 (57.4°C), indicative of a lower intrinsic affinity. Oligo2 was used for synthesizing G5(Oligo2)6 12


Page 13 of 28

using the same amide conjugation chemistry.8 Thus, these two populations of NP have identical distributions of ligands with the same numeric average of 6 ligands. SPR experiments with Oligo2 and its multivalent conjugate G5(Oligo2)6 were conducted at 25°C in the same 25-mer sensor chip, and their SPR data (Figure 4A) were analyzed to evaluate binding parameters (kon, koff and KD). Kinetic parameters for monomeric Oligo2, extracted using a 1:1 Langmuir kinetic model, validated its weaker binding with µM affinity (KD = 1.40 × 10 M). Thus, Oligo2 has a lower affinity than Oligo1 (KD = 8.11 × 10

−7

−5

M, Table 1), which was

Fraction

Response Unit (RU)

Response Unit (RU)

consistent with its lower Tm value.

Fraction

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A, B) SPR sensorgrams for the binding kinetics of G5(Oligo2)6 and G5(OctOligo1)13. The measurements were made at 25°C as a function of either association time (A) or 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 28

injection concentration (B). (C, D) Distribution of ligand valency in G5(Oligo2)6 (C) and G5(Oct-Oligo1)13 (D) by Poisson simulations. The green and orange columns represent the populations of NPs that exhibit fast (monovalent-like) and slow (multivalent) binding characteristics, respectively. Table 2. Comparison of kinetic parameters of SPR binding between monovalent oligonucleotides (Oligo1, Oligo2) and their multivalent conjugates G5(Oligo1)6, G5(Oligo2)6 and G5(Oct-Oligo1)6 at 25°C. Subpopulation (fraction)

Oligo1

Monovalent

4.34 × 10

Oligo2

Monovalent

2.64 × 10

Fast (0.9)

4.61 × 10

Slow (0.1)

3.37 × 10

Fast (0.6)

1.82 × 10

G5(Oligo2)6

Slow (0.4)

4.55 × 10

G5(Oct-Oligo1)13

Slow (~1)

1.93 × 10

G5(Oligo1)6

a

−1

Ligand

koff (s ) −2

−1

−2

−4

−2

−4

−7

−1 −1

kon (M s ) 5.36 × 10

1.93 × 10

3.31 × 10 3.10 × 10 1.62 × 10 1.57 × 10 1.43 × 10

4

4

4

4

4

4

4

KD, M (Tm)a 8.11 × 10 (57.4°C)

MEFb

−7

1

−5

1

−6

0.6

−8

74.4

−6

12.4

−8

482.8

−11

60,074

1.40 × 10 (49.6°C) 1.39 × 10 1.09 × 10 1.13 × 10 2.90 × 10 1.35 × 10

melting (annealing) temperature; b multivalent enhancement factor = KDoligo/KDNP

Data analysis of G5(Oligo2)6 binding was performed using the dual Langmuir model (Figure S2). The best fit for bound NPs again was achieved by a linear combination of the two subpopulations corresponding to fast (monovalent-like; fraction = 0.6) and slow (fraction = 0.4) dissociation, respectively. Table 2 provides a summary of kinetic binding parameters determined at 25°C for the pair of Oligo2 and G5(Oligo2)6 compared to Oligo1 and G5(Oligo1)6. 14


Page 15 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Like G5(Oligo1)6, G5(Oligo2)6 had two subpopulations with a 12-fold (fast) and 483-fold (slow) change in MEF as compared to Oligo2. The magnitude of MEF by G5(Oligo2)6 is greater than G5(Oligo1)6 partly due to the lower affinity of Oligo2 vs. Oligo1. Importantly, the lower affinity G5(Oligo2)6 ligand still showed a slow disassociating population (KD = 1.13 × 10

−8

M)

and this subpopulation had comparable avidity to that seen with the G5(Oligo1)6 (KD = 1.09 × −8

10 M). In addition, the fraction of multivalent subpopulations in G5(Oligo2)6 was significantly higher that the population in with G5(Oligo1)6. Poissonian distribution analysis performed for G5(Oligo2)6 (Figure 4C) suggests that the multivalent interacting particles are 40% of the total population, and correspond to G5(Oligo2)6 NP with ≥8 oligo2 per dendrimer particle. This suggested that the threshold NP valence was independent of the ligand affinity, but the increase in the slow disassociating fraction was due to a higher average ligand density per NP and not decreasing affinity. Validating the concept of threshold ligand valence by precise NP synthesis. Our prior work8 and these studies indicated a threshold number of ligands was necessary for any NP to achieve high avidity interactions. For these dendrimer-based particles, it appeared that a threshold number of 8-9 ligands was necessary for multivalent interactions regardless of the temperature or affinity of the ligand. To validate this concept we hypothesized that if average NP molecules were synthesized with ≥95% of NP distribution to have a ligand valency of ≥9, then each of these NPs would exhibit multivalent, high avidity binding. This distribution is impossible to achieve given the amide chemistry with the 24 available attachment sites on the dendrimer (Ac)90G5(glutaric acid)24 as simulated by Poisson distribution (Figure 1). Instead, we elected to use a more efficient conjugation chemistry involving strain-promoted, alkyne-azide cycloaddition (SPAAC) copper-free click chemistry.19 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 28

G5(Oct-Oligo1)13 was synthesized as described in the Methods and its SPR binding kinetics were studied at 25°C using varying concentrations (125–1000 pM) on the same 25-mer chip (Figure 4B). Its binding curves show a number of unique features including a straight association curve that implies a continuous increase in the binding rate even after 10 minutes of injection. In addition, none of the bound NPs disassociate from the surface even after a high-speed flush and 5 minutes of extended wash time. Importantly, these particle RUs are high enough to be detected with the sub nM samples. The SPR curves indicate that ~99% of the NPs in G5(Oct-Oligo1)13 showed multivalent, high avidity interactions with pM affinity (KD = 1.35 × 10−11M). This is indicative of 60,000-fold enhancement of binding avidity over free Oligo1 (Table 2) and appears to correspond to a threshold number of 6-7 in ligands per NP (Figure 4D). Populations made with identical chemistry that had less than an average of 3 ligands per NP (and no particles with more than 6 ligands) showed no multivalent interactions (data not shown). These results reinforce that the ligand valence threshold is the primary determinant of the ability for a NP to form multivalent interactions. These data show a positive correlation between avidity and ligand valence, which is consistent with a most valency-avidity analyses 1, 12, 13, 17 including ones performed with other NP that use small ligands such as sialic acid,16 folate,20 methotrexate and vancomycin.21 The lack of an adverse steric effect in higher ligand densities, such as in G5(Oct-Oligo1)13, can be attributed, in part, its small ligand size and a conjugation chemistry involving a sufficiently long spacer (length = 1.9 nm; Figure 1). However, work in some other systems suggest that presentation of too many ligands in the same surface of a NP may cause overcrowding or steric effects,22,

23

which can interfere with high avidity binding. This is especially true with large ligands, like antibodies, or with bigger NPs.24 Therefore, these results may only be significant for NP with 16


Page 17 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


small molecule ligands. In addition, the decrease in ligand valence threshold (n=6-7), relative to what was obtained for G5(Oligo1)6 (n=9), suggests that the longer linker in the G5(Oct-Oligo1)13 may improve ligand flexibility to promote additional multivalent binding while avoiding the entropic penalty for additional multivalent interactions.14 This has been reported in an oligonanogold systems,25 where a 20-mer vs.10-mer-oligonucleotide linker showed stronger NP binding avidity despite a similar-length complementary sequence. This result is consistent with theoretical calculations examining the impact of linker length on avidity.26 The most important point of these studies is that they strongly confirm the concept that a threshold ligand valence per NP is of primary importance to avidity interactions. Proof of this concept was made possible by the use of the SPACC copper-free click chemistry, where the efficiency of the conjugation resulted in a population of NP that uniformly exceeded the theoretical threshold of ligands per particle. All of the NPs in this population demonstrated high avidity interactions despite still having a range of ligands per particle.19 This clearly supports our concept that once the threshold valence is achieved, additional ligand density on the NP does not improve the avidity interaction. Selecting a chemistry that achieves the threshold ligand number for most nanoparticles is crucial to the design of synthetic systems for drug delivery, imaging and other biological applications. In our observations, the variability of the ligand density is the major hurdle to the development of functionalized particle for biological applications.11, 27 There is value in studying multivalency because it will guide the design of NPs for biological applications such as drug and gene targeting and imaging.24, 28, 29 Avidity interactions are now known to underlie many important biological interactions such as antibody binding and lectin interactions.30,

31

Evaluating these interactions could provide important insights, especially in

situations where differential avidity can alter processes such as T cell activation by MHC.32 Of 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 28

interest, most natural ligand-interactions that produce avidity interactions are relatively low affinity (micromolar), so the ligands we employed mimic these natural processes.12,

33

The

finding that temperature and ligand affinity had minimal impact of multivalency suggests that natural multivalent interactions could be consistently produced with a range of low affinity interactions and a variety of natural conditions. Our studies also show the utility of SPR-based systems in characterizing affinity interactions involved in multivalent avidity. The affinity measurements by SPR clearly documented differences in the affinity of the two oligonucleotides, and others have shown SPR it is sensitive enough to detect even single nucleotide differences in small oligonucleotide interactions.15 We were also able to examine environmental effects such as temperature on the interaction of multiple ligands, and others have now shown that multiple, different ligand interactions can also been readily measured.34 These capabilities allow this system to analyze complex multivalent biological phenomena including the adhesion of viruses to cells or the interactions that hold cells together.13, 35 Finally, despite these studies being performed in vitro, we believe our results are applicable to a wide range of biological situations. High ligand densities are necessary in SPR to assure a uniform surface and flow kinetics36. However, many situations, such as binding of influenza viruses to sialic acids on cells or cell-cell adhesion, involve similar cell membrane densities of ligands36,

37

. In addition, in cell membranes ligands can be assembled into lipid rafts by

multivalent structures (such as viruses) leading to high local concentrations of ligands38. Thus, in many situations high avidity interactions occur with large numbers of cell surface ligands, such as we used in our experiments. While we also varied temperature, our studies showed that at temperatures related to physiological conditions (30oC and 35oC) the need for avidity to achieve significant interactions between molecules was even greater than that at lower 18


Page 19 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


temperatures (given the lower affinity seen at physiological temperatures). Since it is a general characteristic of biological interactions that affinity decreases when temperature of the system is increased, it is likely that our work using oligonucleotides is relevant to other biological interactions. Finally, most affinity interactions, like single molecules of virus hemeagglutinin binding to sialic acid39 or lectin-like interactions of integrins,40-42 involve lower strength interactions with associations in approximately 10 micromolar Kd range. As previously stated, this range may be particularly important to produce avidity interactions and is similar to the interaction strength calculated for the oligonucleotides in these studies. So, overall we feel our results are relevant to many biological applications. Materials. All chemicals and materials were purchased from Sigma-Aldrich or Fisher Scientific and used as received unless otherwise specified. Phosphate buffer saline (PBS) without calcium and magnesium was purchased from Thermo Scientific (Logan, UT). The generation 5 poly(amidoamine) (G5 PAMAM) dendrimer was purchased from Dendritech and purified by dialysis (10K MWCO dialysis membrane) against PBS and H2O. Click-Easy MFCO-Nhydroxysuccinimide 2 (Figure S3) was purchased from Berry & Associates, Inc. (Dexter, MI). Single-stranded DNA oligonucleotides (ssDNA oligo) that include 8-mer amine-terminated oligos (Oligo1: 5’-NH2-C6-TGCTGAGG; Oligo2: 5’-NH2-C6-TAAGATGC), an azideterminated

Oligo1,

and

25-mer

biotinylated

Oligo

(5′-

biotin-

TTTCCTCAGCATCTTATCCGAGTTT) were synthesized with 5′-end modifications and purified by HPLC at Integrated DNA Technologies (Coralville, IA). The 10K molecular weight cutoff (MWCO) centrifugal filters (Amicon Ultra-4) were purchased from Millipore (Billerica, MA). The 10K MWCO dialysis membrane was purchased from Spectrum Laboratories (Rancho Dominquez, CA). 19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 28

Characterization. All the conjugates were analyzed by ultraperformance liquid chromatography (UPLC), 1H NMR, and other standard methods which have been previously described.11, 27, 29 The number of ligands that attached to the dendrimer was determined from the integration of the methyl protons of the terminal acetyl groups to the protons on the conjugated ligands. The number of acetyl groups per dendrimer was determined by first computing the total number of end groups from the number average molecular weight from gel permeation chromatography (GPC) and potentiometric titration data for G5-(NH2)n (n = 114 (experimental); 100%) as previously described.32 The total number of end groups was applied to the ratio of primary amines to acetyl groups, obtained from the 1H NMR of the partially acetylated dendrimer, to compute the average number of acetyl groups per dendrimer. Synthesis of G5(Oligo1)6 and G5(Oligo2)6. First, (Ac)90G5(glutaric acid)24 was prepared by partial acetylation of G5-NH2 with acetic anhydride (90 mol equiv) followed by capping with excess glutaric anhydride as reported earlier.27 The synthesis of G5(Oligo1)6 and G5(Oligo2)6 was performed by the amide coupling of (Ac)90G5(glutaric acid)24 with an amine-terminated Oligo1 and Oligo2, respectively, as described.8 The sequence of each on these oligonucleotides is presented in Figure S1. Synthesis of 3 (Ac)80G5(Cyclooctyne)n = 13 (Figure S3). Partially acetylated (Ac)80G5-NH2 (50.0 mg, 1.67 µmol) was dissolved in 800 µL of DMSO. Click-Easy MFCO-Nhydroxysuccinimide 2 (9.5 mg, 25.0 µmol) was dissolved in 200 µL of DMSO and added dropwise to the dendrimer solution. The solution was stirred overnight, and the product was purified using 10K MWCO centrifugal filtration devices. Purification consisted of ten cycles (25 min at 4800 rpm) using PBS (5 cycles) and deionized (DI) water (5 cycles). The purified

20


Page 21 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dendrimer sample was lyophilized to yield 3 G5(Cyclooctyne)n as white solid (51.2 mg, 90%). G5(Cyclooctyne)n was characterized by UPLC and 1H NMR (Figure S4). By the 1H NMR integration method, the mean number (n) of cyclooctyne linker attached to the dendrimer 3 was determined as 13.2. SPAAC Click conjugation chemistry for synthesis of G5(Oct-Oligo1)13 (Figure S3). The non-copper click chemistry process was conducted in DI water, without pH adjustment, metal catalyst, heating or cooling. G5(Cyclooctyne)13 (0.56 mg, 0.016 µmol) was dissolved in H2O (50 µL). Azide oligonucleotide 1 (5′-azido-TGCTGAGG; Figure S5) (2.06 mg, 0.247 µmol) in H2O (150 µL) was added dropwise. The Cu-free click reaction mixture was stirred at room temperature for 48 hrs. The product was purified using 10K MWCO centrifugal filtration devices. Purification consisted of ten cycles (25 min at 4800 rpm) using PBS (5 cycles) and DI water (5 cycles). After 10K MWCO ultrafiltration, 80% of the Oligo1-functionalized G5 dendrimer was recovered, and the purified dendrimer sample was lyophilized to yield G5(OctOligo1)13 as white solids (2.1 mg, 89%) and characterized by matrix assisted laser desorption ionization (MALDI) time-of-flight (TOF) mass spectrometry and UV–vis spectroscopy (Figure S6). Based on MW and the concentration of oligo, as determined by MALDI MS and UV-Vis, the mean number (n) of Oligo1 per G5 dendrimer was 13. Given the molar ratios of the reactants, this suggested that all of the oligos were clicked to the dendrimer, indicating the efficiency of the click chemistry conjugation. Moreover, despite having 13 attached ligands via a hydrophobic linker, the functionalized G5 PAMAM dendrimer still maintained superior water solubility. This was demonstrated by the lyophilized solid dendrimer’s property to be rapidly dissolved in water, preparing a concentrated aqueous stock at 10 mg/mL.

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 28

SPR spectroscopy. The binding kinetics of multivalent NPs was conducted in a Biacore X (Pharmacia Biosensor AB, Uppsala, Sweden) using an experimental method as previously described.8 The sensor chip (Biacore SA) used was pre-coated with streptavidin (SA) on the surface of its flow cell 1 (Fc1) while its flow cell 2 was left untreated as a reference cell. The injection of the 25-mer biotinylated ssDNA oligo (Figure S1) in Fc1 resulted in 1300 response unit (RU) indicative of ssDNA oligo immobilization at a surfaced density of 1.3 ng/mm2. For running SPR experiments, each solution of oligo-conjugated dendrimer dissolved in HBS-EP buffer was injected to the sensor chip at a flow rate of 10 µL/min. After each conjugate injection, the chip surface was regenerated by injection of a NaOH solution (pH 11, 5–10 µL) to ensure complete removal of the bound NPs before a next injection. Analysis of rate constants. For analysis of complementary binding kinetics by each oligoconjugated NP, RU (Fc1; 25-mer DNA) was processed by subtraction of RU (Fc2; reference) to generate ∆RU (Fc1−Fc2). Avidity distribution in the binding kinetics of G5(oligo1)6, G5(oligo2)6 and G5(Oct-oligo)13 was determined as described previously8 by parallel initial rate analysis in combination with dual Langmuir kinetic analysis (Figure S2). In brief, the rate of binding kinetics by the entire population was extracted using the first derivative (dRU/dt) at the initial (first) phase of association up to 2 min. The rate of binding kinetics by the slow-dissociation subpopulation was determined using the second phase of association (dRUslow/dt). Parameters for binding kinetics that include kon, koff and KD (= koff/kon) were extracted using the dual Langmuir kinetic binding model with a BIAevaluation software. Poisson simulation of nanoparticle-ligand distribution. Statistical analysis for ligand distribution is based on a Poissonian model as described earlier11 in which the conjugation

22


Page 23 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


reaction between each oligonucleotide molecule and a dendrimer NP occurs in a stochastic manner. In this simulation, the total number of reactive sites available in the surface modified dendrimer (Ac)90G5-(glutaric acid)24 and (Ac)80G5-(NH2)34 was 24 for G5(Oligo1)6 and G5(Oligo2)6, and 34 for G5(Oct-Oligo1)13. The mean number (n) of oligonucleotide molecules attached to each NP was either 6 for G5(Oligo1)6 and G5(Oligo2)6 or 13 for G5(Oct-Oligo1)13. This simulation led to the plots of ligand distribution as shown in Figure 3 and 4, showing the fraction of NPs as a function of ligand valence. Statistics: ANOVA and linear regression analysis were performed on Datagraph® for Mac OS X. Supporting Information. Figures S1–S6 (oligonucleotide sequences, conjugate synthesis, copy of spectral data) are provided. This material is available free of charge via the Internet. Acknowledgements: This work was supported in part by the NSF 0938019 (EFRI-BSBS), and the DARPA W911NF-07-1-0437 (Battlefield Analgesics with Physiological Feedback Control).

23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 28

REFERENCES (1)

Mammen, M., Choi, S. K., and Whitesides, G. M. (1998) Polyvalent Interactions in

Biological Systems: Implications for Design and Use of Multivalent Ligands and Inhibitors. Angew. Chem., Int. Ed. 37, 2754–2794. (2)

Haynes, M. T., and Huang, L. (2016) Multistage Delivery Technologies: Multifunctional,

Interdisciplinary Approaches to Nanomedicine. Mol Ther 24, 849-51. (3)

Li, S., and Huang, L. (2000) Nonviral gene therapy: promises and challenges. Gene Ther

7, 31-4. (4)

Torchilin, V. P. (2006) Multifunctional nanocarriers. Adv Drug Deliv Rev 58, 1532-55.

(5)

Singh, P., Carraher, C., and Schwarzbauer, J. E. (2010) Assembly of Fibronectin

Extracellular Matrix. Annu. Rev. Cell Dev. Biol. 26, 397–419. (6)

Malinovska, L., Kroschwald, S., and Alberti, S. (2013) Protein disorder, prion

propensities, and self-organizing macromolecular collectives. Biochim. Biophys. Acta, Proteins Proteomics 1834, 918–931. (7)

van den Boorn, J. G., Caroline Le Poole, I., and Luiten, R. M. (2006) T-Cell Avidity and

Tuning: The Flexible Connection Between Tolerance and Autoimmunity. Int. Rev. Immunol. 25, 235–258. (8)

Li, M.-H., Choi, S. K., Leroueil, P. R., and Baker, J. R. (2014) Evaluating Binding

Avidities of Populations of Heterogeneous Multivalent Ligand-Functionalized Nanoparticles. ACS Nano 8, 5600–5609. (9)

Rychlik, W., Spencer, W. J., and Rhoads, R. E. (1990) Optimization of the annealing

temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409–6412. (10)

Yakovchuk, P., Protozanova, E., and Frank-Kamenetskii, M. D. (2006) Base-stacking

and base-pairing contributions into thermal stability of the DNA double helix. Nucleic Acids Res. 34, 564–574.

24


Page 25 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(11)


Mullen, D. G., Fang, M., Desai, A., Baker Jr, J. R., Orr, B. G., and Banaszak Holl, M. M.

(2010) A Quantitative Assessment of Nanoparticle-Ligand Distributions: Implications for Targeted Drug and Imaging Delivery in Dendrimer Conjugates. ACS Nano 4, 657–670. (12)

Jayaraman, N. (2009) Multivalent ligand presentation as a central concept to study

intricate carbohydrate-protein interactions. Chem. Soc. Rev. 38, 3463–3483. (13)

Kiessling, L. L., Gestwicki, J. E., and Strong, L. E. (2000) Synthetic Multivalent Ligands

in the Exploration of Cell-Surface Interactions. Curr. Opin. Chem. Biol. 4, 696–703. (14)

Krishnamurthy, V. M., Estroff, L. A., and Whitesides, G. M. (2006) Multivalency in

Ligand Design, in Fragment-based Approaches in Drug Discovery pp 11-53, Wiley-VCH Verlag GmbH & Co. KGaA. (15)

Yu, F., Yao, D., and Knoll, W. (2004) Oligonucleotide hybridization studied by a surface

plasmon diffraction sensor (SPDS). Nucleic Acids Res. 32, e75. (16)

Choi, S.-K., Mammen, M., and Whitesides, G. M. (1997) Generation and in Situ

Evaluation of Libraries of Poly(acrylic acid) Presenting Sialosides as Side Chains as Polyvalent Inhibitors of Influenza-Mediated Hemagglutination. J. Am. Chem. Soc. 119, 4103–4111. (17)

Bhatia, S., Camacho, L. C., and Haag, R. (2016) Pathogen Inhibition by Multivalent

Ligand Architectures. J. Am. Chem. Soc. 138, 8654–8666. (18)

Zern, B. J., Chacko, A. M., Liu, J., Greineder, C. F., Blankemeyer, E. R., Radhakrishnan,

R., and Muzykantov, V. (2013) Reduction of nanoparticle avidity enhances the selectivity of vascular targeting and PET detection of pulmonary inflammation. ACS Nano 7, 2461-9. (19)

Huang, B., Kukowska-Latallo, J. F., Tang, S., Zong, H., Johnson, K. B., Desai, A.,

Gordon, C. L., Leroueil, P. R., and Baker Jr, J. R. (2012) The facile synthesis of multifunctional PAMAM dendrimer conjugates through copper-free click chemistry. Bioorg. Med. Chem. Lett. 22, 3152–3156.

25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(20)

Page 26 of 28

Hong, S., Leroueil, P. R., Majoros, I. J., Orr, B. G., Baker Jr, J. R., and Banaszak Holl,

M. M. (2007) The Binding Avidity of a Nanoparticle-Based Multivalent Targeted Drug Delivery Platform. Chem. Biol. (Oxford, U. K.) 14, 107–115. (21)

Choi, S. K., Myc, A., Silpe, J. E., Sumit, M., Wong, P. T., McCarthy, K., Desai, A. M.,

Thomas, T. P., Kotlyar, A., Banaszak Holl, M. M., Orr, B. G., and Baker, J. R. (2013) Dendrimer-Based Multivalent Vancomycin Nanoplatform for Targeting the Drug-Resistant Bacterial Surface. ACS Nano 7, 214–228. (22)

Hlavacek, W. S., Posner, R. G., and Perelson, A. S. (1999) Steric Effects on Multivalent

Ligand-Receptor Binding: Exclusion of Ligand Sites by Bound Cell Surface Receptors. Biophys. J. 76, 3031–3043. (23)

Choi, S.-K., Mammen, M., and Whitesides, G. M. (1996) Monomeric inhibitors of

influenza neuraminidase enhance the hemagglutination inhibition activities of polyacrylamides presenting multiple C-sialoside groups. Chem. Biol. (Oxford, U. K.) 3, 97–104. (24)

Howard, M., Zern, B. J., Anselmo, A. C., Shuvaev, V. V., Mitragotri, S., and

Muzykantov, V. (2014) Vascular Targeting of Nanocarriers: Perplexing Aspects of the Seemingly Straightforward Paradigm. ACS Nano 8, 4100–4132. (25)

Hein, C. D., Liu, X.-M., and Wang, D. (2008) Click Chemistry, A Powerful Tool for

Pharmaceutical Sciences. Pharm. Res. 25, 2216–2230. (26)

Kane, R. S. (2010) Thermodynamics of Multivalent Interactions: Influence of the Linker.

Langmuir 26, 8636–8640. (27)

Zong, H., Thomas, T. P., Lee, K.-H., Desai, A. M., Li, M.-h., Kotlyar, A., Zhang, Y.,

Leroueil, P. R., Gam, J. J., Banaszak Holl, M. M., and Baker, J. R. (2012) Bifunctional PAMAM Dendrimer Conjugates of Folic Acid and Methotrexate with Defined Ratio. Biomacromolecules 13, 982–991. (28)

Chittasupho, C. (2012) Multivalent ligand: design principle for targeted therapeutic

delivery approach. Ther. Delivery 3, 1171–1187.

26


Page 27 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(29)


Majoros, I. J., Thomas, T. P., Mehta, C. B., and Baker Jr, J. R. (2005) Poly(amidoamine)

Dendrimer-Based Multifunctional Engineered Nanodevice for Cancer Therapy. J. Med. Chem. 48, 5892–5899. (30)

Wittmann, V., and Pieters, R. J. (2013) Bridging lectin binding sites by multivalent

carbohydrates. Chem. Soc. Rev. 42, 4492–4503. (31)

Wang, H., Coligan, J. E., and Morse, H. C. (2016) Emerging Functions of Natural IgM

and Its Fc Receptor FCMR in Immune Homeostasis. Front. Immunol. 7, 1–7. (32)

Chan, T. D., and Brink, R. (2012) Affinity-based selection and the germinal center

response. Immunol. Rev. 247, 11–23. (33)

Vachieri, S. G., Xiong, X., Collins, P. J., Walker, P. A., Martin, S. R., Haire, L. F.,

Zhang, Y., McCauley, J. W., Gamblin, S. J., and Skehel, J. J. (2014) Receptor binding by H10 influenza viruses. Nature 511, 475–477. (34)

Bishop, J., Chagovetz, A. M., and Blair, S. (2008) Kinetics of Multiplex Hybridization:

Mechanisms and Implications. Biophys. J. 94, 1726–1734. (35)

Wang, W., Wolff, M. W., Reichl, U., and Sundmacher, K. (2014) Avidity of influenza

virus: Model-based identification of adsorption kinetics from surface plasmon resonance experiments. J. Chromatogr. A 1326, 125–129. (36)

Suenaga, E., Mizuno, H., and Penmetcha, K. K. (2012) Monitoring influenza

hemagglutinin and glycan interactions using surface plasmon resonance. Biosens Bioelectron 32, 195-201. (37)

Head, B. P., Patel, H. H., and Insel, P. A. (2014) Interaction of membrane/lipid rafts with

the cytoskeleton: impact on signaling and function: membrane/lipid rafts, mediators of cytoskeletal arrangement and cell signaling. Biochimica et biophysica acta 1838, 532-45. (38)

Gekara, N. O., and Weiss, S. (2004) Lipid rafts clustering and signalling by listeriolysin

O. Biochem Soc Trans 32, 712-4.

27



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(39)

Page 28 of 28

Reuter, J. D., Myc, A., Hayes, M. M., Gan, Z., Roy, R., Qin, D., Yin, R., Piehler, L. T.,

Esfand, R., Tomalia, D. A., and Baker, J. R., Jr. (1999) Inhibition of viral adhesion and infection by sialic-acid-conjugated dendritic polymers. Bioconjug Chem 10, 271-8. (40)

Liu, J., Weller, G. E., Zern, B., Ayyaswamy, P. S., Eckmann, D. M., Muzykantov, V. R.,

and Radhakrishnan, R. (2010) Computational model for nanocarrier binding to endothelium validated using in vivo, in vitro, and atomic force microscopy experiments. Proc Natl Acad Sci U S A 107, 16530-5. (41)

Eniola, A. O., Willcox, P. J., and Hammer, D. A. (2003) Interplay between rolling and

firm adhesion elucidated with a cell-free system engineered with two distinct receptor-ligand pairs. Biophys J 85, 2720-31. (42)

Ramakrishnan, N., Tourdot, R. W., Eckmann, D. M., Ayyaswamy, P. S., Muzykantov, V.

R., and Radhakrishnan, R. (2016) Biophysically inspired model for functionalized nanocarrier adhesion to cell surface: roles of protein expression and mechanical factors. R Soc Open Sci 3, 160260.

TABLE OF CONTENTS GRAPHIC

28


Ligand Characteristics Important to Avidity ... - ACS Publications

Recommend Documents