Ligand-Induced G-Quadruplex Polymorphism - American Chemical

Subscriber access provided by Nottingham Trent University

Article

Ligand-Induced G-Quadruplex Polymorphism: A DNA Nanodevice for Label-Free Aptasensor Platforms Prashant S Deore, Micaela D. Gray, Andrew J. Chung, and Richard A. Manderville J. Am. Chem. Soc., Just Accepted Manuscript • DOI: 10.1021/jacs.9b06533 • Publication Date (Web): 22 Aug 2019 Downloaded from pubs.acs.org on August 23, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society

Ligand-Induced G-Quadruplex Polymorphism: A DNA Nanodevice for Label-Free Aptasensor Platforms Prashant S. Deore, Micaela D. Gray, Andrew J. Chung, and Richard A. Manderville* Departments of Chemistry and Toxicology, University of Guelph, Guelph, Ontario, N1G 2W1, Canada ABSTRACT: G-Quadruplexes (GQs) serve as popular recognition elements for DNA aptasensors and are incorporated into a DNA nanodevice capable of controlled conformational changes to activate a sensing mechanism. Herein we highlight the utility of a GQ–GQ nanodevice fueled by GQ-specific ligands as a label-free aptasensor detection strategy. The concept was first illustrated utilizing the prototypical polymorphic human telomeric repeat sequence (H-Telo22, d[AG3(T2AG3)3]) that can undergo ligand-induced topology changes between antiparallel, parallel or hybrid GQ structures. The H-Telo22-ligand interactions served as a model of the GQ–GQ nanodevice. The utility of the device in a real aptasensor platform was then highlighted utilizing the ochratoxin A (OTA) binding aptamer (OTABA) that folds into an antiparallel GQ in the absence and presence of target OTA. Three cationic fluorogenic ligands served as GQ-specific light-up probes and as potential fuel for the GQ–GQ nanodevice by producing an inactive GQ topology (parallel or hybrid) of OTABA. Our findings demonstrate efficient OTA-mediated dye displacement with excellent emission sensitivity for OTA detection when the fluorogenic dyes induce a topology change in OTABA (parallel or hybrid). However, when the fluorogenic dye fails to induce a conformational change in the antiparallel fold of OTABA, subsequent additions of OTA to the aptamer‒dye complex results in poor dye displacement with weak emission response for OTA detection. These results are the first to exemplify a ligand-induced GQ–GQ nanodevice as an aptasensor mechanism and demonstrate diagnostic applications for topology-specific GQ binders.

INTRODUCTION. Nucleic acids perform diverse functions by adopting complex secondary structures in addition to the canonical right-handed double helical B-form DNA.1,2 One such motif is the G-quadruplex (GQ), in which four guanine molecules assemble into tetrameric (G-tetrad) structures that are stacked with intervening sequences extruded as singlestrand loops.2,3 They are stabilized by intraquartet hydrogen bonds, G-tetrad stacking and cation coordination within the central cavity. They also exhibit structural diversity that is exemplified by the intramolecular GQ structures produced by the human telomeric repeat sequence (HTelo, d[AG3(T2AG3)3]), which can adopt a variety of strand orientations (antiparallel, parallel, or hybrid)4,5 and are influenced by cation nature,6 molecular crowding agents7 and ligands.8-10 The GQ motif is also a common recognition element for nucleic acid biosensors (aptasensors),11 which confers exciting diagnostic applications. To turn aptamer-binding events into read-out signals, the aptamer typically undergoes a conformational change upon target binding to activate a sensing mechanism.12 One strategy is to incorporate the GQ recognition element into a DNA nanodevice that is capable of controlled conformational changes.3 Common examples include GQ–single-strand13,14 or a GQ–duplex15 equilibrium (Figure 1). The GQ–single-strand device is fueled by a metal cation/chelator to switch between the GQ and single-strand, respectively (Figure 1A), while the GQ–duplex device is fueled by addition of a complementary strand to the GQ-producing oligo to afford the duplex structure (Figure 1B).

Figure 1. Schematic for GQ nanodevices. The sequence of the 31-mer OTABA is 5ʹ–GATCGGGTGTGGGTGGCGTAAAGGGAGCATC–3ʹ with bold underlined G’s capable of participating in G-tetrad formation.

For aptasensor applications utilizing the GQ–duplex nanodevice, target-mediated strand displacement from the duplex to afford the GQ–target complex activates the sensing mechanism.16–19 In this platform, GQs typically cannot compete with duplex formation if full-length complemen-

ACS Paragon Plus Environment


binds to the parallel GQ structure, which exhibits a strong positive CD signal at 264 nm (solid purple trace, Figure 2a).9,10 In contrast, BtC binds H-Telo22 in K+ buffer to favor the antiparallel topology, which displays a positive CD signal at 295 nm and a negative signal at 265 nm (dashed green trace, Figure 2a). H-Telo22 binding by 4QI produced the hybrid topology, which is also favored by native HTelo22 in K+ solution.5,7,9 The hybrid is characterized by a positive CD signal at 292 nm with a distinct shoulder at ~ 270 nm. The strong positive signal is then followed by weak negative and positive signals at 257 nm and 247 nm, respectively (dashed red trace, Figure 2a). When bound to H-Telo22 the dyes display turn-on fluorescence due to increased dye rigidity and planarity through -stacking interactions with the G-tetrad of the GQ (Figure 2b), which restricts the nonradiative torsional relaxation channel for the free dyes.30,32,41 NMM displays a 10-fold increase in emission intensity upon binding HTelo22 and exhibits a sharp emission peak at 609 nm that is accompanied by a broader peak at 670 nm following excitation at 397 nm (purple trace, Figure 2b). BtC is the brightest dye of the three and exhibits emission at 645 nm following excitation at 580 nm (dashed green trace, Figure 2b) with a 4-fold increase in emission intensity compared to the free dye. For 4QI a 29-fold increase in emission intensity at 595 nm was observed upon H-Telo22 binding with excitation at 533 nm (dashed red trace, Figure 2b). The excitation spectrum of each H-Telo22‒dye mixture also displayed a prominent energy transfer (ET) band at ~ 256 nm, which is indicative of dye stacking interactions with the G-tetrad.44

(a) 3

NMM

4QI

2 CD [mdeg]

tary strands are employed,20 requiring the optimization of a truncated strand that is discarded as waste upon formation of the GQ–target complex. A more efficient GQbased platform involves a GQ–GQ nanodevice that takes advantage of the intrinsic structural polymorphism of GQ structures. In this mechanism, one GQ topology would represent an inactive state, while switching to an alternative GQ fold would activate the sensing mechanism without generating DNA waste material. The few examples that have highlighted a GQ–GQ nanodevice for controlled formation of a GQ–target complex have all been fueled by the addition of metal ions.21–23 Numerous small molecule and fluorescent light-up probes have also been developed as GQ-targeting ligands with some being specific for a given topology.8-10,24-26 A major impetus for the design of GQ-targeting ligands has been to visualize GQ structures in cellular environments, 27 help establish their structure and function,26 and serve as possible chemotherapeutic agents.28,29 Herein we demonstrate for the first time the ability of GQ-specific ligands to serve as fuel for a GQ–GQ nanodevice. The principle was first illustrated using the prototypical polymorphic HTelo22 (d[AG3(T2AG3)3]) in both K+ and Na+ solutions. In K+ solution, the commercial dye N-methyl mesoporphyrin IX (NMM) was utilized to first convert H-Telo22 into the parallel GQ fold.9,10 NMM dye displacement was then mediated by two cationic fluorogenic probes 4-quinoliniumindole (4QI)30 or the coumarin–hemicyanine hybrid (BtC, Figure 1C).31,32 These dyes bind H-Telo22 to produce the hybrid and antiparallel topologies, respectively, which acted as a conformational switch for effective NMM displacement. In this platform the GQ–GQ device worked in a single direction, with NMM unable to displace 4QI or BtC to convert the GQ back into the parallel fold. However, in Na+ solution, 4QI and BtC served as fuel to afford a complete GQ–GQ nanodevice that could switch back and forth between an antiparallel basket-type GQ and a parallelstranded GQ structure. The utility of a ligand-induced GQ-GQ device in a labelfree fluorescent aptasensor platform33 was then highlighted using the GQ–target complex produced by the fungal carcinogen ochratoxin A (OTA)34,35 and its binding 31-mer aptamer (OTABA, Figure 1c).36 OTABA binds OTA in an antiparallel chair-type topology with three lateral loops connecting two G-tetrads.37 It serves as a proof-of-concept aptamer for small molecule detection,38,39 and exhibits excellent specificity for OTA compared to other potential interferences, such as the nonchlorinated OTB derivative37 and other mycotoxins.40 In addition to 4QI and BtC, the GQspecific fluorescent light-up probe Thioflavin T (ThT,41–43 Figure 1C) was also utilized as potential fuel to afford an inactive GQ topology (hybrid or parallel) of OTABA required for the GQ–GQ nanodevice. Our results demonstrate the importance of the GQ topology switch mediated by the fuel dye for sensitive target detection. RESULTS AND DISCUSSION. H-Telo22 GQ–GQ Nanodevices: (i) NMM Displacement in K+ Solution. To illustrate a GQ–GQ nanodevice for H-Telo22 in K+ buffer we utilized NMM, 4QI and BtC. When bound to H-Telo22 the dyes induce three distinct GQ topologies (Figure 2a). The porphyrin NMM preferentially

1 0 240

260

-1

280

300

320

340

BtC

-2

Wavelength (nm)

(b)600

BtC

500 Intensity (au)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 11

400 300

NMM

200

4QI

100 0 200

300

400 500 600 Wavelength (nm)

700

800

Figure 2. (a) CD and (b) fluorescence spectral overlay of HTelo22–dye (1:5) mixtures in 50 mM potassium phosphate buffer containing 100 mM KCl. The H-Telo22 concentration for CD was 3 M and the spectra were acquired at 15 °C,


Page 3 of 11

whereas H-Telo22 concentration for fluorescence was 1 M and the spectra were acquired at 25 °C.

plot software – simple ligand binding model providing Kd = 1.9 ± 0.1 M.

It was feasible to monitor NMM displacement from HTelo22 through addition of BtC or 4QI (Figure 3). Addition of the hemicyanines to NMM-bound H-Telo22 caused loss of the positive CD peak at 264 nm, suggesting structural conversion away from the parallel propeller-loop GQ structure produced by NMM binding to H-Telo22.9,10 The titration with BtC generated a new positive CD signal at ~ 290 nm (solid green trace, Figure 3a), while the 4QI titration afforded a broad positive signal at ~ 280 nm (solid red trace, Figure 3b). Fluorescence titrations suggested that the GQ topology change was accompanied by NMM displacement (Figure 3c). Addition of 4QI caused loss of NMM emission and excitation. The excitation spectrum from NMM emission at 609 nm also displayed an increase in 4QI excitation at 533 nm and an increase in ET at 256 nm, which was fully consistent with preferential 4QI binding to H-Telo22. From the loss of NMM emission at 609 nm mediated by 4QI addition an apparent dissociation constant (Kd) of 1.9 M was determined for 4QI binding to H-Telo22 (insert, Figure 3c). NMM displays a more modest binding affinity for H-Telo22 (Kd ~ 10 M).9 The fluorescence titration for NMM displacement mediated by BtC (Figure S1, Supporting Information) also indicated NMM displacement with preferential BtC binding. However, in this instance the titration was complicated by spectral overlap of NMM and BtC emission, since BtC also exhibits an excitation

peak that overlaps with NMM excitation at 397 nm.32 Nevertheless, the displacement data afforded a Kd of 1.0 M for BtC binding to H-Telo22. Thus, both cationic hemicyanines exhibit stronger affinity for H-Telo22 than the negatively charged NMM. In this regard, addition of excess NMM to the hybrid (4QI-bound) or antiparallel (BtC-bound) HTelo22 did not convert the GQ topology back into the parallel fold (Figure S2). These data suggested that the dye combinations with H-Telo22 in K+ buffer afforded a GQ–GQ nanodevice that worked in a single direction from parallel to antiparallel/hybrid. (ii) Reversible H-Telo22 GQ–GQ Nanodevice Mediated by Hemicyanines in Na+ Solution. In Na+ buffer native HTelo22 folds into an antiparallel basket-type GQ structure.5,9,45 To illustrate a GQ–GQ nanodevice for H-Telo22 in Na+ buffer it was not feasible to utilize NMM, as the porphyrin does not interact with the antiparallel topology.9 However, both 4QI and BtC bind to H-Telo22 in Na+ solution (Figure 4) and to our surprise BtC preferentially binds to the antiparallel GQ (Figure 4a), while additions of 4QI clearly shifted the equilibrium from the antiparallel to the parallel fold (Figure 4b). Both dyes also displayed turn-on fluorescence upon H-Telo22 binding in Na+ buffer (Btc (3fold increase), 4QI (19-fold increase), Figure S3) that was also accompanied by an increase in ET at 256 nm. Plots of relative increase in dye fluorescence intensities upon HTelo22 binding (inserts, Figure S3) afforded Kd values of 2.9 M (BtC) and 2.3 M (4QI). Thus, it was deemed feasible to generate a GQ–GQ nanodevice for H-Telo22 in Na+ buffer by simply using the two hemicyanine dyes. Displacement of BtC from H-Telo22 in Na+ buffer mediated by 4QI (Figure 5) featured loss in amplitudes of the positive and negative CD signals at 295 nm and 265 nm for the antiparallel GQ (Figure 5a) and loss in BtC emission at 645 nm (Figure 5b). From the loss in BtC emission a Kd value of 14.9 M (insert, Figure 5b) was determined for 4QI binding to BtC-bound H-Telo22. The variation in Kd value determined from BtC displacement (14.9 M) versus 4QI binding to free H-Telo22 (2.3 M) may be ascribed to differences in the interaction/sterics between 4QI and HTelo22 mediated by bound BtC. In this instance it was also feasible to displace 4QI from H-Telo22 through addition of BtC (Figure S4). Addition of BtC to 4QI-bound H-Telo22 led to loss in the positive CD signal at ~ 260 nm and growth in the positive peak at ~ 295 nm (Figure S4a). The fluorescence titration also displayed loss in 4QI excitation at 533 nm and growth in BtC emission at 645 nm.

1 0

4QI

1 0

240 -1

265

290

315

340

240

265

-1

Wavelength (nm)

290

340

Wavelength (nm) 1

(F0‒F)/F0

(c) 400 ET

350

315

Kd = 1.9

0.8

0.1 µM

0.6 0.4 0.2

300

0

0

4QI

250

0.5

1

1.5

2

[4QI]/[NMM]

NMM

200

150 NMM

100 50 0 200

250

300

350

400

450

500

550

600

650

700

750

Wavelength (nm)

(a) 4

Figure 3. NMM displacement from H-Telo22 mediated by BtC and 4QI. CD titrations demonstrating changes in GQ topology of H-Telo22 (3 M) with displacement of NMM (15 M) induced by (a) BtC (0 – 300 M) and (b) 4QI (0 – 300 M), in 50 mM potassium phosphate buffer containing 100 mM KCl at 15 °C. (c) Fluorescence titration of H-Telo22 (1 M) showing displacement of NMM (5 M) by 4QI ligand (0 – 10 M), monitored with the fluorescence of NMM (Ex 397 nm, Em 609 nm) in 50 mM potassium phosphate buffer containing 100 mM KCl at 25 °C. Inset: binding isotherm for (c) obtained using sigma

(b)4

3

3

4QI

4QI

BtC

BtC

2 1 0 -1

240

265

290

315

-2 -3

340

CD [mdeg]

2

BtC CD [mdeg]

CD [mdeg]

2

(b)3

CD [mdeg]

(a) 3

Intensity (au)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2 1 0 -1

240

265

290

315

340

-2 Wavelength (nm)

-3

Wavelength (nm)

Figure 4. CD spectra of H-Telo22 (3 M, solid black traces) upon binding with (a) BtC (0 and 30 M, dashed green trace)


Journal of the American Chemical Society and (b) 4QI (0–45 M, dashed red traces) ligands in 50 mM Tris buffer containing 50 mM NaCl at 15 °C.

(a) 3

BtC

CD [mdeg]

2 1 0

240

265

290

315

340

-1

-2 -3

Wavelength (nm)

(b) 300

Kd = 14.9

200

(F0‒F)/F0

0.5

BtC

250 Emission (au)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

0.6 µM

0.4

0.3 0.2 0.1

150

0 0

100

1

2 3 4 [4QI]/[BtC]

5

50

0 600


800

Figure 5. BtC displacement from H-Telo22 mediated by 4QI. (a) CD titration demonstrating changes in GQ topology of BtCbound H-Telo22 (30 M BtC:3 M H-Telo22) by 4QI (0–300 M) in 50 mM Tris buffer containing 50 mM NaCl at 15 °C. (b) fluorescence titration (1 M H-Telo22) with BtC displacement (5 M) by 4QI (0–20 M) in Tris buffer at 25 °C. Fluorescence emission was monitored for BtC at 645 nm (Ex 580 nm) and binding isotherm was plotted against the ratio of 4QI to BtC to obtain Kd = 14.9 ± 0.6 M value using sigma plot software – simple ligand binding model.

Table 1. Parameters for dye binding to H-Telo22 M

Ka

dye

Irel c (B/F)

GQ topology

Tm (ΔTm) (°C)d

Kd (µM)e

BtC

4

antiparallel

65.6 (3.9)

1.0 ± 0.1

4QI

29

hybrid

67.9 (6.2)

1.9 ± 0.1

NMM

10

parallel

69.9 (8.2)

10 ± 3f

BtC

3

antiparallel

53.5 (2.2)

7.9 ± 1.4 (2.9 ± 0.8)

4QI

19

parallel

58.2 (6.9)

14.9 ± 0.6 (2.3 ± 0.2)

Nab

a50

mM potassium phosphate pH 7.0 with 100 mM KCl; b50 mM Tris buffer pH 7.0 with 50 mM NaCl; cRelative emission intensity of the H-Telo22:dye (1:5 M) versus free dye using ex/em (nm) 580/645 (BtC), 533/595 (4QI), 397/609 (NMM); dTm values were determined from solutions of 3 M H-Telo22 in the absence or presence of 15 M dye monitored at 295 nm over 3 ramps at a rate of 0.5 °C min–1 and are reproducible within 3%, Tm = Tm (dye–HTelo22) – Tm (native H-Telo22); fApparent dissociation constant for dye binding to H-Telo22, values in parenthesis

Page 4 of 11

from direct binding to native H-Telo22, other values from dye displacement; fKd value from ref. 9. From 4QI displacement a Kd of 7.9 M was determined for BtC binding to H-Telo22, which was a more modest binding affinity than BtC binding to free H-Telo22 in Na+ buffer (2.9 M). Overall, the two hemicyanine dyes could be utilized with H-Telo22 in Na+ solution to afford a complete GQ–GQ nanodevice that could transition from parallel to antiparallel or antiparallel to parallel depending on the choice of fuel dye to induce the topology change. Parameters for dye binding to H-Telo22 in K+ and Na+ solutions are summarized in Table 1 and Figure S5. Also included in Table 1 are UV–vis thermal melting parameters (Tm values) for H-Telo22 in the absence and presence of excess dye. Ligand-Induced GQ–GQ Aptasensor Platform. From the NMM displacement data utilizing H-Telo22 as a proofof-concept, it became clear that a ligand-induced GQ-GQ nanodevice would act as a label-free platform for monitoring target binding to a GQ-folding aptamer. For this application the aptamer would be pre-bound to a GQ-specific fluorescent light-up probe that upon target-mediated displacement would display a turn-off emission signal. To test this hypothesis, we utilized the OTABA‒OTA system and three cationic light-up probes that included BtC, 4QI and ThT. To achieve our objective, the first task was to characterize the OTABA–dye interaction to determine whether the dyes could induce OTABA polymorphism. (i) Dye Binding to OTABA. The fluorescence response of the light-up probes upon OTABA binding, their impact on GQ stability (Figure 6, Table 2) and GQ topology were determined in the previously optimized OTA binding buffer (see Experimental Section for details).36 Additions of OTABA (up to 2 equiv.) to the dye (6 M) caused dosedependent increases in ligand emission at 488 nm for ThT (240-fold increase at 1.5 equiv. OTABA, Figure 6a), 605 nm for 4QI (42-fold, Figure 6b) and 640 nm for BtC (8-fold, Figure 6c). The excitation spectra also displayed prominent ET bands at ~ 256 nm for dye stacking interactions with the G-tetrad.44 The binding data afforded Kd values (Figure S6) of 10.9 M (ThT), 2.5 M (4QI) and 3.2 M (BtC), highlighting stronger aptamer affinity for the hemicyanines compared to ThT. Native OTABA exhibits positive CD peaks at ~ 290 and 240 nm and a negative peak at 260 nm, which is characteristic of the antiparallel fold.37 It displays a melting temperature of Tm = 48.9 ºC in the OTA binding buffer (Figure 7, see also Table 2). Addition of the target OTA to OTABA increased the stability of the antiparallel fold by Tm = 5.5 ºC. Addition of ThT had little impact on the antiparallel GQ, exhibiting only slight changes in the amplitudes of the three characteristic peaks (Figure 6d) and displayed a Tm = 50.8 ºC for a slight increase of Tm = 1.9 ºC compared to native OTABA (Table 2). In sharp contrast, additions of 4QI led to loss of the antiparallel CD features and afforded a strong positive peak at ~ 260 nm (Figure 6e), which is characteristic of a parallel GQ.5,7,9 The OTABA–4QI GQ displayed a Tm = 55.6 ºC for an increase of Tm = 6.7 ºC. Addition of BtC to OTABA also caused the aptamer to adopt an alternative GQ fold (Figure 6f). The strong positive peak at 293 nm for the antiparallel GQ of native


Page 5 of 11

OTABA shifted to 291 nm and contained a shoulder at ~ 275 nm. The negative peak at 260 nm decreased in (b) 450 4QI

(a)300 ThT

OTABA

100

300

OTABA 225 150

50

20 0

0 200

300

400 500 Wavelength (nm)

600

200

(e)

ThT

300


600

(f)

4QI

3

200

700

0.8 0.3 -0.2230

250

270

290

310

-0.7

330

2

1.5 1 0.5

0 -0.5

-1.2

230

250

-1

Wavelength (nm)

2

300


700

BtC

1.5

Molar Ellipticity (θ)

1.3


2.5


OTABA

ET

40

75

0

1.8

60

ET Intensity (au)

ET

150

(d)

(c) 80 BtC

375

200

Intensity (au)

Intensity (au)

250

270

290

310

330

Wavelength (nm)

1 0.5 0

230

250

270

290

310

330

-0.5

-1 -1.5

Wavelength (nm)

Figure 6. Fluorescence and CD titrations of dye binding to OTABA carried in the OTA binding buffer (pH 8). For fluorescence titrations (a–c), the initial trace is depicted by the solid black line and represents free dye (6 M), while dashed traces depict changes in dye emission/excitation upon successive addition of OTABA up to 1.5 equiv (9 M) at 25 ºC. For CD titrations (d–f), the initial trace is depicted by the solid black line and represents native OTABA (6 M), while dashed traces depict changes in CD profile upon successive addition of dye up to 2 equiv (12 M) at 15 ºC. 1 0.9

Normalized Absorbance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.8

0.7 0.6 0.5

0.4 0.3 0.2

0.1 0 35

40

45

50 55 60 Temperature ( C)

65

70

Figure 7. Melting curves for OTABA‒dye complex (5:10 µM) in OTA binding buffer (pH = 8) with temperature ramped at 0.5 °C min–1. Increase in melting temperature (Tm) is found in the following order: (OTABA) < (OTABA–ThT) < (OTABA–BtC) < (OTABA–4QI). The traces are denoted as OTABA (gray dots), OTABA–ThT (blue squares), OTABA–BtC (green triangles) and OTABA–4QI (red squares).

amplitude considerably and shifted to 256 nm and was followed by a small positive peak at 247 nm. The CD profile adopted by OTABA in the presence of BtC strongly resembled the profile adopted by the extended H-Telo oligonucleotide in KCl that favors formation of a mixed parallel– antiparallel GQ (hybrid-2).46 The hybrid GQ produced by BtC binding exhibited a Tm = 52.5 ºC (Tm = 3.6 ºC). These experiments demonstrated the ability of 4QI and BtC to serve as fuel for a GQ–GQ nanodevice because they can generate an inactive GQ fold (parallel or hybrid), as outlined in step 1 of Figure 1C. In contrast, ThT cannot participate in the GQ–GQ nanodevice because it fails to induce a topology change in the antiparallel fold of OTABA. (ii) OTA-Mediated Dye Displacement. For dye displacement from the aptamer mediated by OTA, a 1:2

OTABA‒dye mixture (6:12 M) was treated with aliquots of OTA. ThT was poorly displaced from the aptamer, displaying only a 6% drop in emission intensity (Figure 8a). Better responses were observed for 4QI (28% displacement, Figure 8b) and BtC (52% displacement, Figure 8c). OTA-mediated changes in GQ topology were also monitored by CD spectroscopy. Additions of OTA to the OTABA‒ ThT complex caused only the amplitudes of the characteristic antiparallel peaks to increase (Figure 8d). For the OTABA‒4QI complex that adopts a parallel GQ topology, OTA additions caused loss in amplitude of the positive 260 nm peak, and formation of a distinct positive shoulder at ~ 290 nm (Figure 8e), suggesting production of the antiparallel GQ topology required for OTA binding. More convincing evidence for step 2 in the GQ‒GQ nanodevice (Figure 1C) was provided through additions of OTA to the hybrid OTABA‒BtC complex, which clearly converted the inactive hybrid CD profile back into the active antiparallel fold (Figure 8f). Overall, the displacement assays demonstrated the role for the GQ–GQ nanodevice in providing signal readout for target binding. To illustrate the analytical potential of the dye displacement assay, the 1:2 OTABA‒dye starting mixture was optimized and the OTA titrations were repeated using 0.5 M OTABA in the presence of 1 M dye. Fluorescence titrations for dye displacement mediated by OTA are displayed in Figure 9. Additions of OTA up to 1.5 equiv (0.75 M) caused 93% BtC displacement, as evidenced by the loss of emission intensity for the aptamer-bound BtC at 640 nm, coupled with the loss of the ET band at 256 nm (Figure 9a). The extent of BtC displacement (93%) was considerably improved from the 52% displacement observed at the higher concentration regime (Figure 8c). From the fluorescence displacement data, a Kd ~ 112 nM (insert, Figure 9a) was determined for OTA binding to OTABA. Additions of OTA to the 1:2 OTABA‒ThT mixture (0.5:1 M) also in-


Journal of the American Chemical Society creased ThT displacement (23%, Figure 9b) compared to the high concentration regime (6%, Figure 8a) and afforded a Kd of 292 nM for OTA aptamer binding. For this titration the excitation spectra also displayed the intrinsic (a)280 ThT

(b) 4QI

80

150 100

120

460

2

490


580

(e)

ThT

4

1.5


670

700

600

(f)

4QI

230

250

270

290

310

330

OTA

-1

2

OTA

1 0 230

250

270

290

310

330

-1

-1.5 -2

-2

Wavelength (nm)

Wavelength (nm)


0


0.5

-0.5

580

3

1

60

0 550

610

90

30

0

0

OTA

150

50

40


Intensity (au)

Intensity (a.u)

Intensity (a.u.)

120

180

OTA

200

160

BtC

210

OTA

200

(d)

(c)

250

240

2.5

630


750

780

BtC

1.5 0.5 -0.5230

250

270

290

310

330

OTA -1.5 -2.5

Wavelength (nm)

Figure 8. Fluorescence and CD titrations of OTA-mediated dye displacement from OTABA in the OTA binding buffer (pH 8). For fluorescence titrations (a–c), the initial solid black trace represents the 2:1 dye:OTABA complex (12:6 M), while dashed traces represent changes in dye emission upon additions of OTA up to 1.5 equiv (9 M) at 25 ºC. For CD titration (d–f), the initial solid black trace represents the 2:1 dye:OTABA complex (12:6 M), while dashed traces represent changes in CD profile upon additions of OTA up to 2 equiv (12 M) at 15 ºC. BtC 40 35 30 25 20 15 10 5 0

1

ET

9 nM

0.6 0.4

0.2 0 0

220 270 320 370 420 470 520 570 620 670 720 770 Wavelength (nm)

(b)

0.2 0.4 0.6 OTA (µM)

0.8

75

Intrinsic OTA

OTA (0–2.0 equiv.)

60

Intensity (au)

500 400

300 200

45

30 15 0 460 500 540 580 620

100

Wavelength (nm)

(F0‒F)/(F0‒FF)

ThT 600

Intensity (au)

Kd = 112

0.8


(F0‒F)/F0

Intensity (au)

(a)

0 250

(c)

300

350 400 450 500 Wavelength (nm)

550

Kd = 292

1.2 1 0.8 0.6 0.4 0.2 0

43 nM

0 0.2 0.4 0.6 0.8 1

600

OTA (µM)

4QI 240 200

160

ET

(F0‒F)/(F0‒FF)

Intensity (au)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 11


120

80 40

0 200

300


700

Kd = 356

1.2 1 0.8 0.6 0.4 0.2 0 0

15 nM

0.2 0.4 0.6 0.8 OTA (µM)

1

Figure 9. Fluorescence titrations of the OTABA:dye complex (0.5–1 µM, solid black trace) with OTA (0–2 equiv., dotted traces) in OTA binding buffer (pH 8.0) at 25 °C. Insert displays the binding isotherm for formation of the OTA–OTBA complex using sigma plot software.

interaction/sterics between the target and aptamer mediated by the three fluorogenic dyes.39 Nevertheless, the determined Kd range (112–356 nM) for OTA binding to the GQ-folding aptamer36 was in complete alignment with the reported range (125–374 nM) from a variety of binding assays including equilibrium dialysis, fluorescence polarization (FP), surface plasmon resonance (SPR) and a SYBR Green displacement assay.39 From the OTA titrations involving 4QI and BtC displacement, a limit of detection (LoD) ~ 15 nM (6 ng/mL) and a limit of quantification (LoQ) ~ 45–47 nM (~18 ng/mL) were determined (R2 = 0.95–0.99), Figure S6). In contrast, an LoD of 73 nM (29 ng/mL) and LoQ of 222 nM (89 ng/mL) was determined from ThT displacement (R2 = 0.85, Figure S7). Superior sensitivity for OTA detection was obtained using the hemicyanine dyes that also exhibited significantly brighter emission intensity compared to ThT when bound to 0.5 M OTABA in the starting aptamer‒dye complex (Figure S8, summarized in Table 2). Utilizing the OTABA‒BtC system (i.e. Figure 9a) for OTA detection, the ability of the GQ–GQ nanodevice platform to distinguish OTA from other potential interferences was also determined (Figure S9). The dye displacement platform displayed excellent selectivity for OTA in the presence of OTB and the two mycotoxins zearalenone and citrinin that are common co-contaminates.34,38,40 Furthermore, the detection platform displayed good recovery of OTA from red wine samples spiked with the toxin (see Experimental section for details and Table S1).

excitation maxima of OTA at ~ 380 nm. Under the same conditions OTA caused 47% displacement of 4QI with a Kd of 356 nM (Figure 9c). Overall, the variation in Kd values for OTA binding to the aptamer through use of the dye displacement assays may be ascribed to differences in the


Page 7 of 11 1

1

(b)

4QI, kobs = 0.11 min‒1

normalized intensity

(a) normalized intensity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.8 0.6 0.4 0.2 0

BtC, kobs = 0.22 min‒1

0.8 0.6 0.4 0.2 0

0

500

1000 1500 time (s)

2000

2500

0

500

1000 1500 time (s)

2000

Figure 10. Normalized emission intensity as function of time driven by dye displacement mediated by OTA binding to OTABA.

Table 2. Parameters for dye binding to OTABA and subsequent displacement by OTA dye

dye bound to OTABA ex/ema (nm)

Irel b (B/F)

Irel dyesc

Kd (dye) (µM)d

ThT

448/488

240

1

10.9 0.5

4QI

532/605

42

5.6

2.5 ± 0.2

BtC

580/640

8

15

3.2 ± 0.3

±

dye displacement by OTA

GQ topology

Tm (Tm) (ºC)e

f

Kd (OTA) (nM)g

antiparallel

50.8 (1.9)

6–23

292 ± 43

parallel

55.6 (6.7)

28– 47

356 ± 15

hybrid

52.5 (3.6)

52– 93

112 ± 9

%D

kobs / t1/2 (min–1 min)h ‒

LoD (ng/mL)

LoQ (ng/mL)

29.3

88.8

0.11 / 6.4

6.0

18.1

0.22 / 3.2

6.2

18.7

/

aExcitation/emission maximum of the OTABA:dye (12:6 M); bRelative emission intensity of the OTABA:dye (12:6 M) versus free dye; cRelative emission intensity of the OTABA:dye (0.5:1 M); dApparent dissociation constant for dye binding to OTABA; eTm values were determined from solutions of 5 M OTABA in the absence or presence of 10 M dye monitored at 295 nm over 3 ramps at a rate of 0.5 °C min–1 and are reproducible within 3%, Tm = Tm (dye–OTABA) – Tm (native OTABA); f% dye displacement (D) mediated by OTA at OTABA:dye (6:12 M) versus OTABA:dye (0.5:1 M); gApparent dissociation constant for OTA binding to OTABA; hDetermined in the OTA binding buffer at 15 °C starting from 0.5 M OTABA in the presence of 1.0 M dye, displacement initiated by addition of 1 M OTA, t1/2 = 0.693/kobs. It was expected that the rate of 4QI and BtC displacement from OTABA mediated by OTA would provide insight into the kinetics of GQ conformational switching from inactive parallel and hybrid topologies into the active chairtype antiparallel fold required for OTA binding. Fluorescence emission traces as a function of time (Figure 10) for OTA-mediated dye displacement afforded half-lives (t1/2) of ~ 6 minutes and ~ 3 minutes for 4QI and BtC displacement, respectively, at 15 ºC. The dye displacement kinetics suggested faster hybrid→antiparallel GQ conversion than parallel→antiparallel GQ conversion. The rates were also significantly faster than rates of strand displacement in a duplex–GQ nanodevice designed for thrombin detection.18 CONCLUSIONS. For these measurements a fluorescent 8-aryl-dG nucleoOur studies demonstrate the utility of the GQ-GQ base probe was inserted site-specifically within the 15-mer nanodevice to serve as a ligand-mediated label-free apthrombin binding aptamer (TBA) and displayed quenched tasensor platform. A model of the platform was first illusemission in the duplex that turns-on in the GQ‒thrombin trated using the polymorphic H-Telo22 and three GQstructure. Rates of strand displacement mediated through specific fluorogenic dyes. In this model the anionic porthrombin addition had half-lives ranging from 8.4–42 min phyrin NMM was pre-bound to H-Telo22 in K+ buffer, at 37 ºC that were dependent on position of internal probe which generates the parallel propeller-loop GQ structure. placement.18 The faster rates of target binding for the curDisplacement of NMM was then mediated by two cationic rent system can be critical for diagnostic applications, hemicyanine dyes (BtC and 4QI) that possess significantly highlighting the efficiency of the GQ–GQ device. Paramegreater affinity for H-Telo22 than NMM and favor the antiters for dye binding to OTABA and subsequent displaceparallel or hybrid GQ topology of H-Telo22. Thus, in this ment by OTA are summarized in Table 2 and Scheme 1. model NMM served as the fuel ligand to afford a GQ topolScheme 1. Schematic for OTA-mediated dye displaceogy that differs from the GQ topology favored by the hemiment mechanism.


Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cyanines that act as the target of H-Telo22. Hemicyanine dye binding to H-Telo22 was then monitored by loss of NMM fluorescence upon displacement from H-Telo22. The application of the GQ–GQ device in a real aptasensor platform was then demonstrated using the OTA/OTBA system. Here, BtC and 4QI were found to induce OTBA polymorphism and convert the antiparallel GQ topology of OTABA into the hybrid and parallel GQ structure, respectively. In contrast, the commonly used GQ-specific light-up probe ThT was found to bind to OTABA without altering the antiparallel GQ motif required for OTA binding. The order of dye affinity for OTABA was 4QI > BtC > ThT. However, despite the greater affinity of 4QI and BtC for OTABA compared to ThT, subsequent addition of the target OTA to the dye-bound OTABA resulted in poor ThT displacement. Efficient displacement of BtC and 4QI was observed with excellent sensitivity for OTA detection through loss of BtC or 4QI fluorescence. This outcome clearly highlighted the importance of the conformational GQ switch from parallel/hybrid to antiparallel for effective dye displacement mediated by the OTA target. Given the tremendous effort in the design and synthesis of GQtargeting ligands as probes and potential drugs for chemotherapy, it is fully expected that many of these derivatives can serve as tools to foster GQ–GQ nanodevices important for diagnostic biosensor applications. EXPERIMENTAL SECTION. Materials and Methods. Ochratoxin A (OTA) was received as a 99.5% pure powder from Dr. Hans-Ulrich Humpf at the University of Mü nster, Germany. It was then suspended in MeOH and quantified using UV Absorbance at 333 nm, with ε = 6400 L mol−1 cm−1. The HPLC purified telomeric DNA (HTelo22) and native 31-mer ochratoxin A binding aptamer (OTABA) were purchased from Sigma-Aldrich Ltd. (Oakville, ON), suspended in Milli-Q water and quantified using UV Absorbance at 256 nm, with ε = 228500 L mol−1 cm−1 for HTelo22 and ε = 363400 L mol−1 cm−1 for OTABA. N-Methyl Mesoporphyrin IX (NMM) was purchased from Frontier Scientific Ltd, while Thioflavin T (ThT), OTB, citrinin and zearalenone were purchased from Sigma-Aldrich Ltd. The sample of BtC was available in our laboratory and was synthesized as described.32 The fluorescent dye 4QI was synthesized as described in the synthetic procedure below. To obtain good solubility of the probes, 2 mM stock solutions were prepared in spectroscopic grade DMSO prior to dilution with aqueous buffer solution for spectrophotometric measurements. Water used for buffers or spectroscopic solutions was obtained from a filtration system (18.2 MΩ). OTA binding buffer was prepared fresh (10 mM Tris pH 8.0, 20 mM CaCl2, 120 mM NaCl, and 5 mM KCl) using standard reported protocol.36For HTelo22-based nanodevices, the NMM displacement study was performed in the 50 mM potassium phosphate buffer containing 100 mM KCl, while the hemicyanines-based nanodevice was facilitated in 50 mM tris buffer containing 50 mM NaCl. Thermal denaturation studies. All melting temperature (Tm) measurements were performed on a Cary 300-Bio UV– vis spectrophotometer using 3 µM H-Tel22 in Tris-NaCl and phosphate-KCl buffer, and 5 µM OTABA in OTA binding buffer (pH = 8) in the absence or presence of 2 or 5 equivalents of ligand (NMM, OTA, ThT, 4QI or BtC). The UV absorbance was monitored at 295 nm as a function of temperature, which contained forward–reverse scans from 10–90 °C with the heat-

Page 8 of 11

ing/cooling rate of 0.5 °C min–1. The experiments were repeated three times and averaged Tm values were established by determining the first derivative of the DNA melting curves using Varian thermal software. Fluorescence measurements. Fluorescence spectra were acquired on a Cary Eclipse Fluorescence spectrophotometer in quartz cells (108.002F-QS) with a path length of 10 X 2 mm at 25 °C. Fluorescence displacement of NMM from the pre-annealed sample of H-Telo22–NMM (1:5 µM) were performed by systematic addition of BtC/4QI ligands up to 10 µM (2 equivalents of NMM) and the fluorescence spectra were immediately recorded after manual mixing of the samples in phosphate buffer containing KCl. Binding constants (Kd values) were obtained from the binding isotherm plots of the fraction of NMM displacement versus BtC/4QI concentration, generated using SigmaPlot 11.0 software using simple ligand binding model. The ligand binding to H-Telo22 and the reversible displacement of 4QI and BtC fluorescent ligands (FL) from H-Telo22–FL complex (1:5 µM) were performed by systematic addition and manual mixing of the corresponding FL (BtC for 4QI displacement and vice versa) up to 20 µM (4 equivalents of the pre-bound ligand) in tris buffer containing NaCl. Kd values were obtained from the binding isotherms of the fraction of 4QI (or BtC) displacement versus BtC (or 4QI) concentration, which were generated using SigmaPlot 11.0 software using simple ligand binding model. For the OTA aptasensor study, both excitation and emission spectra were recorded in 50 mM OTA binding buffer at 25 °C. Fluorescence titrations with 6 µM ThT, 4QI or BtC in OTA binding buffer were carried out for OTABA binding with systematic addition up to 12 µM (2 equivalents) of OTABA and the fluorescence spectra were immediately recorded after manual mixing of the samples. Binding constants (Kd values) were obtained from the binding isotherm plots of the fraction of aptamer bound versus OTABA concentration generated using SigmaPlot 11.0 software using simple ligand binding model. Similar fluorescence titrations with 6 µM OTABA–dye complex was performed to observe dye displacement by OTA (up to 12 µM, 2 equivalents). The emission spectra were generated with the appropriate dye excitation maxima. Fluorescence emission was used to calculate % displacement using the following equation: (𝐼 −𝐼 ) % displacement = Initial Final × 100 (𝐼Initial −𝐼Blank )

Where, I is the emission intensity of dye when bound to OTABA (IInitial), displaced upon target binding (IFinal) and free in solution (IBlank). Fluorescence titrations of OTA with OTABA–dye (0.5:1 µM) were performed until a final concentration of 2 µM of OTA was reached. The binding constants were obtained using the sigma plot software by plotting % displacement with OTA concentration. For kinetic measurements, the solutions of OTABA–dye (0.5:1 µM) were prepared in OTA binding buffer (pH 8) with stirring at 15 °C in a quartz cell. The fluorescence intensities were monitored at appropriate wavelengths for the fluorogenic dyes (ThT 448/488 nm, 4QI 532/605 nm, BtC 580/640 nm) with initial baseline reading followed by manual injection of 2 equiv. OTA within 2 seconds of addition dead-time. Kinetics data were analyzed using the first order rate equation using Marquardt non-linear regression analysis on the Cary Eclipse Kinetics Software V 1.1(133). The data for each dye was averaged from two kinetic runs. The limit of detection (LoD) and limit of quantification (LoQ) were based on the standard deviation of the response and the slope of calibration curve and were determined by the


Page 9 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


equations; LoD = 3.3σ/s and LoQ = 10σ/s, where, σ = standard error of estimate obtained by standard deviation of the yintercept of the regression line Sy/x; and s = slope of calibration curve.47 The selectivity of BtC–OTABA–OTA nanodevice and its anti-interference ability were examined by adding 4 µM of OTB, citrinin and zearalenone individually and in co-existence with OTA (4 µM) to the OTABA‒BtC system (0.5:1 µM) and the % intensity drop was measured, as described previously. Also, the probe performance in a real-life sample was demonstrated using four OTA-spiked (0.13, 0.27, 0.53 and 1.0 µM) red wine samples. The spiked OTA wine samples were extracted into a CH3CN–CHCl3 mixture (0.188–0.132 mL per 1 mL of wine) with addition of 50 mg NaCl per 1 mL of wine. The solvents were evaporated, and the obtained residue was resuspended in 10% aqueous methanol. Fluorescence responses of the samples were then directly measured using the OTABA‒BtC system to determine the OTA recovery and concentrations were determined by the comparative method. The data shown in Table S1 is averaged from at least three individual replicates and all measurements were performed in OTA binding buffer (pH = 8) at 25 °C. CD measurements. CD spectra were obtained on a Jasco J-815 CD spectrophotometer equipped with a thermally controlled 1 × 4 multicell block. It was performed in quartz cells (110-QS) with a light path of 1 mm and monitored between 200 and 400 nm at a bandwidth of 1 nm and scanning speed of 100 nm/min at 15 °C. CD spectral titrations with H-Telo22– NMM (3:15 µM) in phosphate buffer containing KCl were performed for ligand-induced NMM displacement with systematic addition up to 300 µM (20 equivalents of NMM) of 4QI and BtC ligands and the CD spectra were recorded immediately after manual mixing of the samples. Similar CD titrations were performed for 4QI (up to 45 µM, 15-times H-Telo22) and BtC (up to 30 µM, 10-times H-Telo22) binding to 3 µM H-Telo22 in tris buffer containing NaCl. Further, subsequent displacements mediated by either ligands, such as BtC displacement by 4QI (up to 300 µM, 5 equivalents of BtC) from the 1:20 HTelo22–BtC complex, and 4QI displacement by BtC (up to 240 µM, 7 equivalents of 4QI) from the 1:10 H-Telo22–4QI complex were performed to observe ligand induced GQ polymorphism in H-Telo22 DNA. CD spectral titrations with 6 µM of OTABA in OTA binding buffer were carried out for dye binding with systematic addition up to 12 µM (2 equivalents) of ThT, 4QI or BtC and the CD spectra were recorded immediately after manual mixing of the samples. Similar CD titrations with 6 µM OTABA–dye complex were performed to observe dye displacement by OTA (up to 12 µM, 2 equivalents). Synthetic procedures. 4-Quinolinium-indole derivative (4QI). A microwave vessel was charged with a mixture of 1,4-dimethylquinolinium iodide48 (1.95 mmol), 1-(3-hydroxypropyl)indole-3carboxyaldehyde49 (1.62 mmol), 2 drops of piperidine and 3 mL ethanol. The reaction mixture was exposed to microwave radiation using a CEM microwave reactor at 80 °C with stirring under variable pressure for 10 min. After this time, 7 mL of acetonitrile was added, and the mixture was heated to reflux for 2 h. The mixture was then cooled to room temperature and the product was filtered and washed with diethyl ether (5 x 10 mL), affording 421 mg of red solid (62% yield). 1H-NMR (DMSO-d6, 600 MHz): δ (ppm) 1.97 (m, 2H), 3.44 (q, J = 5 Hz, 2H), 4.30 (t, J = 7 Hz, 2H), 4.35 (s, 3H,), 4.70 (t, J = 5 Hz, 1H), 7.26 (td, J = 1, 7 Hz, 1H), 7.30 (td, J = 1, 7 Hz, 1H), 7.58 (d, J = 8 Hz, 1H), 7.85 (d, J = 16 Hz, 1H), 7.91 (t, J = 8 Hz, 1H), 8.12 (td, J

= 1, 7 Hz, 1H), 8.15 (d, J = 8 Hz, 1H), 8.20 (d, J = 9 Hz, 1H), 8.32 (m, 1H), 8.42 (d, J = 16 Hz, 1H), 8.83 (d, J = 8 Hz, 1H), 9.00 (d, J = 7 Hz, 1H). 13C-NMR (DMSO-d6, 150 MHz): δ (ppm) 33.0, 43.8, 44.3, 58.1, 111.5, 113.1, 113.7, 114.1, 119.2, 120.8, 122.1, 123.5, 125.6, 126.4, 126.5, 128.8, 134.9, 135.4, 137.5, 138.0, 139.0, 146.7, 153.6. HRMS (ESI/Q-TOF) m/z: [M]+ Calcd for C23H23N2O+: 343.1805; Found: 343.1808.

ASSOCIATED CONTENT Supporting Information. Figures S1–S9, Table S1 described in the text and NMR spectra of synthetic dyes. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *[email protected]

ACKNOWLEDGMENT The work was supported by the Natural Sciences and Engineering Research Council (NSERC) of Canada (Discovery grant to R.A.M., 04621‒2018). R.A.M. thanks Dr. Hans-Ulrich Humpf at the University of Mü nster, Germany, for the sample of OTA.

REFERENCES (1) Choi, J.; Majima, T. Conformational Changes of Non-B DNA. Chem. Soc. Rev. 2011, 40, 5893–5909. (2) Bochman, M. L.; Paeschke, K.; Zakian, V. A. DNA Secondary Structures: Stability and Function of G-Quadruplex Structures. Nat. Rev. Genet. 2012, 13, 770–780. (3) Mergny, J. L.; Sen, D. DNA Quadruple Helices in Nanotechnology. Chem. Rev. 2019, 119, 6290–6325. (4) Prisian, I.; Lah, J.; Vesnaver, G. Diverse Polymorphism of GQuadruplexes as a Kinetic Phenomenon. J. Am. Chem. Soc. 2008, 130, 14161–14169. (5) Sproviero, M.; Fadock, K. L.; Witham, A. A.; Manderville, R. A. Positional Impact of Fluorescently Modified G-Tetrads within Polymorphic Human Telomeric G-Quadruplex Structures. ACS Chem. Biol. 2015, 10, 1311–1318. (6) Largy, E.; Marchand, A.; Amrane, S.; Gabelica, V.; Mergny, J.L. Quadruplex Turncoats: Cation-Dependent Folding and Stability of Quadruplex-DNA Double Switches. J. Am. Chem. Soc. 2016, 138, 2780–2792. (7) Buscaglia, R.; Miller, M. C.; Dean, W. L.; Gray, R. D.; Lane, A. N.; Trent, J. O.; Chaires, J. B. Polyethylene Glycol Binding Alters Human Telomere G-Guadruplex Structure by Conformational Selection. Nucleic Acids Res. 2013, 41, 7934–7946. (8) Marchand, A.; Granzhan, A.; Iida, K.; Tsushima, Y.; Ma, Y.; Nagasawa, K.; Teulade-Fichou, M.-P.; Gabelica, V. Ligand-Induced Conformational Changes with Cation Ejection upon Binding to Human Telomeric DNA G-Quadruplexes. J. Am. Chem. Soc. 2015, 137, 750–756. (9) Nicoludis, J. M.; Barrett, S. P.; Mergny, J.-L.; Yatsunyk, L. A. Interaction of Human Telomeric DNA with N-Methyl Mesoporpyrin IX. Nucleic Acids Res. 2012, 40, 5432–5447. (10) Nicoludis, J. M.; Miller, S. T.; Jeffrey, P. D.; Barrett, S. P.; Rablen, P. R.; Lawton, T. J.; Yatsunyk, L. A. Optimized End-Stacking Provides Specificity on N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA. J. Am. Chem. Soc. 2012, 134, 20446–20456. (11) Du, Y.; Dong, S. Nucleic Acid Biosensors: Recent Advances and Perspectives. Anal. Chem. 2017, 89, 189–215. (12) Li, D.; Song, S. P.; Fan, C. H. Target-Responsive Structural Switching for Nucleic Acid-Based Sensors. Acc. Chem. Res. 2010, 43, 631−641. (13) Monchaud, D.; Yang, P.; Lacroix, L.; Teulade-Fichou, M. P.; Mergny, J. L. A metal-mediated conformational switch controls G-


Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

quadruplex binding affinity. Angew. Chem. Int. Ed. 2008, 47, 4858–4861. (14) Huang, Y. C.; Sen, D. A Twisting Electronic Nanoswitch Made of DNA. Angew. Chem. Int. Ed. 2014, 53, 14055–14059. (15) Alberti, P.; Mergny, J.-L. DNA Duplex-Quadruplex Exchange as the Basis for a Nanomolecular Machine. Proc. Natl. Acad. Sci. USA 2003, 100, 1569–1573. (16) Cruz-Aguado, J. A.; Penner, G. Fluorescence Polarization Based Displacement Assay for the Determination of Small Molecules with Aptamers. Anal. Chem. 2008, 80, 8853–8855. (17) Li, T.; Dong, S. J.; Wang, E. K. A Lead(II)-Driven DNA Molecular Device for Turn-On Fluorescence Detection of Lead(II) Ion with High Selectivity and Sensitivity. J. Am. Chem. Soc. 2010, 132, 13156–13157. (18) Fadock, K. L.; Manderville, R. A.; Sharma, P.; Wetmore, S. D. Optimization of Fluorescent 8-Heteroaryl-Guanine Probes for Monitoring Protein-Mediated Duplex → G-Quadruplex Exchange. Org. Biomol. Chem. 2016, 14, 4409–4419. (19) Deore, P. S.; Soldatov, D. V.; Manderville, R. A. A 5ʹ-BODIPY End-label for Monitoring DNA Duplex–Quadruplex Exchange. Sci. Rep. 2018, 8, 16874. (20) Phan, A. T.; Mergny, J. L. Human Telomeric DNA, GQuadruplex, i-Motif and Watson-Crick Double Helix. Nucleic Acid Res. 2002, 30, 4618–4625. (21) Miyoshi, D.; Karimata, H.; Wang, Z. M.; Koumoto, K.; Sugimoto, N. Artificial G-Wire Switch with 2,2ʹ-Bipyridine Units Responsive to Divalent Metal Ions. J. Am. Chem. Soc. 2007, 129, 5919–5925. (22) Chen, Q.; Zuo, J.; Chen, J.; Tong, P.; Mo, X.; Zhang, L.; Li, J. A Label-Free Fluorescent Biosensor for Ultratrace Detection of Terbium (III) Based on Structural Conversion of G-Quadruplex DNA Mediated By ThT and Terbium (III). Biosens. Bioelectron. 2015, 72, 326–331. (23) Engelhard, D. M.; Nowack, J.; Clever, G. H. Copper-Induced Topology Switching and Thrombin Inhibition with Telomeric DNA G-Quadruplexes. Angew. Chem. Int. Ed. 2017, 56, 11640–11644. (24) Vummidi, B. R.; Alzeer, J.; Luedtke, N. W. Fluorescent Probes for G-Quadruplex Structures. ChemBioChem 2013, 14, 540–558. (25) Li, Q.; Xiang, J. F.; Yang, Q. F.; Sun, H. X.; Guan, A. J.; Tang, Y. L. G4LDB: A Database for Discovering and Studying G-Quadruplex Ligands. Nucleic Acids Res. 2013, 41, D1115–D1123. (26) Asamitsu, S.; Bando, T.; Sugiyama, H. Ligand Design to Acquire Specificity to Intended G-Quadruplex Structures. Chem. Eur. J. 2019, 25, 417-430. (27) Manna, S.; Srivatsan, S. G. Fluorescence-Based Tools to Probe G-Quadruplexes in Cell-Free and Cellular Environments. RSC Adv. 2018, 8, 25673–25694. (28) Neidle, S. Quadruplex Nucleic Acids as Targets for Anticancer Therapeutics. Nat. Rev. Chem. 2017, 1, 0041. (29) Hänsel-Hertsch, R.; Di Antonio, M.; Balasubramanian, S. DNA G-Quadruplexes in the Human Genome: Detection, Functions and Therapeutic Potential. Nat. Rev. Mol. Cell Biol. 2017, 18, 279– 284. (30) Bohländer, P. R.; Wagenknecht, H.-A. Synthesis and Evaluation of Cyanine–Styryl Dyes with Enhanced Photostability for Fluorescent DNA Staining. Org. Biomol. Chem. 2013, 11, 7458– 7462. (31) Yan, J.-W.; Tian, Y.-G.; Tan, J.-H.; Huang, Z.-S. Colorimetric and Fluorescence Detection of G-Quadruplex Nucleic Acids with a Coumarin–Benzothiazole Probe. Analyst 2015, 140, 7146–7149. (32) Deore, P. S.; Coman, D. S.; Manderville, R. A. A Coumarin– Hemicyanine Hybrid as a Ratiometric Fluorescent Sensor of Microenvironment Proticity. Chem. Commun. 2019, 55, 3540–3543. (33) Du, Y.; Li, B.; Wang, E. “Fitting” Makes “Sensing” Simple: Label-Free Detection Strategies Based on Nucleic Acid Aptamers. Acc. Chem. Res. 2013, 46, 203–213.

Page 10 of 11

(34) Pfohl-Leszkowicz, A.; Manderville, R. A. Ochratoxin A: An Overview on Toxicity and Carcinogenicity in Animals and Humans. Mol. Nutr. Food Res. 2007, 51, 61–99. (35) Manderville, R. A.; Wetmore, S. D. Mutagenicity of Ochratoxin A: Role for a Carbon-Linked C8-Deoxyguanosine Adduct? J. Agric. Food Chem. 2017, 65, 7097–7105. (36) Cruz-Aguado, J. A.; Penner, G. Determination of Ochratoxin A with a DNA Aptamer. J. Agric. Food Chem. 2008, 56, 10456−10461. (37) Fadock, K. L.; Manderville, R. A. DNA Aptamer–Target Binding Motif Revealed Using a Fluorescent Guanine Probe: Implications for Food Toxin Detection. ACS Omega 2017, 2, 4955– 4963. (38) Ha, T. H. Recent Advances for the Detection of Ochratoxin A. Toxins 2015, 7, 5276−5300. (39) McKeague, M.; De Girolamo, A.; Valenzano, S.; Pascale, M.; Ruscito, A.; Velu, R.; Frost, N. R.; Hill, K.; Smith, M.; McConnell, E. M.; DeRosa, M. C. Comprehensive Analytical Comparison of Strategies used for Small Molecule Aptamer Evaluation. Anal. Chem. 2015, 87, 8608−8612. (40) Rivas, L.; Mayorga-Martinez, C. C.; Quesada-González, D.; Zamora-Gálvez, A.; de la Escosura-Muñiz, A.; Merkoçi, A. LabelFree Impedimetric Aptasensor for Ochratoxin-A Detection Using Iridium Oxide Nanoparticles. Anal. Chem. 2015, 87, 5167-5172. (41) Mohanty, J.; Barooah, N.; Dhamodharan, V.; Harikrishna, S.; Pradeepkumar, P. I.; Bhasikuttan, A. C. Thiolavin T as an Efficient Inducer and Selective Fluorescent Sensor for the Human Telomeric G-Quadruplex DNA. J. Am. Chem. Soc. 2013, 135, 367–376. (42) Liu, L.; Shao, Y.; Peng, J.; Huang, C.; Liu, H; Zhang, L. Molecular Rotor-Based Fluorescent Probe for Selective Recognition of Hybrid G-Quadruplex and as a K+ Sensor. Anal. Chem. 2014, 86, 1622–1631. (43) Renaud de la Faverie, A.; Guedin, A.; Bedrat, A.; Yatsunyk, L. A.; Mergny, J. L. Thioflavin T as a Fluorescence Light-up Probe for G4 Formation. Nucleic Acids Res. 2014, 42, e65. (44) Dumas, A.; Luedtke, N. W. Highly Fluorescent Guanosine Mimics for Folding and Energy Transfer Studies. Nucleic Acids Res. 2011, 39, 6825–6834. (45) Wang, Y.; Patel, D. J. Solution Structure of the Human Telomeric Repeat d[AG3(T2AG3)3] G-Tetraplex. Structure 1993, 1, 263-282. (46) Dai, J.; Carver, M.; Punchihewa, C.; Jones, R. A.; Yang, D. Structure of the Hybrid-2 Type Intramolecular Human Telomeric G-Quadruplex in K+ Solution: Insights into Structure Polymorphism of the Human Telomeric Sequence. Nucleic Acids Res. 2007, 35, 4927–4940. (47) Shrivastava, A.; Gupta, V. B. Methods for the Determination of Limits of Detection and Limits of Quantitation of the Analytical Methods. Chron. Young Sci. 2011, 2, 21–25. (48) Coe, B. J.; Foxon, S. P.; Harper, E. C.; Harris, J. A.; Helliwell, M.; Raftery, J.; Asselberghs, I.; Clays, K.; Franz, E.; Brunschwig, B. S.; Fitch, A. G. The Synthesis, Structures and Nonlinear Optical and Related Properties of Salts with Julolidinyl Electron Donor Groups. Dyes Pigments 2009, 82, 171–186. (49) Naik, P. N.; Khan, A.; Kusurkar, R. S. Intramolecular Diels‒ Alder Reaction for the Synthesis of Tetracyclic Carbazoles and Isocanthines. Tetrahedron 2013, 69, 10733–10738.


Page 11 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


SYNOPSIS TOC


11

Ligand-Induced G-Quadruplex Polymorphism - American Chemical

Recommend Documents