Lighting up the Native Viral RNA Genome with a Fluorogenic Probe for

Subscriber access provided by ECU Libraries

Article

Lighting up the Native Viral RNA Genome with a Fluorogenic Probe for the Live-Cell Visualization of Virus Infection Xingyu Luo, Binbin Xue, Guangfu Feng, Jiaheng Zhang, Bin Lin, Pan Zeng, Huiyi Li, Haibo Yi, Xiao-Lian Zhang, Haizhen Zhu, and Zhou Nie J. Am. Chem. Soc., Just Accepted Manuscript • DOI: 10.1021/jacs.8b10265 • Publication Date (Web): 12 Mar 2019 Downloaded from http://pubs.acs.org on March 12, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society

Lighting up the Native Viral RNA Genome with a Fluorogenic Probe for the Live-Cell Visualization of Virus Infection Xingyu Luo‡a, Binbin Xue‡b, Guangfu Feng‡a, Jiaheng Zhanga, Bin Linc, Pan Zenga, Huiyi Lib, Haibo Yia, Xiao-Lian Zhangd, Haizhen Zhu*,b, and Zhou Nie*,a a State

Key Laboratory of Chemo/Bio-Sensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan Provincial Key Laboratory of Biomacromolecular Chemical Biology, Hunan University, Changsha, 410082, P. R. China b Institute of Pathogen Biology and Immunology of College of Biology, State Key Laboratory of Chemo/Biosensing and Chemometrics, Hunan University, Changsha 410082, China c Pharmaceutical Engineering & Key Laboratory of Structure-Based Drug Design & Discovery, Ministry of Education, Shenyang Pharmaceutical University, Shenyang 110016, PR China d State

Key Laboratory of Virology and Hubei Province Key Laboratory of Allergy and Immunology and Department of Immunology, School of Medicine, Wuhan University, Wuhan 430071, Hubei, China ABSTRACT: RNA viruses represent a major global health threat, and the visualization of their RNA genome in infected cells is essential for virological research and clinical diagnosis. Due to the lack of chemical toolkits for the live-cell imaging of viral RNA genomes, especially native viral genomes without labeling and genetic modification, studies on native virus infection at the single live-cell level are challenging. Herein, taking hepatitis C virus (HCV) as a representative RNA virus, we propose that the innate noncanonical G-quadruplex (G4) structure of viral RNA can serve as a specific imaging target and report a new benzothiazolebased G4-targeted fluorescence light-up probe, ThT-NE, for the direct visualization of the native RNA genome of HCV in living host cells. We demonstrate the use of the ThT-NE probe for several previously intractable applications, including the sensitive detection of individual virus-infected cells by small-molecule staining, real-time monitoring of the subcellular distribution of viral RNA genome in live cells, and continuous live-cell tracking of the infection and propagation of clinically isolated native HCV. The fluorogenic probe-based viral RNA light-up system opens up a promising chemical strategy for cutting-edge live-cell viral analysis, providing a potentially powerful tool for viral biology, medical diagnosis and drug development.

INTRODUCTION Ribonucleic acid (RNA) performs complex functions in diverse biological systems, and the visualization of RNA by fluorescence imaging is vital for research on RNA biology.1-2 As RNA is inherently nonfluorescent, a promising strategy is to develop fluorogenic small-molecule probes that reveal brilliant fluorescence upon binding with a specific RNA structure.3-5 These probes allow the detection and tracking of RNA molecules in real time, serving as important components in the chemical toolkit of RNA biology.6-7 However, most applications have been performed in vitro. Examples of fluorogenic probes for the direct imaging of RNA of interest in live cells are still limited8-9 and even scarcer for important RNA targets of pathological diagnosis. RNA viruses, which have RNA as their genetic material, are a significant global healthcare threat.10 They cause notable human diseases, including hepatitis C, Ebola hemorrhagic fever, SARS, and influenza. Hepatitis C virus (HCV) is a representative single-stranded RNA virus that has infected over 170 million people worldwide. HCV infection leads to several severe liver diseases, including chronic hepatitis, cirrhosis and liver cancer.11-12 Since the whole life cycle of the virus is dependent on host cells, the detection and imaging of viral RNA in living cells are not only necessary for

understanding the spatiotemporal dynamics of viral RNA translation, replication, and localization but also significant for monitoring the progression of viral infection and the efficacy of the applied treatment.13 Traditional methodologies, including quantitative reverse transcription PCR (RT-qPCR)14 and fluorescence in situ hybridization (FISH),15 are insufficient for this purpose because they require fixation or cell lysis procedures. Current viral RNA live-cell imaging techniques include chemical labeling16-17 or genetic modification of the viral genome,18-19 but these methods require sophisticated pretreatment and are unsuitable for studies of native viruses from clinical samples. Hence, developing viral RNA imaging approaches that allow the direct visualization of unmodified viral genomes at the single live-cell level is in high demand but substantially challenging. Given the unique features of RNA-targeting fluorogenic probes, a small-molecule-based viral RNA imaging system might be a potential candidate but thus far remains unexplored. RNA G-quadruplex (G4) is a noncanonical secondary structure with stacked planar G-quartets, formed by guaninerich RNA sequences via Hoogsteen hydrogen bonding.20-24 Recent studies have reported the presence of a putative G4 sequence (PGS) in various RNA virus genomes, such as HCV, human immunodeficiency virus (HIV), Ebola virus, and Zika

ACS Paragon Plus Environment

Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

virus.25-28 The RNA G4 structural folding of these sequences has been demonstrated both in vitro and in cells and has been proposed to participate in regulating viral RNA replication and translation.29 Since PGS are highly conserved in pathogenic RNA virus genomes, they are attractive targets for antiviral drug development.30 Several G4-binding small-molecule ligands have been developed and demonstrated to specifically target viral RNA G4 and exhibit antiviral activity. For instance, TMPyP4 targets RNA G4 in the HCV core sequence,25 and BRACO-19 targets the G4 region in the HIV1 promoter.31 Inspired by these facts, we envisage that the unique noncanonical structure of G4s in RNA viral genomes might be a potential target for developing a novel fluorogenic probe for viral RNA genome visualization in living cells. Herein, we report a viral RNA (vRNA) light-up system using a small molecular fluorogenic probe for real-time imaging in living host cells. We developed a new kind of benzothiazole-based fluorescence G4 light-up probe, namely, ThT-NE that exhibited high structural specificity and structural stabilizing ability for vRNA G4, as well as excellent cellular permeability. Using ThT-NE, we achieved visualization of the HCV vRNA genome in living eukaryotic cells infected with HCV via quick staining of viral G4 in the HCV core gene (Scheme 1). Moreover, this new approach is applicable for monitoring the subcellular localization of HCV genomic RNA in a single living cell and for continuously tracking viral infection and propagation in hepatocytes infected by native HCV in patient blood samples. To the best of our knowledge, we present the first case of a smallmolecule probe for viral genome imaging in living cells. Moreover, it is suitable for the native HCV genome without chemical labeling or genetic modification. Furthermore, our findings provide substantive live-cell evidence for the presence of vRNA G4 during the HCV lifecycle, implying the vast potential of the G4-specific imaging probe in viral pathological research.

Scheme 1. The principle of the HCV vRNA light-up system using the Gquadruplex probe ThT-NE.

RESULTS AND DISCUSSION Design, synthesis, and characterization of viral RNA G4targeting fluorogenic probe. To target vRNA G4, we designed a new compound, ThT-NE, whose scaffold is derived from thioflavin T (ThT), a benzothiazole-based G4-specific fluorogenic probe extensively used for in vitro G4 analysis.3235 ThT-NE contains methylbenzothiazole (electron acceptor) and N,N-diethylaniline (electron donor) moieties, and its

Page 2 of 11

detailed synthesis and characterization are shown in Figure S1-S4 and Scheme S1. Time-dependent density functional theory (TD-DFT) calculations and molecular dynamics simulations (MDS) corroborated the off/on fluorescence switch function of ThT-NE upon binding with G4 (Figure 1AD). The TD-DFT result (Figure 1B) of coordinate-driving potential surface scans indicated that when ThT-NE is excited to the first excited state (S1), the relaxation process starts with barrierless rotation until the twist angle (θ) between the methylbenzothiazole and N,N-diethylaniline moieties reaches 90°, at which the minimum energy conical intersection between S1 and the ground state (S0) occurs. This intersection causes twisted intramolecular charge transfer (TICT), which manifests that ThT-NE alone is nonfluorescent (with an extremely low oscillator strength: f = 0.009) due to intramolecular rotation-caused radiationless relaxation (Figure S7). The MDS results (Figure 1C, D) of RNA G4-bound ThTNE indicate that the π-π stacking interaction between ThT-NE and the ending G-quartet of G4 significantly restricts the intramolecular rotation of ThT-NE and confines it to the nearly coplanar conformation (with θ = 14° and a significantly enhanced f of 1.174), leading to a long-lived excited state (S1) and fluorescence switch-on. Next, to identify the potential target sequence of the HCV vRNA genome, we performed sequence alignments of the core gene of HCV subtype 2a, which is one of the most common genotypes in China. The core sequence was chosen since the core protein is the most highly conserved structural protein in the HCV genome, and a previous study reported the existence of PGS in the core gene of diverse HCV subtypes.25 HCV genome sequences from 255 HCV subtype 2a-infected patients were aligned, and a highly conserved G-rich consensus sequence (5’GGGAAUGAGGGACUCGGCUGGGCAG GAUGG-3’), named CG2a, was observed in the core gene between positions +259 and +288 (Scheme 1 and S2). Circular dichroism (CD) analysis revealed the parallel G-quadruplex topological structure of CG2a (Figure S8). Thus, the 30 nt CG2a sequence was chosen as the target for the evaluation of ThT-NE. As shown in Figure 1F, the ThT-NE fluorescence increases by over 1693-fold in the presence of CG2a, which displays maximal excitation/emission peaks at 461 nm/495 nm with a significantly enhanced quantum yield from ~0.01% to 31.4% (Figure S9 and Table S2). These results suggest that ThT-NE is applicable for illuminating the unique RNA G4 sequence of HCV. The G4-specific fluorogenic function of ThT-NE was further characterized in vitro. The fluorescence of the ThTNE/CG2a complex was eliminated under G4-unfolding conditions, including formamide and urea treatment (Figure S10). The mutated sequences of CG2a (CG2a-M and CG2aM2), in which partial guanines were replaced by adenosines (Figure 1E), exhibited negligible fluorescence upon the addition of ThT-NE (Figure 1G inset) since the G-A mutation largely impaired the G-quadruplex formation, as shown by the CD spectra (Figure S8). Native polyacrylamide gel electrophoresis (PAGE) showed that CG2a migrated faster than CG2a-M and CG2a-M2, implying that CG2a had a compact G4 structure (Figure S11). Further ThT-NE staining revealed that only the CG2a band was selectively stained (Figure S11). Moreover, as shown in Figure 1G, much weaker ThT-NE fluorescence was observed when it was incubated with other RNA conformations, including single-stranded


Page 3 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(ss16, ss22, ss23), double-stranded (ds17, ds18, ds26), and hairpin (HP20) RNA, tRNA fragments (tRNA Val), and microRNA mimics (miR122), as well as other cellular constituents, including duplex DNA, amino acids, and proteins (Figures S12-S14 and Table S1). Additionally, ThT-NE showed no detectable fluorescence upon incubation with the cell lysates (Figure S12) and total RNA extracted from Huh7 cells (3×105 cells/mL, Figure 1G).

Figure 1. In vitro characterization of the G4-specific fluorogenic function of ThT-NE. (A) The structure of ThT-NE and the definition of dihedral angle θ. (B) Potential energy (eV) vs. the dihedral angle θ of ThT-NE in the ground state (S0) and the excited state (S1). (C) Molecular simulation of spatial structure docking of ThT-NE/RNA G-quadruplex. (D) The flipping frequency of N,N-diethyl-phenylamine in ThT-NE in a 100 ns MD simulation. On the y axis, 0 stands for no flipping, and 1 stands for flipping. Flipping is defined as the phenylamine ring rotating across the plane perpendicular to the thiazole ring. (E) Color-coded alignment of the conserved CG2a sequence in the HCV core gene and the related mutated/complementary sequences used in this study. (F) Fluorescence spectra of ThT-NE (1 μM) in the absence or presence of CG2a (10 μM). (G) The changes in the fluorescence of ThT-NE (1 μM) in response to CG2a (5 μM) and other RNA conformations, including singlestranded (ss16, ss22, ss23, 15 μM), double-stranded (ds17, ds18, ds26, 15 μM), and hairpin (HP20, 15 μM) RNA, microRNA mimics (miR122, 15 μM), tRNA fragments (tRNA Val, 15 μM), or total RNA extracted from 3×105 Huh7 cells. The inset plots the fluorescence enhancement of ThTNE (1 μM) in response to CG2a (5 μM), CG2a-mutated sequences (CG2aM, CG2a-M2, 5 μM), and the hybrid of CG2a and AS-CG2a (5 μM). F and F0 are the fluorescence intensity of ThT-NE in the presence and absence of the indicated RNA strands, respectively. (H) Fluorescence emission change at 495 nm of ThT-NE excited at 461 nm as a function of CG2a concentration (0-10 μM). The inset represents the linear detection range of ThT-NE with CG2a.

All these results show that ThT-NE is applicable for the selective detection of HCV vRNA G4. Concentrationdependent experiments showed an excellent linear response of ThT-NE in a CG2a concentration range of nearly three orders

of magnitude (0.008–1 μM) with the lowest detectable concentration of 0.008 μM (Figure 1H). Job’s analysis indicated a 1:1 binding model for ThT-NE with CG2a (Figure S15), and the fluorescence titration experiments provided a Kd of 1.77 μM ± 0.19 μM for CG2a (Figure 1H), indicating the high affinity of ThT-NE with CG2a. We further characterized the effect of ThT-NE on the G4 stabilities of CG2a. ThT-NE showed negligible influence on the CD spectra of CG2a in the presence of a physiological concentration of K+ (100 mM) (Figure S16A). Notably, even in the absence of any alkaline metal ion (K+/Na+), CG2a alone also exhibited a typical CD characteristic of a parallel G4, and ThT-NE slightly further improved the parallel G4 formation (Figure S16A). Thus, ThT-NE enables the lighting-up of CG2a in a cation-free system (Figure S16B). Subsequent CD melting studies showed that ThT-NE moderately increased G4 thermal stabilization of CG2a with or without physiological ionic strength (Figure S17). These results indicate that CG2a is a robust G4 target and that ThT-NE might allow further stabilization of HCV RG4 folding in living cells for efficient imaging.

Figure 2. Cellular imaging of the G4 structure formed by CG2a RNA using ThT-NE. Upper: schematic illustration of the HCV vRNA mimicking system by transfecting hepatocytes (Huh7 cells) with CG2a RNA tagged with Cy5 dye to test the G4-specific imaging of ThT-NE; Lower: representative confocal imaging of living Huh7 cells transfected with various Cy5-tagged RNA sequences (red) such as CG2a, CG2a-M, AS-CG2a/CG2a, respectively, and stained with 1 μM ThT-NE (green). Scale bar: 10 μm.

Visualization of HCV RNA in live infectious cells using ThT-NE as a specific probe. To test the feasibility of using ThT-NE in live-cell imaging, we first prepared a mimicking system of HCV vRNA-presenting cells by transfecting the synthesized CG2a RNA into hepatocytes. Huh7 cells, a hepatocyte-derived cellular carcinoma cell line that has been widely used as a host for HCV infection, were used for preparation. Prior to the imaging experiments, the biocompatibility of ThT-NE was evaluated using the cell counting MTT assay, which revealed that ThT-NE showed a negligible effect on cell viability after 24 h of observation (Figure S18). For live-cell imaging, CG2a and other RNAs used in the abovementioned in vitro experiments were tagged with Cy5 dye and transfected into Huh7 cells using liposomebased transfection. The intracellular signal of the Cy5 tag allows easy evaluation of the transfection efficiency of RNAs



and their colocalization with the ThT-NE signal in live cells. The pre-evaluation (Figure S19) indicated that the transfection efficiency under our experimental conditions was high (approximately 80%) and was similar among different RNA samples. As shown in the observations by confocal laser scanning microscopy (Figures 2 and S20), the CG2atransfected cells exhibited numerous strong green fluorescent spots in the cytoplasm after staining with ThT-NE, and the ThT-NE foci colocalized well with the Cy5 signals of CG2a with a high overlap coefficient (OLC = 0.93). While ThT-NE staining was performed on mutated CG2a (CG2a-M)transfected Huh7 cells, no ThT-NE foci were observed, although numerous CG2a-M-Cy5 spots were present, which was consistent with the in vitro performance of ThT-NE (Figure S21). Moreover, the negligible fluorescence background of ThT-NE staining (e.g., vehicle-treated Huh7 cells) indicated that the endogenous constituents from live cells showed no interference with the ThT-NE signal. To further determine whether the ThT-NE fluorescence resulted from its binding to the G4 structure of CG2a in cells, the antisense strand AS-CG2a, complementary to CG2a, was introduced to block G4 formation via hybridization, which was confirmed by the CD spectra (Figure S22). The cotransfection of AS-CG2a with CG2a eliminated the CG2ainduced fluorescence enhancement of ThT-NE, indicating that the lighting-up of ThT-NE is dependent on CG2a G4-folding. Taken together, the evidence shows that ThT-NE possesses considerable specificity for G4 formed by viral RNA sequences in living cells, making it a promising probe for the high-contrast imaging of HCV genomic RNA.

Figure 3. Cellular imaging of the full-length HCV genome in living host cells by ThT-NE. (A) Schematic illustration of ThT-NE-stained HCV vRNA in host GG2 cells. (B) Representative confocal images of living Huh7 cells and GG2 cells at the indicated incubation times in the presence of ThT-NE (1 μM), ThT-NH (1 μM), or ThT (1 μM). Scale bar: 10 μm. (C) Fluorescence changes over time in GG2 and Huh7 cells in the presence of ThT-NE, ThT-NH, and ThT, respectively. Fluorescence intensity was quantified from approximately 200 cells per condition and normalized using ImageJ software. FGG2 and FHuh7 represent the fluorescence intensities of various probes in GG2 and Huh7 cells, respectively. The data represent the average values of the ratio of FGG2/FHuh7.

We next investigated whether our HCV vRNA-light-up system could be applied for visualizing the full-length HCV

Page 4 of 11

genome in live cells. We employed a full-length HCV 2a infectious cell line, GG2, which derives from the hepatoma cell line Huh7 and expresses the full-length genome of HCV subtype 2a (JFH-1) (Figure 3A).36-37 This HCV-infected cell model enables the translation and replication of the HCV genome and the consequent production and secretion of viral particles, providing a valuable tool for studying virus lifecycle and antiviral drug development. Compared with the Huh7 cell line, which was nonfluorescent after ThT-NE treatment, ThTNE-stained GG2 cells were significantly fluorescent with a punctate pattern, which was consistent with the RT-qPCR results revealing high expression levels of the HCV genome in GG2 cells (Figure S23). The GG2 cells stably expressing the HCV genome also provided a convenient cell system to evaluate candidate probes of the proposed HCV vRNA lightup system. In addition to ThT-NE, its prototype ThT and its synthetic analogue ThT-NH with a julolidine moiety (characterization shown in Figure S5 and S6) were used for comparison. ThT-NE and ThT (Ex = 459 nm/Em = 493 nm) have similar excitation and emission peak wavelengths, but ThT-NH exhibits an obvious redshift in both the excitation and emission maxima (Ex = 481 nm/Em = 512 nm) (Figure S9 and Table S2). In comparison experiments conducted at the same staining concentration (1 μM), both ThT-NE and ThTNH enabled quick staining, and bright green fluorescence was observed in GG2 cells within 10 min, whereas ThT-stained cells showed negligible fluorescence within 30 min and weak fluorescence even after 4 h (Figures 3B, 3C and S24). The significant difference of these analogues in staining time probably results from ThT-NE (octanol-water partition coefficients, logP = 5.03) and ThT-NH (logP = 5.08) being more hydrophobic than ThT (logP = 4.29) due to their bulky alkyl substituents (Table S3), enabling them to penetrate the cell membrane much more readily than ThT. Moreover, in contrast to ThT-NE, ThT-NH showed a detectable green signal in the control cell line Huh7 (Figures 3B, 3C and S24), which was consistent with the in vitro results indicating a stronger response of ThT-NH than ThT-NE to non-G4 structures (Figures S25 and S26). These results reveal that ThT-NE is more specific than ThT-NH for HCV vRNA staining. Taken together, the evidence shows that ThT-NE is the most suitable fluorogenic probe for visualization of the full-length HCV genome (Figure 3C) with quick response and high specificity. Given the balance between a high signal-tobackground ratio and quick staining, the optimized staining time of 10 mins for ThT-NE was applied for further imaging experiments. Moreover, the photobleaching property of ThTNE was determined. As shown in Figure S27, approximately 70% of the fluorescence signal of ThT-NE in ThT-NE-treated GG2 cells was retained after 30 min irradiation, illustrating the good photostability of ThT-NE in live-cell imaging. We further investigated whether the ThT-NE fluorescence originated from its targeting to the core gene of HCV vRNA. The initial test (Figures 4A and S28) using fixed GG2 cells after nuclease digestion indicated that the ThT-NE staining was completely eliminated by RNase A treatment but was almost unaffected by DNase I, demonstrating that the ThT-NE signal is derived from RNA. Next, the specificity of ThT-


Page 5 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Specific targeting of the HCV core sequence and its innate G4 structure in host cells by ThT-NE. (A) Upper: confocal imaging of fixed GG2 (HCV vRNA+) cells with or without pretreatment with DNase I or RNase A at 37 °C for 4 h followed by staining with 1 μM ThT-NE (green) and Hoechst 33324 (blue). Scale bar: 10 μm. Lower: Fluorescence intensity per cell was quantified from 30 cells per group and normalized using ImageJ software. Data represent the means ± standard deviation (SD). (B) Upper: schematic illustration of the HCV core gene targeted by ThT-NE (green) and MB-C (red), an HCV core sequence-specific molecular beacon probe. Lower: Confocal imaging of MB-C-transfected living host cells, including GG2 cells (vRNA+/core+/ G4+), Huh7 cells (vRNA-/core-/G4-), FCA1 cells (vRNA+/core-/G4-), CG2a-mutated GG2-G4-Mut cells (vRNA+/core+/G4-) and AS-CG2a-transfected GG2 cells (vRNA+/core+/G4-) in the presence of ThT-NE (1 μM). Scale bar: 10 μm. (C) Quantitative PCR analysis of the copy numbers of the HCV vRNA genome (5’ untranslated region, 5’-UTR) and the HCV core gene in total RNA extracted from GG2, FCA1, GG2-G4-Mut, and Huh7 cells. (D) Western blotting of HCV core protein and NS3 protein in cell lysates from GG2, FCA1, Huh7, and GG2-G4-Mut cells. (E) Confocal live-cell imaging of GG2 cells stained with or without treatment of G4 ligands, including 10 μM CarboxyPDS (10 μM) and TMPyP4 (5 μM), followed by staining with 1 μM ThT-NE (green) and Hoechst 33324 (blue). Scale bar: 10 μm. Lower: Fluorescence intensity per cell was quantified from 30 cells per group and normalized using ImageJ software. Data represent the means ± SD. (F) Upper: schematic illustration of colocalization between ThT-NE (green) and immunofluorescence staining of G4 structure on HCV core gene by a BG4 antibody (red) in cells. Lower: immunofluorescence staining of BG4 antibody and ThT-NE (1 μM) staining in the fixed GG2 cell without or with transfection of AS-CG2a, GG2-G4-Mut cell, FCA1 cell, and Huh7 cell. Scale bar: 10 μm.

NE for the HCV vRNA genome was evaluated by performing live-cell imaging analysis using both ThT-NE and an HCV vRNA-specific molecular beacon (MB) probe. The MB probe with the Cy5/BHQ3 (fluorophore/quencher) pair (MB-C) was designed for hybridization with and turn-on detection of the conserved sequence (the position from +293 to +317) of the core gene in HCV genomic RNA (Figure S29). As shown in Figures 4B and S30, after MB-C probe transfection, the ThTNE foci colocalized with the Cy5 signals of the activated MBC probe with a high OLC of 0.87 in GG2 cells, whereas neither signal was observed in Huh7 cells, implying that ThTNE selectively targets HCV genomic RNA. The core genetargeting specificity of ThT-NE was examined by using a core gene-deleted replicon-harboring cell line, FCA1, which is also

derived from Huh7 cells but expresses the HCV subgenome without the core gene sequence.38 RT-qPCR and Western blotting analysis (Figure 4C and 4D) validated that FCA1 cells showed the viral gene replication level comparable to GG2 cells and expressed viral nonstructural protein (NS3) but lacked the core gene region and its product. Notably, in contrast to GG2 cells, FCA1 cells showed neither ThT-NE foci nor MB-C signals (Figure 4B and S30), suggesting the high specificity of ThT-NE for the HCV core gene. To further analyze the targeting site of ThT-NE in detail, we prepared a G4-mutated HCV 2a infectious cell line (named GG2-G4-Mut), which expresses the HCV 2a genome with multiple point mutations in the G4-forming CG2a region



Page 6 of 11

(+265-+279) of the core gene. 25 Although the GG2-G4-Mut cells showed moderate replication and expression levels of the core gene (Figure 4C and 4D), the intracellular ThT-NE signals were undetectable in GG2-G4-Mut cells (Figures 4B and S30). Similarly, transfecting the GG2 cells with the antisense strand AS-CG2a, the complementary blocker of the CG2a region of the core gene, caused a complete loss of ThTNE fluorescence (Figure 4B and S30). These results confirm that the ThT-NE is strongly specific for the CG2a region of the core gene. Flow cytometry results also revealed that ThTNE selectively stained the GG2 cells, while FCA1, GG2-G4Mut, and Huh7 cells were all fluorescently undetectable (Figure S31). These results suggest that ThT-NE enables highly specific visualization of the HCV core sequence in living cells. In addition to HCV core gene selectivity, we characterized the viral G4 structural targeting specificity of ThT-NE. Treatment with CarboxyPDS or TMPyP4, two classical G4specific ligands,39-40 drastically eliminated the fluorescence of ThT-NE in live GG2 cells, indicating that these G4 ligands and ThT-NE compete for the same targets in GG2 cells (Figures 4E, S32 and S33). Moreover, we exploited a highly specific antibody against G4 structure (BG4)41-43 in immunofluorescence experiments to compare their localization with ThT-NE positive staining. As shown in Figures 4F and S34, the ThT-NE foci colocalized well with BG4 staining in the cytoplasm of GG2 cells (OLC = 0.88). However, the addition of AS-CG2a into GG2 cells to block the G4 folding of the CG2a region eliminated both the fluorescence and the colocalization of ThT-NE and BG4 staining. Furthermore, no ThT-NE signals and extremely weak BG4 staining were observed in GG2-G4-Mut cells, as the mutations of the CG2a region disrupt its G4-forming capability, and in FCA1 and Huh7 cells, which lack the HCV core gene. These results provide direct evidence that ThT-NE selectively targets the G4 structure formed by the CG2a region in the core gene of the HCV genome. Real-time monitoring of the subcellular distribution of the viral RNA genome in live cells. The intracellular localization of the HCV genome is significant for analyzing the HCV lifecycle. Almost all observed ThT-NE foci and their colocalized pattern with MB-C were located in the host cytoplasm (Figure 4B), which is consistent with the fact that the entire HCV lifecycle, including translation, replication, and virion packaging, occurs in the host cell cytoplasm.13 A detailed study of the subcellular distribution of HCV vRNA will provide precise spatial information for dissecting the viral lifecycle and virus-host interactions. Although FISH-based approaches allow spatiotemporal analysis, their fixed cell setting is inapplicable to the real-time tracking of spatial information in live cells; thus, visualization of the subcellular distribution of HCV vRNA in live host cells is still challenging. To address this challenge, we examined whether our HCV vRNA light-up system could be multiplexed with different fluorescent trackers for multiple host cellular organelles. ER-tracker red (endoplasmic reticulum probe), Lyso-tracker red (lysosome probe), Mito-tracker red (mitochondrion probe) and

Figure 5. Subcellular distribution of HCV vRNA in living cells. (A) Confocal imaging of living GG2 cells costained with 1 μM ThT-NE (green) and different organelle trackers (red) for the endoplasmic reticulum (ER), lysosome (Lyso), mitochondria (Mito) and Golgi apparatus. Scale bar: 10 μm. A line-scan analysis was performed to demonstrate the subcellular localization of ThT-NE-stained HCV vRNA on the specific organelle (on the right of each set of images). (B) Z-scan for a 3D-reconstructed image of GG2 cells costained with 1 μM ThT-NE (green) and ER-tracker (red) Scale bar: 10 μm, Z range: 18 μm. (C) Quantitation of the colocalization percentage of ThT-NE-stained HCV vRNA foci in subcellular organelles such as ER, lysosome, mitochondria and Golgi apparatus. A total of 180 fluorescent positive foci in each group were quantified and analyzed using ImageJ software.

Golgi-tracker red (Golgi apparatus probe) were used to costain GG2 live cells with ThT-NE (Figure 5A). We found that most of the ThT-NE foci colocalized well with the ER with the highest OLC value of 0.700, while only a few of them colocalized with lysosome (OLC: 0.174), mitochondria (OLC: 0.120), and Golgi apparatus (OLC: 0.006) (Figure 5A and 5C). The reconstruction of the 3D confocal imaging indicated that ThT-NE-stained HCV vRNA puncta were located inside the ER (Figure 5B). This subcellular pattern of HCV vRNA is explained by ER being the primary site for HCV genomic RNA replication and packaging into nascent virions,44-45 and our results provide live-cell spatial evidence supplementing conventional ex vivo observations. Our small-molecule visualization system presents a powerful tool for the real-time tracking of the subcellular localization of HCV vRNA in a single living cell.


Page 7 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society lysed, engineered, or processed. These merits suggest the possibility of monitoring the authentic infection of native virus in living cells, which is essential for virus biology and therapeutics. As a proof-of-concept, we first examined the ability of ThT-NE to detect virus infection by the laboratoryprepared HCV virus. HCV virus was prepared by collecting the viral particles secreted from full-length JFH1 RNAtransfected Huh7.5 cells and then inoculated into Huh7.5 cells at a multiplicity of infection (moi) = 0.1. As expected, we observed that the intracellular ThT-NE foci number and the fluorescence intensity per cell increased over the period of infection (Figure 6A), which was consistent with the gradually amplified amount of vRNA quantified by RT-qPCR (Figure S35). A similar trend of increasing expression level of the HCV nonstructural protein NS5A was also observed by immunofluorescence (Figure 6A). Approximately 1.45, 6.90, and 17.19% of the cells were HCV vRNA-positive with detectable ThT-NE fluorescent puncta at 12, 24, and 48 hours post infection (hpi), respectively, which showed great consistency with the percentages of NS5A immunofluorescence-positive cells (1.35, 7.08, and 16.99%, respectively) at the same hpi (Figure 6B). These results indicate that ThT-NE staining is a potent and reliable method for the sensitive and rapid distinction of individual HCVinfected cells from uninfected cells. Moreover, in contrast to immunofluorescence using fixed cells, our viral genome lightup system is applicable for monitoring the process of HCV propagation in live cells.

Figure 6. Evaluation of native virus infection in living host cells using ThT-NE. (A) Left panels: Confocal live-cell imaging of ThT-NE (1 μM)stained Huh7.5 cells with or without infection by purified HCV (moi=0.1) at 12, 24 and 48 hours post infection (hpi). Scale bar: 50 μm. Right panels: Confocal images of immunofluorescence of NS5A protein (NS5A-IF) from fixed Huh7.5 cells with or without infection by purified HCV (moi=0.1) at 12, 24 and 48 hpi. (B) Quantitation of relative infectious rates at 12, 24, and 48 hpi. The relative infectious rate was determined by counting the percentage of ThT-NE-positive cells (A, left panels) or NS5A-positive cells (B, right panels) in over 1000 cells visualized by Hoechst 33324 in each condition. Data represent means ± SD. (C) Schematic illustration for dynamic monitoring of HLCZ01 cell infection by hepatitis C patient serum using ThT-NE. (D) High content imaging of ThT-NE (1 μM)-stained HLCZ01 cells infected with hepatitis C patient serum at 1-18 days post infection (dpi). Scale bar: 100 μm. (E) Upper: the average fluorescence intensity of ThT-NE per HCV infection-positive HLCZ01 cell with ThT-NE foci at different dpi (over 1000 cells were quantified and analyzed). Lower: quantitation of relative infectious rates of the HLCZ01 cells infected with hepatitis C patient serum at different dpi. (F) Total fluorescence changes of ThT-NE (left y axis) and quantitative PCR analysis of the copy numbers of the HCV core gene in total RNA extracted from HLCZ01 cells infected by hepatitis C patient serum (right y axis) at different dpi.

Live-cell tracking of viral infection and propagation of laboratory-prepared and clinically isolated native HCV. Probing HCV vRNA by ThT-NE does not require the virus to be modified, labeled, or engineered nor host cells to be fixed,

Encouraged by this preliminary result and the unique advantage of our approach without the requirement of virus modification and processing, we further explored the clinical and diagnostic potential of our method to the native virus in blood sera from hepatitis C patients (Figure 6C). HLCZ01 cells, which support the entire lifecycle of both HBV and HCV from laboratory and clinical isolates,46 were infected with sera from HCV-infected donors and subsequently monitored by live-cell imaging. As shown in Figure 6D and 6E, the percentage of infected cells, which show an HCV vRNA-positive signal, was exceedingly low (< 5%) before 10 dpi, then sharply increased to 46% at 14 dpi, indicating the spreading process of HCV. The average fluorescence intensity of infected cells was relatively low before 10 dpi and dramatically increased after 14 dpi (Figure 6E), implying that viral RNA replication was significantly activated in the individual infected cells after 14 dpi. The total intracellular fluorescent signal of cell imaging showed good agreement with the RT-qPCR results of HCV vRNA, indicating the same trend in HCV vRNA replication (Figure 6F). All these data suggest that our approach can be used for live-cell imaging of the infection and propagation of clinical isolates of HCV. Discussion of the specificity and potential antiviral properties of ThT-NE. It is worth noting that the performance of ThT-NE in live-cell imaging presents high specificity for HCV vRNA G4 structure rather than host cellular constituents, including endogenous RNA G4s. This behavior is intriguing because ThT-NE is essentially only a G4 structure-specific fluorogenic probe via its recognition of an ending G-quartet (Figure 1C). ThT-NE enabled the specific staining of vRNA G4 without interference from other RNA structures, including single-stranded, duplex, and hairpin RNA structures, and highly abundant host cellular constituents, such as duplex DNA, total RNA, proteins, and cell lysates (Figures



1G and S12-S14). Further in vitro characterization of ThT-NE response to different RNA/DNA G4s indicated that ThT-NE had selectivity for HCV vRNA G4 over some G4s but not others (Figure S36). However, our results demonstrated the unprecedented specificity of ThT-NE for HCV RNA PGS in different cell models, including the mimicking system of vRNA-presenting cells (Figure 2), the full-length HCV infectious cell line (Figures 3 and 4), and native virus infection in living host cells (Figure 6). These results implied that in addition to the intrinsic specificity of ThT-NE for G4 structures, other factors related to the unique viral life cycle and our experimental setting might contribute to the specificity of ThT-NE for HCV vRNA G4 in live-cell imaging. Three plausible reasons can be proposed. (1) Since the infected cells are hijacked to maximize viral replication, the amount of viral G4s in infected cells (103-104 copies per cell)47-48 greatly surpasses that of the host endogenous G4s (typically ~102 copies per cell)41. This explanation was supported by the FISH experiment, showing that the expression level of HCV vRNA was considerably higher than the levels of other G4-containing RNAs (e.g., NRAS, BCL-2, TERRA, VEGF, ZIC1) in the cytoplasm (Figure S37). (2) The low concentration of the ThT-NE probe (1 μM) and short incubation time (10 min) in our study enable negligible background fluorescence from endogenous G4s. Due to the low abundance of endogenous G4, high G4 probe concentrations (4-14 μM) and long incubation times (0.5-48 h) were conventionally employed in previous studies to visualize endogenous G4s in living cells (Summarized in Table S4), which allowed more probes to penetrate the cells for the efficient binding of endogenous G4s to generate detectable signals. The dynamic range characterization of ThT-NE in the control cells (Huh 7, Figure S38) indicated that ThT-NE was not detectably fluorescent in the concentration range lower than 4 μM or the incubation period less than 1 h, providing an ultralow-background window in which the intracellular concentration of the penetrated probe is insufficient to light up endogenous G4 (the detailed discussion about the ultralowbackground window for HCV vRNA G4 imaging is demonstrated in Figure S39 and its legend). (3) The unique replication machinery of the HCV genome improves the specificity of ThT-NE targeting to HCV vRNA. During HCV replication, the virus induces remodeling of the host ER membrane to form vesicle-like viral replication complexes with an average diameter of approximately 150 nm.49 According to previous research on the intracellular dynamics of HCV RNA synthesis,50 it is estimated that each replication complex synthesizes approximately 10-50 copies of HCV vRNA. Therefore, the amplified HCV RNA genomes are highly concentrated and packaged in these nanosized membrane-bound vesicles, generating high local vRNA concentrations (ca. micromolar level). This confined enrichment effect caused by the HCV RNA replication complex further enlarges the local concentration difference between HCV PGS and endogenous G4, which enables the efficient staining of HCV vRNA G4 with high specificity at low concentrations of ThT-NE. In this proof-of-concept work, because the selectivity of ThT-NE for HCV vRNA G4 over other RNA/DNA G4s is finite, the high specificity of ThT-NE for live-cell imaging of HCV vRNA G4 might be attributed to the high abundance and

Page 8 of 11

the confined enrichment of HCV vRNA in host cells as well as the pre-optimized experimental settings. We also preliminarily explore whether ThT-NE is applicable as a probe to access the efficacy of an antiviral agent. Interferon- (IFN-), a known active antiviral agent for HCV infection, was used and its activity was evaluated by monitoring the intracellular abundance change of HCV vRNA in living host cells. As shown in Figure S40, increasing concentrations of IFN- significantly decreased the ThT-NE signals in GG2 cells, which consistent with the similar trend observed in RT-qPCR analysis of HCV vRNA. Therefore, ThT-NE staining under pre-optimized conditions allows high-contrast imaging of IFN-caused decrease of HCV vRNA abundance, implying that ThT-NE enables straightforward and quick evaluation of the efficacy of the antiviral agents via live-cell analysis of HCV vRNA. Given that the small molecule-based viral RNA lightup system might be versatile for various applications, the use of ThT-NE might require re-optimization according to the particular experimental conditions (i.e., cell line, moi, the time when staining will be performed, etc.) to determine the specificity and the dynamic range. ThT-NE is not only a fluorogenic probe but also a smallmolecule ligand for HCV vRNA G4, so it is interesting to investigate whether it possesses antiviral activity similar to that of other G4 ligands. Our preliminary antiviral experiments (Figure S41) showed that both the viral RNA levels and the protein expression levels of the core and NS3 proteins in GG2 cells were gradually decreased by ThT-NE in a dosedependent manner (1-5 μM) after 48 h incubation. ThT-NE showed a slight influence at 1 μM, but 5 μM ThT-NE significantly reduced RNA replication and inhibited the protein translation of HCV. The time-dependent inhibition (12-48 h) of HCV gene replication and viral protein expression was also observed upon treatment with 3 μM ThTNE (Figure S42). Hence, ThT-NE exhibits evident antiviral activity at high concentrations (>3 μM) and long incubation times (> 24 h), indicating the potential of ThT-NE as a novel targeted theranostic reagent for HCV treatment. Under our vRNA live-cell imaging conditions with a low ThT concentration (1 μM) and a short incubation time (10 min), ThT-NE might have only a slight effect on the replication and expression of the HCV genome, presenting a potent tool for real-time and in situ visualization of HCV vRNA. CONCLUSION In summary, we proved the concept that using a fluorogenic probe specifically targeting the innate noncanonical structure of viral RNA, the native HCV vRNA genome can be directly visualized in living host cells. A new small-molecule probe, ThT-NE, has been developed to target the PGS of the HCV core gene, and its molecular structural tailoring allows activatable fluorescent imaging of the RNA G4 structure within the HCV genome with quick response, high contrast, and excellent selectivity. In contrast to most G4-targeting livecell imaging studies focusing on intracellular endogenous G4, our work expands the application of G4-specific smallmolecule probes to visualize pathogen-related G4 in living cells, indicating their potential use in pathological research and clinical diagnosis. The vRNA G4-triggered fluorogenic property of ThT-NE enables the label-free imaging of viral RNA in live cells without chemical or genetic modification of either virus or host cells, allowing us to conduct several


Page 9 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


previously intractable experiments, including live-cell monitoring of the subcellular distribution of the viral RNA genome and authentic infection of clinical isolates of HCV. Given the accumulating evidence supporting the presence of G4s in many types of RNA viruses, developing new smallmolecule imaging probes specific for these viral RNA G4 might provide valuable toolkits for not only understanding the activity and function of G4 in viral biology but also dissecting the spatiotemporal dynamics of viral life cycles. We anticipate that our small molecule-based viral RNA light-up system may provide a new strategy for cutting-edge single-cell viral analysis, which will be important for virus-related basic biology, medical diagnosis, and drug development.

ASSOCIATED CONTENT Supporting Information Please see the Supporting Information (SI) for more experimental details and other tables (Table S1-S4), schemes (Scheme S1-S2), and figures (Figure S1-S42). The Supporting Information is available free of charge on the ACS Publications website.

AUTHOR INFORMATION Corresponding Author * Corresponding author email address: [email protected] (Z. N.); Tel.: +86-731-88821626; Fax: +86-731-88821848; [email protected] (H. Z.); Tel/Fax: +86-73188821385.

Author Contributions ‡

Xingyu Luo, Binbin Xue and Guangfu Feng contributed equally.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This work was supported by the National Natural Science Foundation of China (21725503, 21575038, 81730064, 81571985 and 31571368), the Foundation for Innovative Research Groups of NSFC (21521063), National Science and Technology Major Project (2017ZX10202201) and the Young Top-notch Talent for Ten Thousand Talent Program. We thank Prof. Jia-Heng Tan for help with and guidance of the G-quadruplex-specific immunofluorescence experiment. And we also thank Prof. Yugang Bai for helpful discussions.

REFERENCES (1) Morisaki, T.; Lyon, K.; Deluca, K. F.; Deluca, J. G.; English, B. P.; Zhang, Z.; Lavis, L. D.; Grimm, J. B.; Viswanathan, S.; Looger, L. L.; Lionnet, T.; Stasevich, T. J. Real-time Quantification of Single RNA Translation Dynamics in Living Cells. Science 2016, 352, 14251429. (2) Chen, K. H.; Boettiger, A. N.; Moffitt, J. R.; Wang, S.; Zhuang, X. Spatially Resolved, Highly Multiplexed RNA Profiling in Single Cells. Science 2016, 348, aaa6090. (3) Trachman III, R. J.; Truong. L.; Ferré-D'Amaré, A.R. Structural Principles of Fluorescent RNA Aptamers. Trends Pharmacol. Sci. 2017, 38, 928-938. (4) Song, W.; Filonov, G. S.; Kim, H.; Hirsch, M.; Li, X.; Moon, J. D.; Jaffrey, S. R. Imaging RNA Polymerase III Transcription Using a Photostable RNA-Fluorophore Complex. Nat. Chem. Biol. 2017, 13, 1187-1194.

(5) Autour, A.; Jeng, S. C. Y.; Cawte, A. D.; Adolahazadeh, A.; Galli, A.; Panchapakesan, S. S. S.; Rueda, D.; Ryckelynck, M.; Unrau, P. J. Fluorogenic RNA Mango Aptamers for Imaging Small Non-coding RNAs in Mammalian Cells. Nat. Commun. 2018, 9, 656. (6) Paige, J. S.; Wu, K. Y.; Jaffrey, S. R. RNA Mimics of Green Fluorescent Protein. Science 2011, 333, 642-646. (7) Höfer, K.; Langejürgen, L. V.; Jäschke, A. Universal AptamerBased Real-Time Monitoring of Enzymatic RNA Synthesis. J. Am. Chem. Soc. 2013, 13, 13692-13694. (8) Chen, S. B.; Hu, M. H.; Liu, G. C.; Wang, J.; Ou, T. M.; Gu, L, Q.; Huang, Z. S.; Tan, J. H. Visualization of NRAS RNA G-Quadruplex Structures in Cells with an Engineered Fluorogenic Hybridization Probe. J. Am. Chem. Soc. 2016, 138, 10382-10385. (9) Ying, Z. M.; Wu, Z.; Tu, B.; Tan, W. H.; Jiang, J. H. Genetically Encoded Fluorescent RNA Sensor for Ratiometric Imaging of MicroRNA in Living Tumor Cells. J. Am. Chem. Soc. 2017, 139, 9779-9782. (10) Ahlquist, P. Parallels among Positive-strand RNA Viruses, Reverse-transcribing Viruses and Double-stranded RNA viruses. Nat. Rev. Microbiol. 2006, 4, 371-382. (11) Hanafiah, K. M.; Groeger, J.; Flaxman, A. D.; Wiersma, S. T. Global Epidemiology of Hepatitis C Virus Infection: New Estimates of Age-Specific Antibody to HCV Seroprevalence. Hepatology 2013, 57, 1333-1342. (12) Jones, C. T.; Catanese, M. T.; Law, L. M.; Khetani, S. R.; Syder, A. J.; Ploss, A.; Oh, T. S.; Schoggins, J. W.; MacDonald, M. R.; Bhatia, S. N.; Rice, C. M. Real-time Imaging of Hepatitis C Virus Infection Using a Fluorescent Cell-based Reporter System. Nat. Biotechnol. 2010, 28, 167-171. (13) Lindenbach, B. D.; Rice, C. M. Unravelling Hepatitis C Virus Replication from Genome to Function. Nature 2005, 18, 933-938. (14) Shen, F.; Sun, B.; Kreutz, J. E.; Davydova, E. K.; Du, W.; Reddy, P. L.; Joseph, L. J.; Ismagilov, R. F. Multiplexed Quantification of Nucleic Acids with Large Dynamic Range Using Multivolume Digital RT-PCR on a Rotational SlipChipTested with HIV and Hepatitis C Viral Load. J. Am. Chem. Soc. 2011, 133, 17705-17712. (15) Ramanan, V.; Trehan, K.; Ong, M. L.; Luna, J. M.; Hoffmann, H. H.; Espiritu, C.; Sheahan, T. P.; Chandrasekar, H.; Schwartz, R. E.; Christine, K. S.; Rice, C. M.; van Oudenaarden, A.; Bhatia, S. N. Viral Genome Imaging of Hepatitis C Virus to Probe Heterogeneous Viral Infection and Responses to Antiviral Therapies. Virology 2016, 494, 236-247. (16) Santangelo, P. J.; Lifland, A. W.; Curt, P.; Sasaki, Y.; Bassell, G. J.; Lindquist, M. E.; Jr Crowe, J. E. Single Molecule–Sensitive Probes for Imaging RNA in Live Cells. Nat. Methods 2009, 6, 347349. (17) Brandenburg, B.; Lee, L. Y.; Lakadamyali, M.; Rust, M. J.; Zhuang, X.; Hogle, J. M. Imaging Poliovirus Entry in Live Cells. J. M. PLoS Biol. 2007, 5, e183. (18) Nilaratanakul, V.; Hauer, D. A.; Griffin, D. E. Development and Characterization of Sindbis Virus with Encoded Fluorescent RNA Aptamer Spinach2 for Imaging of Replication and Immune-mediated Changes in Intracellular Viral RNA. J. Gen. Virol. 2017, 98, 9921003. (19) Burch, B. D.; Garrido, C.; Margolis, D. M. Detection of Human Immunodeficiency Virus RNAs in Living Cells Using Spinach RNA Aptamers. Virus Res. 2017, 15, 141-146. (20) Kwok, C. K.; Merrick, C. J. G-Quadruplexes: Prediction, Characterization, and Biological Application. Trends Biotechnol. 2017, 35, 997-1013. (21) Li, W.; Li, Y.; Liu, Z.; Lin, B.; Yi, H. B.; Xu, F.; Nie, Z.; Yao, S. Insight into G-quadruplex-hemin DNAzyme/RNAzyme: Adjacent Adenine as the Intramolecular Species for Remarkable Enhancement of Enzymatic Activity. Nucleic Acids Res. 2016, 44, 7373-7384. (22) Havrila, M.; Stadlbauer, P.; Kührová, P.; Banáš, P.; Mergny, J. L.; Otyepka, M.; Šponer, J. Structural Dynamics of Propeller Loop: towards Folding of RNA G-quadruplex. Nucleic Acids Res. 2018, 46, 8754-8771. (23) Chen, X. C.; Chen, S. B.; Dai, J.; Yuan, J. H.; Ou, T. M.; Huang, Z. S.; Tan, J. H. Tracking the Dynamic Folding and Unfolding



of RNA G-Quadruplexes in Live Cells. Angew. Chem. Int. Ed. 2018, 57, 4702-4706. (24) Laguerre, A.; Stefan, L.; Larrouy, M.; Genest, D.; Novotna, J.; Pirrotta, M.; Monchaud, D. A Twice-As-Smart Synthetic G‑Quartet: PyroTASQ is Both a Smart Quadruplex Ligand and a Smart Fluorescent Probe. J. Am. Chem. Soc. 2014, 136, 12406-12414. (25) Wang, S. R.; Min, Y. Q.; Wang, J. Q.; Liu, C. X.; Fu, B.S.; Wu, F.; Wu, L. Y.; Qiao, Z. X.; Song, Y. Y.; Xu, G. H.; Wu, Z.G.; Huang, G.; Peng, N. F.; Huang, R.; Mao, W. X.; Peng, S.; Chen, Y. Q.; Zhu, Y.; Tian, T.; Zhang, X. L.; Zhou, X. A Highly Conserved Grich Consensus Sequence in Hepatitis C Virus Core Gene Represents a New Anti–hepatitis C Target. Sci. Adv. 2016, 2, e1501535. (26) Amrane, S.; Kerkour, A.; Bedrat, A.; Vialet, B.; Andreola, M. L. and Mergny, J. L. Topology of a DNA G ‑ Quadruplex Structure Formed in the HIV-1 Promoter: A Potential Target for Anti-HIV Drug Development. J. Am. Chem. Soc. 2014, 136, 5249-5252. (27) Wang, S. R.; Zhang, Q. Y.; Wang, J. Q.; Ge, X. Y.; Song, Y. Y.; Wang, Y. F.; Li, X. D.; Fu, B. S.; Xu, G. H.; Shu, B.; Gong, P.; Zhang, B.; Tian, T.; Zhou, X. Chemical Targeting of a G-Quadruplex RNA in the Ebola Virus L Gene. Cell Chem. Biol. 2016, 23, 11131122. (28) Fleming, A. M.; Ding, Y.; Alenko, A.; Burrows, C. J. Zika Virus Genomic RNA Possesses Conserved G-quadruplexes Characteristic of the Flaviviridae Family. ACS Infect. Dis. 2016, 2, 674-681. (29) Métifiot, M.; Amrane, S.; Litvak, S.; Andreola, M. L. GQuadruplexes in Viruses: Function and Potential Therapeutic Applications. Nucleic Acids Res. 2014, 42, 12352-12366. (30) Ruggiero, E.; Richter, S. N. G-quadruplexes and Gquadruplex Ligands: Targets and Tools in Antiviral Therapy. Nucleic Acids Res. 2018, 46, 3270-3283. (31) Perrone, R.; Nadai, M.; Frasson, I.; Poe, J. A.; Butovskaya, E.; Smithgall, T. E.; Palumbo, M.; Palù, G.; Richter SN. A Dynamic G‑ Quadruplex Region Regulates the HIV-1 Long Terminal Repeat Promoter. J. Med. Chem. 2013, 56, 6521-6530. (32) Bhasikuttan, A. C.; Mohanty, J. Targeting G-quadruplex structures with extrinsic fluorogenic dyes: promising fluorescence sensors. Chem. Commun. 2015, 51, 7581-7597. (33) Mohanty, J.; Barooah, N.; Dhamodharan, V.; Harikrishna, S.; Pradeepkumar, P. I.; Bhasikuttan, A. C. Thioflavin T as an Efficient Inducer and Selective Fluorescent Sensor for the Human Telomeric G ‑Quadruplex DNA. J. Am. Chem. Soc. 2013, 135, 367-376. (34) Liu, Z. L.; Luo, X. Y.; Li, Z.; Huang, Y.; Nie, Z.; Wang. H. H.; Yao, S. Z. Enzyme-Activated G-Quadruplex Synthesis for in Situ Label-Free Detection and Bioimaging of Cell Apoptosis. Anal. Chem. 2017, 89, 1892-1899. (35) Liu, Z. L.; Li, W.; Nie, Z.; Peng, F. F.; Huang, Y.; Yao, S. Z. Randomly Arrayed G-quadruplexes for Label-free and Real-time Assay of Enzyme Activity. Chem. Commun. 2014, 50, 6875-6878. (36) Wakita, T.; Pietschmann, T.; Kato, T.; Date, T.; Miyamoto, M.; Zhao, Z.; Murthy, K.; Habermann, A.; Kräusslich, H. G.; Mizokami, M.; Bartenschlager, R.; Liang, T. J. Production of Infectious Hepatitis C Virus in Tissue Culture from a Cloned Viral Genome. Nat. Med. 2005, 11, 791-796. (37) Qin, Y.; Xue, B. B.; Liu. C. Y.; Wang, X. H.; Tian, R. Y.; Xie, Q. Y.; Guo, M. M.; Li, G. D.; Yang, D. R.; Zhu, H. Z. NLRX1 Mediates MAVS Degradation to Attenuate Hepatitis C Virus-induced Innate Immune Response through PCBP2. J. Virol. 2017, 91, JVI. 01264-17 (38) Yu, X. Y.; Gao, Y. M.; Xue, B. B.; Wang, X. H.; Yang, D. R; Qin, Y. W.; Yu, R.; Liu, N. L,; Xu, L.; Fang, X. H.; Zhu, H. Z. Inhibition of Hepatitis C Virus Infection by NS5A-Specific Aptamer. Antiviral Res. 2014, 106, 116-124. (39) Duarte, A. R.; Cadoni, E.; Ressurreição, A. S.; Moreira, R.; Paulo, A. Design of Modular G-quadruplex Ligands. ChemMedChem 2018, 13, 869-893. (40) Feng, G. F.; Luo, C.; Yi, H. B.; Yuan, L.; Lin, B.; Luo, X. Y.; Hu, X. X.; Wang, H. H.; Lei, C. Y.; Nie, Z.; Yao, S. Z. DNA Mimics of Red Fluorescent Proteins (RFP) Based on G-quadruplex-confined

Page 10 of 11

Synthetic RFP Chromophores. Nucleic Acids Res. 2017, 45, 1038010392. (41) Biffi, G.; Di Antonio, M.; Tannahill, D.; Balasubramanian, S. Visualization and Selective Chemical Targeting of RNA Gquadruplex Structures in the Cytoplasm of Human Cells. Nat. Chem. 2014, 6, 75-80. (42) Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S. Quantitative Visualization of DNA G-quadruplex Structures in Human Cells. Nat. Chem. 2013, 5, 182-186. (43) Zhang, S. G.; Sun, H. X.; Wang, L. X.; Liu, Y.; Chen, H. B.; Li, Q.; Guan, A. J.; Liu, M. R.; Tang, Y. L. Real-time Monitoring of DNA G-quadruplexes in Living Cells with a Small-molecule Fluorescent Probe. Nucleic Acids Res. 2018, 46, 7522-7532. (44) Manns, M. P.; Buti, M., Gane, E.; Pawlotsky, J. M.; Razavi, H.; Terrault, N.; Younossi, Z. Hepatitis C Virus Infection. Nat. Rev. Dis. Primers 2017, 3:17006. (45) Shulla, A.; Randall, G. Spatiotemporal Analysis of Hepatitis C Virus Infection. PLoS Pathog. 2015, 11:e1004758. (46) Yang, D. R.; Zuo, C. H.; Wang, X. H.; Meng, X, H.; Xue, B. B.; Liu, N. L.; Yu, R.; Qin, Y. W.; Gao, Y. M.; Wang, Q. P.; Hu, J.; Wang, L.; Zhou, Z. B.; Liu, B.; Tan, D. M.; Guan, Y.; Zhu, H. Z. Complete Replication of Hepatitis B Virus and Hepatitis C Virus in a Newly Developed Hepatoma Cell Line. Proc. Natl. Acad. Sci. U. S. A. 2014, 111, E1264-E1273. (47) Zhang, Y. Y.; Zhang, B. H.; Ishii, K.; Liang. T. J. Novel Function of CD81 in Controlling Hepatitis C Virus Replication. J. Virol. 2010, 84, 3396-3407. (48) Bukh, J. The History of Hepatitis C Virus (HCV): Basic Research Reveals Unique Features in Phylogeny, Evolution and the Viral Life Cycle with New Perspectives for Epidemic Control. J. Hepatol. 2016, 65, S2-S21. (49) Suzuki, T. Hepatitis C Virus Replication. In Organelle Contact Sites: From Molecular Mechanism to Disease; Tagaya, M., Simmen, T., Eds.; Springer: Singapore, 2017; Vol. 997, pp 199-209. (50) Lohmann, V. Hepatitis C Virus RNA Replication. In Hepatitis C Virus: From Molecular Virology to Antiviral Therapy. Bartenschlager R., Ed.; Springer: Berlin, 2013; Vol. 369, pp 167-198.


Page 11 of 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Lighting up the Native Viral RNA Genome with a Fluorogenic Probe for

Recommend Documents