Luteolin Inhibits Hepatitis B Virus Replication through Extracellular

Dec 11, 2015 - While the extracellular signal-regulated kinase (ERK) was activated by luteolin, inhibition of ERK abolished luteolin-induced HNF4α ...
0 downloads 0 Views 9MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Luteolin Inhibits Hepatitis B Virus Replication through Extracellular Signal-Regulated Kinase-Mediated Down-Regulation of Hepatocyte Nuclear Factor 4α Expression Lang Bai,*,†,‡,∥ Yunhong Nong,†,‡,∥ Ying Shi,†,‡ Miao Liu,†,‡ Libo Yan,†,‡ Jin Shang,†,‡ Feijun Huang,§ Yong Lin,⊥ and Hong Tang*,†,‡ †

Center of Infectious Diseases, West China Hospital, Sichuan University, Chengdu 610041, China Division of Infectious Diseases, State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University, and Collaborative Innovation Center for Biotherapy, Chengdu 610041, China § Department of Forensic Pathology, Medical School of Basic and Forensic Sciences, Sichuan University, Chengdu 610041, China ⊥ Molecular Biology and Lung Cancer Program, Lovelace Respiratory Research Institute, 2425 Ridgecrest Dr. SE, Albuquerque, New Mexico 87108, United States ‡

S Supporting Information *

ABSTRACT: Whether luteolin inhibits HBV replication has not been validated and the underlying mechanism of which has never been elucidated. In this study, we show that luteolin reduces HBV DNA replication in HepG2.2.15 cells. Luteolin effectively inhibited the expression of hepatocyte nuclear factor 4α (HNF4α) and its binding to the HBV promoters in HepG2.2.15 cells. While the extracellular signalregulated kinase (ERK) was activated by luteolin, inhibition of ERK abolished luteolin-induced HNF4α suppression. Consistently, blocking ERK attenuated the anti-HBV activity of luteolin. In a HBV replication mouse model, luteolin decreased the levels of HBsAg, HBeAg, HBV DNA replication intermediates, and the HBsAg and HBcAg expression. Taken together, our results validated the anti-HBV activity of luteolin in both in vitro and in vivo studies and established a signaling cascade consisting of ERK and HNF4α for inhibition of HBV replication by luteolin, which may be exploited for clinical application of luteolin for anti-HBV therapy. KEYWORDS: flavonoid, hepatitis B virus, replication, hepatocyte nuclear factor 4α, extracellular signal-regulated kinase

■

INTRODUCTION

new anti-HBV agents that are different from nucleos(t)ide analogues are particularly important and relevant. Luteolin is a common flavonoid that has multiple biological effects including immune-regulation, anti-inflammation, antioxidant, anticancer, and antivirus.8−10 Recently, several studies have shown that luteolin, isolated from herbs, inhibits the secretion of HBsAg and HBeAg in in vitro cultured HepG2.2.15 cells that bear the HBV genome, implying that luteolin is a potential anti-HBV agent.11,12 However, whether luteolin can inhibit HBV replication in vivo and the underlying mechanism are unclear. Luteolin is able to activate mitogen-activated protein kinases (MAPKs), a family of serine/threoine kinases consisting of inhibiting the activation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) and that are

Hepatitis B virus (HBV) infection is a worldwide public health problem. HBV infection can lead to chronic hepatitis B (CHB) that makes the liver prone to develop cirrhosis and hepatocellular carcinoma (HCC).1 It has been revealed that the HBV virus load is an important and independent predictor of cirrhosis and HCC, and antiviral therapy can delay or prevent disease progression.2−4 The currently approved antiHBV agents, nucleos(t)ide analogues and interferon, are efficacious in suppressing HBV replication.5,6 Although interferon can effectively block HBV replication and eradicate the virus in some patients, there are problems such as administration methods and severe side effects that limit its application.6,7 Nucleos(t)ide analogues, which target HBV polymerase for suppressing HBV replication, have been widely applied to clinical anti-HBV therapy. However, nucleos(t)ide analogues can hardly eradicate HBV in patients, and thus, most CHB patients have to undergo long-term therapy, which could result in drug-resistance.6,7 Therefore, to explore and develop © 2015 American Chemical Society

Received: Revised: Accepted: Published: 568

October 19, 2015 December 7, 2015 December 11, 2015 December 11, 2015 DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

Animal Model and Treatment. The HBV infection mouse model was established as described previous and used to assay the effects of luteolin in vivo.31 All of the animals received humane care, and the study protocols complied with Sichuan University’s guidelines. Female BALB/c mice, 18−20 g of weight and 6−8 weeks of age, were obtained from the Experimental Animal Center of West China Medical Center, Sichuan University, China. The HBV replication mouse model was established by hydrodynamic-injecting 10 μg of pHBV4.1 plasmids into the mice through tail vein within 6−8 s. After the mouse model has been established for 24 h, all mice were administrated luteolin by intraperitoneal injection for 3 days, as indicated in the figure legends. Three days after luteolin injection, all animals were euthanized, and the serum and the liver samples were preserved for further detection. Cytotoxicity Assay. The cytotoxicity of luteolin in HepG2.2.15 cells was determined by using a lactate dehydrogenease (LDH) release-base cytotoxicity detection kit (Promega, Madison, WI, U.S.A.). Cells were seeded in 96-well plates at 70−80% confluence. After being cultured for 24 h, the cells were treated with luteolin at different concentrations that ranged from 5 μM to 100 μM for 3 days. LDH release was determined, and cell death was calculated according to manufacturer’s instructions. Enzyme-Linked Immunosorbent Assay (ELISA). HBsAg and HBeAg in the cell culture medium and mouse serum were measured by using the ELISA kits (Kehua Bioengineering, Shanghai, China), respectively. HepG2.2.15 cells were seeded in 24-well plates at 70−80% confluence. After the cells were cultured for 24 h, they were treated with luteolin as indicated in the figure legend. The culture media were collected, and the levels of HBsAg and HBeAg were measured according to the manufacturer’s instructions, respectively. The measurement of HBsAg and HBeAg in mouse serum was the same as in the cultured medium. Real-Time PCR. HNF4α mRNA in HepG2.2.15 cells was examined by real-time PCR. Briefly, total RNA was extracted using Trizol (Invitrogen, IL, U.S.A.). One microgram of RNA from each sample was used for synthesis of cDNA with a reverse transcription kit (Takara, Japan). An equal volume of cDNA product was used in the real-time PCR. Real-time PCR was performed by applying the LightCycler 96 System (Roche, Germany) and using the FastStart Essential DNA Green Master (Roche, Germany) according to the manufacturer’s instructions. The primer sets for HNF4α and GAPDH were used as followed: human HNF4α: forward primer: G CT C CT C CT T C T G C T G C T G C ; r e v er se p r im e r : GGAAGAGCTTGAGACAGGCC; human GAPDH: forward primer: CCAGCGTCAAAGGTGGAGGA; reverse primer: ATGGGGAAGGTGAAGGTCGG. Immunohistochemistry. Mouse liver tissue samples were fixed in 10% formalin for 48 h and embedded with paraffin. HBsAg and HBcAg were detected by immunohistochemistry by using specific anti-HBsAg and anti-HBcAg antibodies, respectively. The positive staining cells of HBsAg and HBcAg were counted in random 5 fields under 400× magnification, respectively. Western Blot. HepG2.2.15 Cells and liver tissues were lysed in M2 buffer (20 mM Tris-HCl, pH 7.6, 0.5% NP-40, 250 mM NaCl, 3 mM EGTA, 3 mM EDTA, 2 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 20 mM β-glycerophosphate, 1 mM sodium vanadate, and 1 μg/mL leupeptin), and cOmplete Cocktail Tablet and PhosSTOP Cocktail Tablet

involved in the regulation of cell proliferation, apoptosis, and immune response.8,13−15 However, it seems that the modulation mechanism of MAPK signal pathways by luteolin is specific to a cell’s context and varies under diverse physiological environments. For instance, luteolin activates the JNK signalling pathway to induce apoptosis while it blocks ERK to inhibit cell proliferation and metastasis in malignant cancer cells.16−20 In contrast, luteolin suppresses the immune response by blocking inflammatory factors production via inhibiting ERK, JNK, and p38 in macrophages and monocytes.21 Besides, luteolin plays an important protecting role in ischemic brain injury, cardiomyocyte ischemic/reperfusion injury, and neurite outgrowth, which is through activating the ERK pathway.22−25 Interestingly, it has been shown that the ERK activation can lead to inhibition of HBV replication.26 However, it remains to be studied further whether luteolin exerts its anti-HBV activity involving MAPK signal pathways. Hepatocyte nuclear factor 4α (HNF4α) is one of the key transcription factors important for transcription and replication of HBV, which binds and upregulates the HBV promoter activity.27,28 It has been demonstrated that restraining the expression of HNF4α can significantly inhibit the transcription and replication of HBV.29 Activation of the MAPK signalling pathway can disrupt the enhancer-promoter communication of HNF4α that is critical for the expression of the HNF4α gene, thus down-regulating the expression of HNF4α.30 However, it is unknown whether MAPK and HNF4α are involved in the effects of luteolin on the replication of HBV. In this study, we systematically investigated the effect of luteolin on anti-HBV replication and underlying mechanism with in vivo and in vitro studies. We provide evidence showing that luteolin effectively inhibited HBV replication in HepG2.215 cells in vitro and in a HBV replication mouse model in vivo. Moreover, we demonstrate that luteolin suppressed the expression of HNF4α and reduce the binding level of HNF4α to the HBV preC/C promoters. Furthermore, we found that activation of ERK was responsible for downregulating HNF4α expression, which plays an important role in the inhibited effect of luteolin on HBV replication. The results suggested that luteolin is a potential anti-HBV agent, and ERKmediated inhibition of HNF4a could be exploited for suppressing HBV replication.

■

MATERIALS AND METHODS

Reagents and Antibodies. Luteolin was purchased from Sigma-Aldrich (L9283, St. Louis, MO, U.S.A.). The JNK inhibitor SP600125, p38 inhibitor SB203580, and ERK inhibitor U0126 were from Cell Signaling Technology (no. 8177, no. 9903, no. 5633, Danvers, MA, U.S.A.). The following antibodies were used for Western blot: anti-HNF4α (sc8987, Santa Cruz Biotechnology, CA, U.S.A.), antiphospho-JNK, antiJNK antiphospho-ERK, anti-ERK, antiphospho-p38 and antip38 (no. 9910s, no. 9926s, Cell Signaling Technology, Danvers, MA, U.S.A.), beta-actin, and GAPDH (220257, 200306-7E4, Zen BioScience, Chengdu, China). The following antibodies were used for immunohistochemistry: anti-HBsAg and antiHBcAg (MS-314, RB-1413, Thermo Fisher, IL, U.S.A.). Cells Culture. The steady HBV replication cell line HepG2.2.15 was used to evaluate the effects of luteolin in vitro. Cells were grown in DMEM with 10% fetal bovine serum, 1 mM glutamate, 100 units/ml penicillin, and 100 μg/mL streptomycin. 569

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

Figure 1. Luteolin inhibited the replication of HBV in vitro. (A) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 72 h. Cell death was measured by LDH released assay. (B) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 24 or 48 h. The levels of HBsAg were measured by ELISA. (C) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 24 and 48 h. The levels of HBeAg were measured by ELISA. (D) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 48 h, the HBV DNA replication intermediates in the cells were extracted and detected by Southern blot. (E) The relative intensity of Southern blot of all groups were obtained and quantitatively analyzed for the HBV DNA replication intermediates. All the experiments were repeated at least three times independently. Data shown are means ± SD. Statistical significance was examined by one-way analysis of variance pairwise comparison. P < 0.05 was considered statistically significant; *: P < 0.05; **: P < 0.01; ***: P < 0.001. Lu: luteolin; HBsAg: hepatitis B surface antigen; HBeAg: hepatitis e antigen; ETV: entecavir; RI: replication intermediates.

HBV DNA probe labeled using DIG-High Prime (Roche Applied Science, Penzberg, Germany) and then analyzed using DIG Luminescent Detection Kit for Nucleic Acids (Roche, Germany). The bands intensity was analyzed using the Quantity-One software (BIO-RAD). Electrophoretic Mobility Shift Assay (EMSA). Cells were treated with luteolin as indicated in the figure legends and harvested to extracted nuclear protein. Cells were lysed in 600− 1000 μL of Buffer A (10 mM HEPES, pH7.9, 10 mM KCl, 5 mM MgCl2, 1 mM DTT, 1 mM EDTA, 5% glycerol, 2 mM PMSF, 1 mM NaVO4, 10 mM NaF, cOmplete Cocktail 1 Tablet and PhosSTOP Cocktail 1 Tablet) and centrifuged for 5 s at 12 000 rpm. Discarding the supernatant and adding 30−60 μL Buffer C (20 mM HEPES, pH7.9, 0.42 M NaCl, 1.5 mM MgCl2, 1 mM EDTA, 0.5 mM DTT, 1% Nonidet P-40, 25% glycerol, 2 mM PMSF, cOmplete Cocktail 1 Tablet and PhosSTOP Cocktail 1 Tablet) and centrifuged for 15 min at 14 000 rpm, the supernatant was measured by BCA protein assay and preserved at −70 °C. Five micrograms of nuclear extracts of each samples was incubated with biotin-labeled

(Roche, Germany). Equal amounts of protein extracts were resolved by 10% SDS-polyacrylamide gel electrophoresis, and the proteins were detected by Western blot and visualized by enhanced chemiluminescence according to the manufacturer’s instructions (Thermo Fisher, IL, U.S.A.). Southern Blot. The isolation and determination of HBV DNA replication intermediates were performed as previously described.27,29,31 Briefly, cells were harvested and lysed in 0.4 mL of 100 mM Tris hydrochloride, pH8.0/0.2% (v/v) Nonidet P-40. The lysate was centrifuged for 4 min at 14 000 rpm, and the supernatant was adjusted to 100 mM NaCl, 10 mM EDTA, 0.8% (wt/vol) SDS, and 1.6 mg/mL Pronase and incubated for 1 h. The supernatant was extracted twice with phenol/ chloroform/isoamyl alcohol (50:48:2) and precipitated with 2 vol of ethanol and resuspended in 30 μL of TE buffer (10 mM Tris hydrochloride, pH 8.0/1 mM EDTA). The samples were separated by 1% agarose and transferred to Hybond-N+ membrane (Amersham Biosciences, Bucks, U.K.). After UVcrossing linked, the blot was prehybridized for 4 h and hybridized for 16−20 h with digoxigenin-labeled full-length 570

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

Figure 2. Luteolin inhibited the replication of HBV replication in vivo. BALB/c mice were hydrodynamically injected with 10 μg of pHBV4.1 plasmids through the tail vein. The mice were administrated the indicated concentrations of luteolin. (A,B) The levels of HBsAg and HBeAg in the serum were measured by ELISA. (C) The HBV DNA replication intermediates in the mice liver were extracted and detected by Southern blot. (D) The relative intensity of Southern blot of all groups were obtained and quantitatively analyzed for the HBV DNA replication intermediates. (E) The expression of HBsAg in the mice liver were detected by immunohistochemistry, and positive cells were shown under 100× and 400× magnification, respectively. (F) The expression of HBcAg in the mice liver was detected by immunohistochemistry, and positive cells were shown under 100× and 400× magnification, respectively. (G) The relative-positive cell rates of HBsAg in the mice liver were shown, and positively stained cells were by counted and analyzed in a random 5 fields under 400× magnification. (H) The relative-positive cell rates of HBcAg in the mice liver were shown, and positively stained cells were by counted and analyzed in random 5 fields under 400× magnification. All the experiments were repeated at least three times independently. Data shown are means ± SD. Statistical significance was examined by one-way analysis of variance pairwise comparison. P < 0.05 was considered statistically significant; *: P < 0.05; **: P < 0.01; ***: P < 0.001. Lu: luteolin; NC: negative control; HBsAg: hepatitis B surface antigen; HBeAg: hepatitis e antigen; HBcAg: hepatitis core antigen; ETV: entecavir; RI: replication intermediates. 571

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

Figure 3. Luteolin inhibited the expression of HNF4α and decreased the binding of HNF4α to the HBV preC/C promoters. (A) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 24 h. HNF4α protein was detected by Western blot. β-Actin was detected as an input control. (B) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 10 h. HNF4α mRNA was detected by real-time PCR. GAPDH mRNA was detected as an input control. (C) HepG2.2.15 cells were treated with luteolin (40 μM) for the indicated times. HNF4α mRNA was detected by real-time PCR. GAPDH mRNA was detected as an input control. (D) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 24 h. The binding of HNF4α to HNF4−1 (nt 1660−1678) of HBV preC/C promoter was detected by electrophoretic mobility shift assay (EMSA) (E) HepG2.2.15 cells were treated with the indicated concentrations of luteolin for 24 h. The binding of HNF4α to HNF4−2 (nt 1755−1773) of HBV preC/C promoter was detected by EMSA. Lu: luteolin.

minimally cytotoxic to cells. Therefore, the maximal concentration of 40 μM of luteolin was used in this study. The effect of luteolin on HBV replication in HepG2.2.15 cells was evaluated. The levels of HBsAg and HBeAg in the culture medium were determined by ELISA 24 and 48 h after luteolin treatment. The results showed that the secretion of HBsAg and HBeAg from HepG2.2.15 cells were inhibited by luteolin. The inhibitory effects increased along with the increase of luteolin concentration, which indicated that luteolin inhibited the secretion of HBsAg and HBeAg from HepG2.2.15 cells in a dose-dependent manner (Figure 1B,C). Cellular HBV DNA replication intermediates are one of the important markers representing the replication level of HBV. Therefore, Southern blot was used for measuring intracellular HBV DNA level in HepG2.2.15 cells after treatment with luteolin for 48 h. Luteolin effectively decreased the level of HBV DNA replication intermediates in HepG2.2.15 cells, and the inhibition effects was significant at the luteolin concentrations ranging from 10 μM to 40 μM (Figure 1D,E). The results demonstrated that luteolin has an anti-HBV activity in vitro.

oligonucleotides in binding buffer for 30 min at room temperature. Competition assays were performed by incubating the unlabled probe with the nuclear extracts for 20 min before addition of biotin-labled probe. The reaction samples were separated by 6% native polyacrylamide gels and then transferred to Hybond-N+ membrane (Amersham Biosciences, Bucks, U.K.). After it was UV-cross-linked, the blot was detected using the LightShift Chemiluminescent EMSA Kit (Thermo Fisher, IL, U.S.A.). The sequences of the probes were showed as followed: HNF4α-1:5′-GAGGACTCTTGGACTCTCA-3′ (nt 1660−1678): HNF4α-2:5′-TTAGGTTAAAGGTCTTTGT-3′ (nt 1755−1773).

■

RESULTS Luteolin Inhibited the Replication of HBV in HepG2.2.15 Cells at Noncytotoxic Concentrations. For selecting a noncytotoxic concentration to be used in the antiHBV study, the cytotoxicity of luteolin in HepG2.2.15 cells was first determined by LDH assay. When the luteolin concentration was below 40 μM, the cell death rates was less than 5% (Figure 1A), indicating that luteolin at 40 μM or less was 572

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

Figure 4. Luteolin inhibited the expression of HNF4α and the replication of HBV through activating the ERK pathway. HepG2.2.15 cells were left untreated or treated with luteolin 40 μM or pretreated with U0126 (10 μM), SP600125 (10 μM), and SB203580 (20 μM) for 2 h, followed by treatment with luteolin (40 μM) for 24 h. (A) Phospho-ERK and total ERK, phospho-JNK and total JNK, phospho-p38 and total p38 were detected by Western blot. GAPDH was detected as an input control. (B) HNF4α protein was detected by Western blot. GAPDH was detected as an input control. (C,D) The levels of HBsAg and HBeAg in the serum were measured by ELISA. (E) The HBV DNA replication intermediates in the cells were detected by Southern blot. (F) The relative intensity of Southern blot of all groups were obtained and quantitatively analyzed for the HBV DNA replication intermediates. All the experiments were repeated at least three times independently. Data shown are means ± SD. Statistical significance was examined by one-way analysis of variance pairwise comparison. p < 0.05 was considered statistically significant; *: P < 0.05; **: P < 0.01; ***: P < 0.001. Lu: luteolin; U0: U0126; SP: SP600125;SB: SB203580; RI: replication intermediates. 573

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

inhibits HNF4α expression and HBV replication,8,26,30 we investigated if the inhibitory effects of luteolin on the replication of HBV involves MAPKs. Indeed, luteolin significantly activated ERK and JNK in HepG2.2.15 cells. In contrast, luteolin inhibited p38 (Figure 4A). Interestingly, only the inhibitor of ERK U0126 but not the JNK inhibitor SP600125 and the p38 inhibitor SB203580, attenuated the inhibitory effect of luteolin on HNF4α expression (Figure 3B). The effectiveness of the inhibitors was confirmed by detection of the phosphorylated form of each kinase (Figure 4A). These results suggest that luteolin down-regulates HNF4α expression by activating ERK. We then examined whether luteolin inhibits HBV replication through the same pathway. The aforementioned inhibitors were used to pretreat the HepG2.2.15 cells before treatment with luteolin. Consistent with the results on HNF4α expression and promoter binding activity, only the ERK inhibitor U0126 attenuated the inhibitory effect of luteolin on secretion of HBsAg and HBeAg from HepG2.2.15 cells (Figure 4C−D). Moreover, U0126 also attenuated the inhibitory effect of luteolin on the HBV DNA replication intermediates in the HepG2.2.15 cells (Figure 4E,F). Although the SP600125 effectively blocked JNK luteolin-induced activation, it did not affect the effect of luteolin on HNF4α expression and HBV replication. These results suggest that luteolin activates ERK to suppress HNF4α expression, resulting in suppression of HBV replication in HepG2.2.15 cells. Luteolin Inhibited the Expression of HNF4α and Activated the ERK Pathway in Vivo. To validate the molecular mechanism of luteolin on HBV replication in vivo, we investigated HNF4α expression and MAPK activity in the HBV replication mouse model. Similar to the results in HepG2.2.15 cells, luteolin (20 mg/ kg) administration inhibited the expression of HNF4α in livers, which was significantly lower than that in the negative control group (Figure 5A). The ERK and JNK signal pathways were also activated by luteolin in the mouse liver cells, which was shown as increased phosphorylation of the respective kinase (Figure 5B). However, luteolin inhibited p38 activity in vivo (Figure 5B). Thus, the results are fully consistent with the in vitro results, suggesting that luteolin inhibits HBV replication may through ERK activation to reduce the expression of HNF4α.

Inhibitory Activity of luteolin on HBV Replication in Vivo. After having confirmed that luteolin has an inhibitory effect on HBV replication in vitro, we proceeded to investigate if the same effect exists in vivo with the HBV replication mouse model successfully established by our laboratory before.31 BALB/c mice were hydrodynamic-injected with 10 μg of pHBV4.1 plasmids through the tail vein within 6−8 s. The mice were treated with luteolin under the minimal liver-cytotoxic concentration (Supplemental Figure 1).32−34 Similar observations were made in vivo, after 3 days of administration of luteolin, the levels of HBsAg and HBeAg in mouse serum decreased gradually in a luteolin-concentration-dependent manner (Figure 2A,B, Supplemental Figure 2). We examined HBV DNA replication intermediates in the mouse liver. Luteolin effectively inhibited the production of HBV DNA in liver cells in a concentration-dependent manner (Figure 2C,D). We also measured the expression of HBsAg and HBcAg in the liver by immunohistochemistry. The results showed that luteolin suppressed the expression of HBsAg and HBcAg in the liver cells (Figure 2E−H). The frequency of HBsAgpositive hepatocytes was 7.42 ± 1.68% in the luteolin-treated mice (20 mg/kg) compared with 12.89 ± 1.83% in the untreated mice, while the frequency of HBcAg-positive hepatocytes was 28.08 ± 1.19% in the luteolin-treated mice (20 mg/kg) compared with 51.00 ± 3.33% in the untreated mice (Figure 2E−H). These in vivo results strongly suggest that luteolin can inhibit HBV replication in vivo. Luteolin Down-Regulated the Expression of HNF4α and Decreased the Binding of HNF4α to the HBV preC/C Promoter. After determination of the effect of luteolin in suppressing HBV replication in vitro and in vivo, we moved on to elucidate the underlying mechanism. It has been reported that HNF4α binds to the promoters of HBV to promote HBV transcription and replication, and inhibiting the expression of HNF4α can significantly attenuate HBV transcription and replication.27−29 Therefore, we first investigated whether luteolin affects the HNF4α expression. As shown in Figure 3A, the reduction of HNF4α expression was observed after treatment with luteolin for 24 h. The down-regulation of HNF4α expression by luteolin was in a dose-dependent manner starting at the concentration of 10 μM, and HNF4α expression was barely detected at the luteolin concentration of 40 μM (Figure 3A). Furthermore, luteolin reduced HNF4α mRNA expression in a dose-dependent manner (Figure 3B). The HNF4α mRNA level reduction by luteolin occurred at as early as 2 h after luteolin treatment, and the HNF4α mRNA suppression lasted for more than 12 h (Figure 3C). These results indicated that luteolin suppresses HNF4α expression via inhibiting HNF4α mRNA expression. Because HNF4α promotes HBV transcription and replication through direct binding to the promoters of HBV, we examined if luteolin decreases HNF4α binding to preC/C HBV promoters, the two major binding sites that are essential for the promotion function of HNF4α. The results showed that luteolin definitely decreased the binding level of HNF4α to the preC/C promoters in a dose-dependent manner on both binding sites (Figure 3D,E), suggesting that luteolin inhibits HBV replication through modulating the expression and promoter binding of HNF4α. Luteolin Down-Regulated the Expression of HNF4α and Inhibited the Replication of HBV through Activating the ERK Signal Pathway. Because luteolin is able to activate MAPK kinases and because MAPK kinases activation

■

DISCUSSION Along with the wide use of nucleotide and nucleoside analogues in clinics, resistance to this type of oral anti-HBV drugs has gradually increased. Due to severe side effects, the application of interferon is hindered. Thus, it is a urgent need to develop novel anti-HBV agents that function through different mechanisms. Previous in vitro studies suggested that luteolin has the inhibitory activity on HBsAg and HBeAg secretion in cultured cells. However, whether luteolin exerts the same antiHBV effect in vivo and the underlying mechanism are unclear. This study for the first time provides direct evidence showing luteolin effectively inhibits HBV replication in vivo. After reproducing the results that luteolin inhibits HBV replication in vitro in HepG2.2.15 cells, we validated this effect in vivo with the HBV replication mouse model. Moreover, luteolin significantly decreased the expression of HNF4α and its binding to the HBV preC/C promoters. While the ERK and JNK pathways were activated by luteolin in vitro and in vivo, only ERK was shown to play a pivotal role in HNF4α down574

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

In this study, we observed a pronounced decrease HNF4α binding to the HBV preC/C promoters after treatment with luteolin, which contributes to the inhibition of the replication of HBV by luteolin. However, RXRα and PPARα share the same binding site of HNF4α on the HBV promoter, which indicates that they are also involved in HBV transcription when HNF4α is inhibited.39 This may partly explain why luteolin could not completely block the HBV replication. On the other hand, it was reported that the phosphorylation of HNF4α decreases the protein, dimer formation and represses transcriptional activity.41 Although ERK kinase is involved, we observed a direct inhibitory effect of luteolin on HNF4α mRNA transcription, which is distinct to the phosphorylation-mediate HNF4α protein degradation. It remains to be determined how ERK mediates suppression of HNF4α mRNA expression. Several lines of evidence suggest that the MAPK pathway may participate in the transcription of HBV regulated by HNF4α: activation of MAPK pathways may be involved in IL6-mediated control of HBV infection through modulation the expression of HNF4α and HNF1α;42 the Ras-mediated MAPK activation suppresses the replication of HBV;26 and the expression of HNF4α was inhibited upon activating the MAPK pathway by PKC.30 Although luteolin activates the MAPK pathways, the roles of MAPKs in the biological properties of luteolin vary greatly in different cell types and different pathological and physiological conditions.8,22,25,43,44 It is important to clarify the role of MAPK pathway in the effects of luteolin on HBV replication. Our results show that luteolin activates ERK and JNK but inhibits p38. The JNK pathway is usually associated with apoptosis and inflammation; however, the apoptosis mechanism may be not involved in the anti-HBV mechanism of luteolin, because luteolin had little effect on cell death, and apoptosis was not affected by the ERK inhibitor or JNK inhibitor (Supplemental Figure 3). Interestingly, only blocking the ERK could abrogate the HNF4α down-regulation effect of luteolin. Moreover, in the presence of ERK inhibitor, the suppressive effect of luteolin on HBV replication was abolished. Therefore, these results indicated that luteolin suppresses HNF4α expression to inhibit HBV replication partly through ERK activation. While the activation of JNK and suppression of p38 by luteolin was observed, these MAPKs are apparently not involved in the anti-HBV effect of luteolin. Instead, JNK and p38 may be involved in other undetermined cellular function of luteolin. It remains to be determined how luteolin activates ERK in the hepatocyte. In lung cancer cells, luteolin activates JNK through ROS-mediated degradation of the MAPK phosphatase MKP1 and activation of the upsteam MAPK activation kinase MKK7.16,17 Whether these mechanisms are employed by luteolin in ERK activation in hepatocytes deserve future study. In conclusion, we provide evidence demonstrating that luteolin inhibits HBV replication in vitro and in vivo at a transcription level, which was through ERK-mediated downregulation of HNF4α expression. Our results suggest luteolin is a potential anti-HBV agent that suppresses HBV replication through modulating host transcription factors, which warrants further studies before clinical anti-HBV application.

Figure 5. Luteolin inhibited the expression of HNF4α and activated ERK and JNK in vivo. HBV replication mouse models were established. The mice were treated with luteolin (20 mg/kg) as described in Figure 2. (A) HNF4α protein was detected by Western blot. GAPDH was detected as an input control. (B) Phospho-ERK, total ERK, phospho-JNK, total JNK, phospho-p38, total p38, and HNF4α were detected by Western blot. GAPDH was detected as an input control. Lu: luteolin; NC: negative control.

regulation and the inhibitory activity of luteolin against HBV replication. In contrast, the activation of JNK and suppression of p38 observed both in vitro and in vivo are likely not involved in the anti-HBV activity of luteolin. It has been suggested that luteolin has antivirus activity against many virus, such as severe acute respiratory syndrome coronavirus (SARS-CoV), human immunodeficiency virus (HIV), enterovirus 71 (EV71), coxsackievirus A16 (CA16), and hepatitis C virus (HCV).32,35−37 It has been reported that luteolin was a highly active anti-HCV compound, which strongly inhibited the RNA dependent RNA polymerase (RdRp) activity of HCV replicase.37 The inhibitory activity of luteolin against HCV was due to its direct binding to the active site of RdRp.37 Luteolin was able to abrogate the function of HIV-1 trans-activator of transcription (Tat) and thus inhibiting the transcription, translation, or post-translational process of HIV-1.35 In addition, luteolin can increase the endogenous antiviral gene expression by activating the JAK/STAT pathway.38 In this study, we found that luteolin profoundly inhibited the replication of HBV, which is through a distinct mechanism that decreases the expression and DNA binding of the hepotocyte transcription factor HNF4α. HNF4α is an important transcription factor that plays a critical role in regulating the transcription and replication of HBV, which promotes the promoter activity of HBV through direct DNA binding.27,39 Unlike other transcription factors, such as retinoid X receptor (RXR) and peroxisome proliferatoractivated receptor (PPAR) that bind to DNA more efficiently as heterodimers, HNF4α primarily resides in the nucleus and binds to DNA as homodimers to regulate gene transcription.40

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.molpharmaceut.5b00789. 575

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics

■

(8) Lin, Y.; Shi, R.; Wang, X.; Shen, H. M. Luteolin, a flavonoid with potential for cancer prevention and therapy. Curr. Cancer Drug Targets 2008, 8 (7), 634−46. (9) Seelinger, G.; Merfort, I.; Wolfle, U.; Schempp, C. M. Anticarcinogenic effects of the flavonoid luteolin. Molecules 2008, 13 (10), 2628−51. (10) Cushnie, T. P.; Lamb, A. J. Antimicrobial activity of flavonoids. Int. J. Antimicrob. Agents 2005, 26 (5), 343−56. (11) Wang, H. L.; Geng, C. A.; Ma, Y. B.; Zhang, X. M.; Chen, J. J. Three new secoiridoids, swermacrolactones A-C and anti-hepatitis B virus activity from Swertia macrosperma. Fitoterapia 2013, 89, 183−7. (12) Tian, Y.; Sun, L. M.; Liu, X. Q.; Li, B.; Wang, Q.; Dong, J. X. Anti-HBV active flavone glucosides from Euphorbia humifusa Willd. Fitoterapia 2010, 81 (7), 799−802. (13) Qi, M.; Elion, E. A. MAP kinase pathways. J. Cell Sci. 2005, 118 (16), 3569−3572. (14) Dong, C.; Davis, R. J.; Flavell, R. A. MAP kinases in the immune response. Annu. Rev. Immunol. 2002, 20, 55−72. (15) Johnson, G. L.; Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002, 298 (5600), 1911−1912. (16) Bai, L.; Xu, X.; Wang, Q.; Xu, S.; Ju, W.; Wang, X.; Chen, W.; He, W.; Tang, H.; Lin, Y. A superoxide-mediated mitogen-activated protein kinase phosphatase-1 degradation and c-Jun NH(2)-terminal kinase activation pathway for luteolin-induced lung cancer cytotoxicity. Mol. Pharmacol. 2012, 81 (4), 549−55. (17) Ju, W.; Wang, X.; Shi, H.; Chen, W.; Belinsky, S. A.; Lin, Y. A critical role of luteolin-induced reactive oxygen species in blockage of tumor necrosis factor-activated nuclear factor-kappaB pathway and sensitization of apoptosis in lung cancer cells. Molecular pharmacology 2007, 71 (5), 1381−8. (18) Lee, H. J.; Wang, C. J.; Kuo, H. C.; Chou, F. P.; Jean, L. F.; Tseng, T. H. Induction apoptosis of luteolin in human hepatoma HepG2 cells involving mitochondria translocation of Bax/Bak and activation of JNK. Toxicol. Appl. Pharmacol. 2005, 203 (2), 124−31. (19) Lee, W. J.; Wu, L. F.; Chen, W. K.; Wang, C. J.; Tseng, T. H. Inhibitory effect of luteolin on hepatocyte growth factor/scatter factorinduced HepG2 cell invasion involving both MAPK/ERKs and PI3KAkt pathways. Chem.-Biol. Interact. 2006, 160 (2), 123−33. (20) Park, S. H.; Kim, J. H.; Lee, D. H.; Kang, J. W.; Song, H. H.; Oh, S. R.; Yoon, D. Y. Luteolin 8-C-beta-fucopyranoside inhibits invasion and suppresses TPA-induced MMP-9 and IL-8 via ERK/AP-1 and ERK/NF-kappaB signaling in MCF-7 breast cancer cells. Biochimie 2013, 95 (11), 2082−90. (21) Xagorari, A.; Roussos, C.; Papapetropoulos, A. Inhibition of LPS-stimulated pathways in macrophages by the flavonoid luteolin. Br. J. Pharmacol. 2002, 136 (7), 1058−64. (22) Qiao, H.; Zhang, X.; Zhu, C.; Dong, L.; Wang, L.; Zhang, X.; Xing, Y.; Wang, C.; Ji, Y.; Cao, X. Luteolin downregulates TLR4, TLR5, NF-kappaB and p-p38MAPK expression, upregulates the pERK expression, and protects rat brains against focal ischemia. Brain Res. 2012, 1448, 71−81. (23) Wu, X.; Xu, T.; Li, D.; Zhu, S.; Chen, Q.; Hu, W.; Pan, D.; Zhu, H.; Sun, H. ERK/PP1a/PLB/SERCA2a and JNK pathways are involved in luteolin-mediated protection of rat hearts and cardiomyocytes following ischemia/reperfusion. PLoS One 2013, 8 (12), e82957. (24) Sun, G. B.; Sun, X.; Wang, M.; Ye, J. X.; Si, J. Y.; Xu, H. B.; Meng, X. B.; Qin, M.; Sun, J.; Wang, H. W.; Sun, X. B. Oxidative stress suppression by luteolin-induced heme oxygenase-1 expression. Toxicol. Appl. Pharmacol. 2012, 265 (2), 229−40. (25) Lin, C. W.; Wu, M. J.; Liu, I. Y.; Su, J. D.; Yen, J. H. Neurotrophic and cytoprotective action of luteolin in PC12 cells through ERK-dependent induction of Nrf2-driven HO-1 expression. J. Agric. Food Chem. 2010, 58 (7), 4477−86. (26) Zheng, Y.; Li, J.; Johnson, D. L.; Ou, J. H. Regulation of hepatitis B virus replication by the ras-mitogen-activated protein kinase signaling pathway. Journal of virology 2003, 77 (14), 7707−12.

Cytotoxicity status of luteolin combined with MAPK inhibitors (PDF) Histological information dosing with luteolin or not (PDF) Quantitative serum HBsAg levels dosing with luteolin or not (PDF)

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Tel: 86-85422650. Fax: 86- 28 85423052. *E-mail: [email protected]. Tel: 86-85422650. Fax: 8628 85423052. Author Contributions ∥

These authors contributed equally to this work (L.B. and Y.N.). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Ms. Cong Liu for her expertise in IHC. This study was supported by the research grants from the National Natural Science Foundation of China (No. 81101602) and National Science and Technology Major Project (No. 2013ZX10002005). The authors declare no competing financial interest.

■

ABBREVIATIONS HBV; hepatitis B virus; MAPKs; mitogen-activated protein kinases; ERK; extracellular signal-regulated kinase; JNK; c-Jun N-terminal kinase; HNF4α; hepatocyte nuclear factor 4α; LDH; lactate dehydrogenease; ELISA; enzyme-linked immunosorbent assay; EMSA; electrophoretic mobility shift assay

■

REFERENCES

(1) Chen, J. D.; Yang, H. I.; Iloeje, U. H.; You, S. L.; Lu, S. N.; Wang, L. Y.; Su, J.; Sun, C. A.; Liaw, Y. F.; Chen, C. J. Risk Evaluation of Viral Load, E.; Associated Liver Disease/Cancer in, H. B. V. S. G. Carriers of inactive hepatitis B virus are still at risk for hepatocellular carcinoma and liver-related death. Gastroenterology 2010, 138 (5), 1747−54. (2) Iloeje, U. H.; Yang, H. I.; Su, J.; Jen, C. L.; You, S. L.; Chen, C. J. Risk Evaluation of Viral Load, E.; Associated Liver Disease/Cancer-In, H. B. V. S. G. Predicting cirrhosis risk based on the level of circulating hepatitis B viral load. Gastroenterology 2006, 130 (3), 678−86. (3) Chen, C. J.; Yang, H. I.; Su, J.; Jen, C. L.; You, S. L.; Lu, S. N.; Huang, G. T.; Iloeje, U. H. Group, R.-H. S. Risk of hepatocellular carcinoma across a biological gradient of serum hepatitis B virus DNA level. JAMA 2006, 295 (1), 65−73. (4) Liaw, Y. F.; Sung, J. J.; Chow, W. C.; Farrell, G.; Lee, C. Z.; Yuen, H.; Tanwandee, T.; Tao, Q. M.; Shue, K.; Keene, O. N.; Dixon, J. S.; Gray, D. F.; Sabbat, J. Cirrhosis Asian Lamivudine Multicentre Study, G. Lamivudine for patients with chronic hepatitis B and advanced liver disease. N. Engl. J. Med. 2004, 351 (15), 1521−31. (5) Yuen, M. F.; Lai, C. L. Treatment of chronic hepatitis B: Evolution over two decades. J. Gastroenterol. Hepatol. 2011, 26 (Suppl 1), 138−143. (6) Locarnini, S.; Hatzakis, A.; Chen, D. S.; Lok, A. Strategies to control hepatitis B: Public policy, epidemiology, vaccine and drugs. J. Hepatol. 2015, 62 (1S), S76−S86. (7) Yapali, S.; Talaat, N.; Lok, A. S. Management of hepatitis B: our practice and how it relates to the guidelines. Clin. Gastroenterol. Hepatol. 2014, 12 (1), 16−26. 576

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577

Article

Molecular Pharmaceutics (27) Tang, H.; McLachlan, A. Transcriptional regulation of hepatitis B virus by nuclear hormone receptors is a critical determinant of viral tropism. Proc. Natl. Acad. Sci. U. S. A. 2001, 98 (4), 1841−6. (28) Tang, H.; Raney, A. K.; McLachlan, A. Replication of the wild type and a natural hepatitis B virus nucleocapsid promoter variant is differentially regulated by nuclear hormone receptors in cell culture. Journal of virology 2001, 75 (19), 8937−48. (29) He, F.; Chen, E. Q.; Liu, L.; Zhou, T. Y.; Liu, C.; Cheng, X.; Liu, F. J.; Tang, H. Inhibition of hepatitis B Virus replication by hepatocyte nuclear factor 4-alpha specific short hairpin RNA. Liver Int. 2012, 32 (5), 742−51. (30) Hatzis, P.; Kyrmizi, I.; Talianidis, I. Mitogen-activated protein kinase-mediated disruption of enhancer-promoter communication inhibits hepatocyte nuclear factor 4alpha expression. Molecular and cellular biology 2006, 26 (19), 7017−29. (31) Liu, F. J.; Liu, L.; He, F.; Wang, S.; Zhou, T. Y.; Liu, C.; Deng, L. Y.; Tang, H. Establishment and primary application of a mouse model with hepatitis B virus replication. World journal of gastroenterology: WJG 2007, 13 (40), 5324−5330. (32) Yi, L.; Li, Z.; Yuan, K.; Qu, X.; Chen, J.; Wang, G.; Zhang, H.; Luo, H.; Zhu, L.; Jiang, P.; Chen, L.; Shen, Y.; Luo, M.; Zuo, G.; Hu, J.; Duan, D.; Nie, Y.; Shi, X.; Wang, W.; Han, Y.; Li, T.; Liu, Y.; Ding, M.; Deng, H.; Xu, X. Small molecules blocking the entry of severe acute respiratory syndrome coronavirus into host cells. Journal of virology 2004, 78 (20), 11334−9. (33) Domitrovic, R.; Jakovac, H.; Tomac, J.; Sain, I. Liver fibrosis in mice induced by carbon tetrachloride and its reversion by luteolin. Toxicol. Appl. Pharmacol. 2009, 241 (3), 311−21. (34) Domitrovic, R.; Jakovac, H.; Grebic, D.; Milin, C.; RadosevicStasic, B. Dose- and time-dependent effects of luteolin on liver metallothioneins and metals in carbon tetrachloride-induced hepatotoxicity in mice. Biol. Trace Elem. Res. 2008, 126 (1−3), 176−85. (35) Mehla, R.; Bivalkar-Mehla, S.; Chauhan, A. A flavonoid, luteolin, cripples HIV-1 by abrogation of tat function. PLoS One 2011, 6 (11), e27915. (36) Xu, L.; Su, W.; Jin, J.; Chen, J.; Li, X.; Zhang, X.; Sun, M.; Sun, S.; Fan, P.; An, D.; Zhang, H.; Zhang, X.; Kong, W.; Ma, T.; Jiang, C. Identification of luteolin as enterovirus 71 and coxsackievirus A16 inhibitors through reporter viruses and cell viability-based screening. Viruses 2014, 6 (7), 2778−95. (37) Manvar, D.; Mishra, M.; Kumar, S.; Pandey, V. N. Identification and evaluation of anti hepatitis C virus phytochemicals from Eclipta alba. J. Ethnopharmacol. 2012, 144 (3), 545−54. (38) Tai, Z. F.; Zhang, G. L.; Wang, F. Identification of small molecule activators of the janus kinase/signal transducer and activator of transcription pathway using a cell-based screen. Biol. Pharm. Bull. 2012, 35 (1), 65−71. (39) Raney, A. K.; Johnson, J. L.; Palmer, C. N.; McLachlan, A. Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter. Journal of virology 1997, 71 (2), 1058−71. (40) Jiang, G.; Nepomuceno, L.; Hopkins, K.; Sladek, F. M. Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors. Mol. Cell. Biol. 1995, 15 (9), 5131−43. (41) Hong, Y. H.; Varanasi, U. S.; Yang, W.; Leff, T. AMP-activated protein kinase regulates HNF4alpha transcriptional activity by inhibiting dimer formation and decreasing protein stability. J. Biol. Chem. 2003, 278 (30), 27495−501. (42) Hosel, M.; Quasdorff, M.; Wiegmann, K.; Webb, D.; Zedler, U.; Broxtermann, M.; Tedjokusumo, R.; Esser, K.; Arzberger, S.; Kirschning, C. J.; Langenkamp, A.; Falk, C.; Buning, H.; Rose-John, S.; Protzer, U. Not interferon, but interleukin-6 controls early gene expression in hepatitis B virus infection. Hepatology 2009, 50 (6), 1773−82. (43) Kang, O. H.; Choi, J. G.; Lee, J. H.; Kwon, D. Y. Luteolin isolated from the flowers of Lonicera japonica suppresses inflammatory mediator release by blocking NF-kappaB and MAPKs activation pathways in HMC-1 cells. Molecules 2010, 15 (1), 385−98.

(44) Kim, M. J.; Woo, J. S.; Kwon, C. H.; Kim, J. H.; Kim, Y. K.; Kim, K. H. Luteolin induces apoptotic cell death through AIF nuclear translocation mediated by activation of ERK and p38 in human breast cancer cell lines. Cell Biol. Int. 2012, 36 (4), 339−44.

577

DOI: 10.1021/acs.molpharmaceut.5b00789 Mol. Pharmaceutics 2016, 13, 568−577