Masking Nanoparticle Surfaces for Sensitive and Selective

Subscriber access provided by Mississippi State University Libraries

Article

Masking Nanoparticle Surfaces for Sensitive and Selective Colorimetric Detection of Proteins Byung-Ho Kim, In Seon Yoon, and Jae-Seung Lee Anal. Chem., Just Accepted Manuscript • Publication Date (Web): 30 Sep 2013 Downloaded from http://pubs.acs.org on October 1, 2013

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Masking Nanoparticle Surfaces for Sensitive and Selective Colorimetric Detection of Proteins Byung-Ho Kim, In Seon Yoon and Jae-Seung Lee* Department of Materials Science and Engineering, Korea University, Seoul 136-713, Republic of Korea ABSTRACT We have developed a convenient and efficient colorimetric detection system for protein targets using aptamer-gold nanoparticle conjugates. We take advantage of the correlation between the catalytic properties and the exposed surface area of the nanoparticles, which is inversely proportional to the amount of the aptamer-bound protein targets. As the concentration of the protein target increases, the nanoparticle surface area becomes more masked, thus increasing the reduction time of 4-nitrophenol for the color change. We also reduce the detection time by either redesigning the aptamer sequences or regulating their density. This detection system is highly selective, discriminating the target protein even at a concentration 1000 times higher than the limit of detection (LOD). Importantly, to the best of our knowledge, the LOD with the unaided eye in this work is the lowest for a colorimetric detection system using lysozyme as a model protein (16 nM). Lysozyme in chicken egg whites is directly analyzed using our detection system, whose results are in excellent agreement with the ELISA analysis.

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 25

Gold nanoparticles (AuNPs) have served as the “gold” standard in the fundamentals and applications of nanoscience owing to their unique chemical and physical properties.1-5 Based on such properties, a number of diagnostic applications of AuNPs with high sensitivity and selectivity have been demonstrated, particularly for the detection of physiologically and clinically important protein targets.6-10 Depending on the role of AuNPs in the detection scheme, various types of readouts are employed, such as fluorescence,11 electrochemical signals,12-14 light scattering,15, 16 and absorbance.17, 18 Among them, the absorbance-based colorimetric detection systems for protein targets are critical, particularly for point-of-care applications. Most colorimetric protein detection systems, however, still require complicated instrumentation such as a UV-vis spectrometer essentially for the quantitative analysis, especially at low analyte concentrations. Therefore, the development of a sensitive and selective colorimetric assay for protein targets whose readouts are truly visible to the unaided eye, regardless of the target concentration, would be a significant achievement as a convenient and facile diagnosis of protein markers and pathogens. Recently, significant efforts have been made to synthesize particulate nanomaterials with biomimetic functions.19-21 For example, several synthetic enzyme mimics based on iron oxide22, 23

, cerium oxide24, 25, and gold26-28 nanoparticles have been developed and investigated for their

potential utilization in detecting biological targets. Importantly, their catalytic activities play a significant role in amplifying the signal response to targets, and their reproducibility and stability surpass those of natural enzymes at various pH values and temperatures.29, 30 If these nanoparticles, in addition to their catalytic properties,31, 32 could accurately recognize a specific target with assistance from surface-conjugated chemical ligands such as aptamers,33-36 they would be specifically devised as “artificial” enzymes for biosensing.


Page 3 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Herein, we present a highly sensitive and selective colorimetric detection of protein targets using aptamer-gold nanoparticle conjugates (aptamer-AuNPs).37 These conjugates are composed of catalytically active AuNP cores for the amplification of the visual signal, and aptamers that are covalently conjugated to the AuNP surface for precise target recognition. Although these types of conjugates have been previously utilized for the protein detection,11, 17, 38 we have for the first time developed their novel, versatile functions as the artificial enzymes. The assay scheme takes advantage of the controlled access of the visible signaling substrate to the catalytic AuNP surface, which is quantitatively correlated with the surface coverage as determined by the aptamer-bound target proteins (Scheme 1). Importantly, for the signal readout, the assay is based only on unaided-eye recognition, and does not require any complicated instrumentation. Moreover, to the best of our knowledge, it exhibits the highest sensitivity reported to date for colorimetric detection systems for lysozyme, the model protein target in our work.39, 40

EXPERIMENTAL SECTION Materials. Sodium borohydride (cat.# 480886), 4-nitrophenol (cat.# 241326), sodium chloride solution (cat.# S5150), gold chloride trihydrate (cat.# 520918), dithiothreitol (cat.# 43815), Tween® 20 (cat.# P9416), trisodium citrate dihydrate (cat.# S4641), lysozyme (cat.# L6876), albumin (cat.# A7906), thrombin human (cat.# T9326), adenosine (cat.# a9251), ribonuclease A (cat.# R6513), cytochrome c (cat.# C2506), myoglobin (cat.# M1882), hemoglobin (cat.# H7379), conalbumin (cat.# C0755), α-lactalbumin (cat.# L6385), albumin (cat.# A5503), casein (cat.# C7078), glucose oxidase (cat.# G7141), and trypsin (cat.# T1426) were purchased from Sigma-Aldrich (MO, USA). Lysozyme aptamer (5´ HS-T10-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAG

Page 4 of 25

3´),

short

lysozyme

aptamer (5´ HS-ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAG 3´), thrombin aptamer (5´ HS-CCATCTCCACTTGGTTGGTGTGGTTGG 3´), adenosine aptamer (5´ HS-T10-ACCTGGGGGAGTATTGCGGAGGAAGGT 3´), and HS-T20 (5´ HS-T20 3´) were purchased from GenoTech Corp. (Daejeon, Republic of Korea). NAP-5 columns were purchased from GE Healthcare (Piscataway, NJ). Ultrapure water was provided by a Direct-Q 3 system and used as a solvent in all experiments. The UV-vis spectra were obtained by an Agilent 8453 UVvisible spectrophotometer. Synthesis of 15 nm AuNPs. AuNPs were synthesized by the citrate reduction of gold chloride trihydrate.41 Ultrapure water was brought to a boil, to which a gold chloride solution (1 mL, 12.7 mM) was added with vigorous stirring. Subsequently, a trisodium citrate solution (0.94 mL, 38.8 mM) was quickly added to the gold solution. The color of the solution gradually changed from yellow to blue, and finally became dark red, indicating the formation of 15 nm AuNPs. Synthesis of Aptamer-AuNPs. To synthesize aptamer-AuNPs, the monothiol DNA sequences were deprotected with a 0.10 M dithiothreitol solution (0.17 M phosphate buffer, pH 8.0) and purified using a NAP-5 column. The purified DNA sequences were combined with the 15 nm AuNP solution, and the mixture was salted (0.15 M NaCl and 0.01% Tween® 20), buffered to 10 mM phosphate at pH 7.4, and incubated for 2 h at room temperature. The aptamer-AuNPs were obtained by repeated centrifugation at 13000 rpm for 20 min, removal of the supernatant, and redispersion in a buffer solution (0.15 M NaCl, 0.01% Tween® 20, and 10 mM phosphate at pH 7.4). Finally, the concentration of the aptamer-AuNP solution was adjusted to 5 nM.


Page 5 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Detection of Lysozyme. A lysozyme solution (0.1 mL) was added to an aptamer-AuNP solution (0.1 mL, 5 nM), and the mixture was incubated for 10 min at 25 oC. Subsequently, a 4nitrophenol solution (0.4 mL, 0.01 M) was added to the mixture, to which a freshly prepared NaBH4 solution (0.4 mL, 0.2 M) was injected. The color of the product was observed every minute.

RESULTS AND DISCUSSION We first prepared a series of 11 lysozyme solutions with different concentrations, each combined with the aptamer-AuNP solution, and incubated the mixtures for 10 min at 25 oC to allow the lysozyme molecules to bind to the aptamer-AuNPs.42 Subsequently, aqueous solutions of 4-nitrophenol and NaBH4 were added into the mixtures, and the catalytic reduction of 4nitrophenol to 4-aminophenol was observed, which results in a color change from yellow to colorless. The time at which the color of the solution changed completely was considered the “color-change time” (CCT) and was obtained as a function of the lysozyme concentration (Figure 1A). Interestingly, we observed an almost linear and reproducible relationship between the CCT and the lysozyme concentration ranging from 10 to 100 nM, indicating the strong quantitative nature of the detection system. For the accurate determination of the CCT, the change in absorbance (Figure S1, Supporting Information) at 400 nm was monitored as a function of time during the catalytic reaction (Figure 1A, left inset). The kinetic analysis of the catalytic reduction clearly points out the CCT with an arrow (Figure 1A, left inset). To further investigate the quantitative response of the detection system to low lysozyme concentrations, we correlated the CCT with the lysozyme concentrations by varying the latter from 10 to 20 nM at every 2 nM (Figure 1A, right inset) and determined the limit of detection (LOD) to be 16 nM.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 25

Importantly, to the best of our knowledge, this LOD is the lowest lysozyme concentration that can be detected using a colorimetric detection system. Notably, in the absence of lysozyme, the CCTs of both AuNPs that are modified and not modified with aptamers were 6 min, indicating the negligible effect of the aptamers on the access of 4-nitrophenol to the AuNP surface. The color change of the detection system in the presence of different lysozyme concentrations at different CCTs is demonstrated in Figure 1B. The vials contain different concentrations of lysozyme ranging from 0 to 100 nM, as designated on the x-axis. At the very beginning of the reaction, all the vials exhibit yellow color, indicating the incomplete catalytic reduction of 4-nitrophenol. As the reaction proceeds, however, the vials containing 0 and 10 nM of lysozyme turn colorless first, which further shows time-dependent gradual color changes as a function of the lysozyme concentration. Significantly, our detection system visualizes the color signal with the same intensity regardless of the lysozyme concentration, which allows one to easily recognize the colorimetric response even at very low concentrations of lysozyme near the LOD. In fact, conventional colorimetric protein detection systems often merely correlate the protein concentration with the absorbance at a specific wavelength. This “target concentrationsignal intensity” correlation eventually requires equipment such as a UV-vis spectrometer for evaluation at low target concentrations, deviating from a true unaided-eye detection system. Therefore, instead of demonstrating the quantification of the target with the unaided eye, such detection systems usually emphasize the selective identification of the targets. In contrast, our system is truly colorimetric in quantifying the concentration of the target with the unaided eye. The colorimetric capability of the detection system was further evaluated with respect to the identification of the target species. We first chose seven physiologically relevant proteins with molecular weights similar to or higher than that of lysozyme: ovalbumin (Ova),


Page 7 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ribonuclease A (Rib), conalbumin (Con), α-lactalbumin (α-La), casein (Cas), trypsin (Try), and bovine serum albumin (BSA) (Table 1).18 For comparison, lysozyme (Lys) and a blank solution (cont) were also included as positive and negative controls, respectively. The nine analytes were combined at a concentration of 1 μg/mL (~70 nM in the case of Lys) with the aptamer-AuNPs, resulting in the highly selective colorimetric responses shown in Figure 2A. Importantly, only the mixture containing lysozyme remained yellow, indicating the tight and selective binding of lysozyme to the aptamer-AuNPs, masking the catalytic surfaces of the AuNPs. In contrast, the mixtures containing the other proteins or no protein turned colorless, owing to the exposed, and thus available, surface of the AuNPs for the catalytic reduction of 4-nitrophenol. This high selectivity was observed even at a protein concentration 100 times greater (0.1 mg/mL; ~7 μM in the case of lysozyme; Figure 2B). Interestingly, the mixture containing α-La became red owing to the dispersed AuNPs, which implies the formation of the partly masked aptamer-AuNPs by α-La. At this protein concentration, the amount of non-specifically bound αLa is sufficient to protect the aptamer-AuNPs from the highly reductive conditions, but yet insufficient to fully mask the catalytic surfaces of the AuNPs. Eventually, the aptamer-AuNPs survived the catalytic reduction of 4-nitrophenol, which otherwise would have led to the removal of the thiolated aptamers from the AuNPs, and thus, the irreversible aggregation of the AuNPs.43 As the protein concentration was further increased to 0.15 mg/mL (~10 μM in the case of lysozyme; Figure 2C), three more batches (Rib, Con, and BSA) exhibited the red color of dispersed AuNPs, indicating a higher occurrence of nonspecific binding of the proteins to the aptamer-AuNPs at a higher concentration. Interestingly, naturally colored proteins (cytochrome c (Cyt), myoglobin (Myo), and hemoglobin (Hem)), were independently examined with the aptamer-AuNPs at this concentration, and were found to exhibit distinguishable color changes



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 25

before and after the reaction with the aptamer-AuNPs (Figure S2, Supporting Information). When the protein concentration jumped to 1.5 mg/mL (~100 μM in the case of lysozyme; Figure 2D), however, the detection system eventually failed to exhibit selectivity, resulting in two additional yellow mixtures containing Try and BSA. Importantly, this result clearly demonstrates the excellent selectivity of the detection system at high protein concentrations up to 0.15 mg/mL, largely eliminating the possibility of nonspecific binding of non-target proteins at the physiological concentrations found in body fluids, a necessary condition for potential clinical applications. The selective colorimetric identification of lysozyme based on the aptamer-AuNP system was spectroscopically analyzed by obtaining the UV-vis spectra of the mixtures containing the proteins at 1 μg/mL (Figure 2E). Only the mixture containing lysozyme exhibits a strong plasmon absorption band at 400 nm, which explains the deep yellow color of the mixture owing to the presence of 4-nitrophenol. On the other hand, the mixtures containing the other proteins or no protein exhibited relatively weaker plasmon bands that were blue-shifted from 400 to 290 nm; no other absorbance bands were observed in the visible region. These spectral results demonstrate the complete conversion of 4-nitrophenol to 4-aminophenol in the mixtures that do not contain lysozyme, which is strongly associated with the efficient color change of the detection system. Interestingly, the mixture containing lysozyme also exhibits a minor band around 290 nm owing to the ongoing reduction of 4-nitrophenol during the given reaction time period. Judging from the 150-min CCT of the detection system at 1 μg/mL (~70 nM) of lysozyme (Figure 1A), the aptamer-AuNPs gradually reduce the 4-nitrophenol until the solution becomes completely colorless at 150 min.


Page 9 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We further controlled the kinetics of the detection scheme by chemically modifying the surface properties of the aptamer-AuNP probes. In fact, the extended lapse of the detection time until the signal response appeared could be a major detriment to the efficiency of the detection system, particularly at higher lysozyme concentrations. To overcome this obstacle, we decreased the surface density of the aptamer strands in order to reduce the number of masking lysozyme molecules, and consequently increased the exposed surface area of the aptamer-AuNPs at a given lysozyme concentration. For the regulation of the surface properties, we cofunctionalized the AuNPs with both the aptamer and thiolated polythymine strands (HS-T20), by introducing a given proportion (10% or 50%) of HS-T20 as a diluent during the conjugation of the aptamer and the AuNPs. After obtaining the CCT-[lysozyme] curves with the probes containing HS-T20, we analyzed the curve slopes and compared them with that of the CCT-[lysozyme] curve obtained with the original aptamer-AuNPs containing no HS-T20 (Figure 1A and Figure 3). As expected, the increased proportion of HS-T20 from 0% to 10% to 50% resulted in a decrease in the slope from 3.1 to 2.6 to 2.3 min/nM, respectively. Importantly, this observation means that kinetically more favorable consequences are associated with the thermodynamically less favorable conditions for the binding of lysozyme to the aptamer-AuNP probes. To further examine this proposal, we prepared a different type of aptamer-AuNP probe, whose binding to lysozyme is thermodynamically more unfavorable owing to the shorter aptamer sequence that does not contain the T10 spacer (see Materials in Experimental Section).44 This T10 spacer exists on the anchoring end near the thiol group of the original aptamer sequence for its higher binding affinity.44 Evidently, the slope of the corresponding CCT-[lysozyme] curve further decreased to 1.9 min/nM (Figure 3). This reduction in the slope corresponded to an approximately 40% decrease from the initial slope (3.1 min/nM), which demonstrates how a careful design of the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 25

probe sequences and composition, particularly by considering the thermodynamics and kinetics, could lead to an effective and simple improvement in the assay efficiency. Our next investigation was aimed at determining the enzymatic functionality of the lysozyme molecules that mask the aptamer-AuNP probes. In fact, nanoparticle-protein conjugates have been of great interest to researchers, especially those working in diagnostic or therapeutic applications of nanoparticle-protein coronas.45-47 When conjugated with lysozyme, our aptamer-AuNP probes could be described as a novel type of nanoparticle-protein conjugate. Therefore, the assessment of their functionality is essential for determining the potential applications of these structures. To evaluate the enzymatic functionality of lysozyme, we prepared two lysozyme solutions ([lysozyme] = 400 nM and 4 μM), and combined them with Micrococcus lysodeikticus, a typical substrate for lysozyme. Without the addition of lysozyme, a strong extinction of the substrate was observed over the entire visible wavelength range, indicating that the concentration of the substrate could be determined quantitatively.48 As lysozymes were introduced to the system, however, the extinction of the spectra decreased dramatically to 60% at 450 nm in 5 min ([lysozyme] = 400 nM), and at last became almost zero ([lysozyme] = 4 μM) (Figures 4A and B). Subsequently, we prepared the aptamer-AuNPs fully conjugated with lysozyme, combined them with the substrate solution, and recorded the resulting UV-vis spectrum after 5 min (Figure 4A). Although a slight increase in the extinction was observed in the overall spectrum below 600 nm owing to the additional extinction of the AuNPs, no decrease in the extinction was observed above 600 nm compared to the blank (Figures 4A and B). This unchanged spectrum of the substrate after the reaction with aptamer-AuNP-lysozyme conjugates indicates the suppressed enzymatic activity of the lysozyme when conjugated to the aptamer-AuNPs. This observation evidently suggests that the protein activity of the protein-


Page 11 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nanoparticle conjugates is critically dependent on the orientation and binding of the proteins on the nanoparticle surfaces, as demonstrated in other reports.49-52 We further explored the potential to generalize the detection scheme based on the nanoparticle-masking strategy for targets having different sizes or types. First, thrombin was chosen as a different protein target, and quantitatively analyzed using the aptamer-AuNP probes.17, 53 Interestingly, the CCT exhibited a strong correlation with the thrombin concentration between 20 and 60 nM (Figure 5). At higher thrombin concentrations, however, an abrupt plateau in the CCT-[thrombin] curve occurred from 70 nM onward, indicating that the AuNP surface was possibly masked by the maximum number of thrombin molecules. This earlier saturation compared to that of lysozyme could be attributed to the larger size of the thrombin molecule, whose molecular weight is 37000 g/mol, approximately 2.5 times as large as that of the lysozyme. Moreover, the consistent yet far shorter CCT of thrombin than that of lysozyme at the same target concentration (13 min and 270 min at 100 nM of thrombin and lysozyme, respectively) implies the presence of larger holes in the thrombin layer, through which the 4nitrophenol molecules have easier, and thus, more rapid access to the nanoparticle surface. The effect of the target size was further investigated with a much smaller organic molecule, adenosine.54 In fact, the molecular weight of adenosine is only ~267 g/mol, even smaller than that of the aptamer itself (the molecular weight of the adenosine aptamer is ~11856 g/mol). Obviously, the aptamer-AuNPs conjugated with adenosine did not exhibit any difference in the CCT from that of the aptamer-AuNPs not conjugated with adenosine (data not shown). The highly quantitative and qualitative properties of the detection system based on the aptamer-AuNP probes were finally evaluated with lysozyme targets that exist in natural media without any prior purification or extraction. Briefly, we collected egg whites from 40 chicken



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 25

eggs, diluted them 1000 times to minimize the possible interactions of the lysozyme with other egg white proteins, and analyzed the concentration of the lysozyme in each egg using the aptamer-AuNP probes (Figure S3, Supporting Information). The lysozyme concentration in the diluted samples was determined to vary from 200 to 400 nM, with the average concentration being 317 nM (Figure 6). These concentration values correspond to the range 2.86-5.72 mg/mL of lysozyme in the eggs. Importantly, these results are in excellent agreement with the indirect ELISA analysis of lysozyme in 500 eggs, where the lysozyme concentration ranges from 2.2 to 4.5 mg/mL.55 Considering how important it is for a detection system to be able to quantify targets in raw materials without any prior treatment, our detection scheme should be highly useful for practical applications.

CONCLUSIONS This paper is important for the following three reasons. (1) The simple conjugation of aptamers and AuNPs achieved a high sensitivity and selectivity on the basis of both the catalytic signal amplification and the aptamer-based target recognition as an artificial enzyme. (2) The catalytic activity of the nanoparticle surfaces was systematically controlled by masking the nanoparticle surfaces with the protein targets. (3) The target proteins in natural media were accurately and efficiently analyzed using the aptamer-AuNPs. Significantly, based on the development of appropriate aptamer sequences for various types of targets,34, 56-60 this detection scheme has a high potential to be extended to the on-site colorimetric detection of other types of proteins and possibly larger targets such as pathogenic bacteria and viruses in natural media.


Page 13 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28.

Alkilany, A. M.; Lohse, S. E.; Murphy, C. J. Accounts Chem. Res. 2013, 46, 650-661. Daniel, M.-C.; Astruc, D. Chem. Rev. 2004, 104, 293-346. Ghosh, S. K.; Pal, T. Chem. Rev. 2007, 107, 4797-4862. Niemeyer, C. M.; Simon, U. Eur. J. Inorg. Chem. 2005, 3641-3655. Dreaden, E. C.; Alkilany, A. M.; Huang, X. H.; Murphy, C. J.; El-Sayed, M. A. Chem Soc Rev 2012, 41, 2740-2779. Rosi, N. L.; Mirkin, C. A. Chem. Rev. 2005, 105, 1547-1562. Xia, F.; Zuo, X. L.; Yang, R. Q.; Xiao, Y.; Kang, D.; Vallee-Belisle, A.; Gong, X.; Yuen, J. D.; Hsu, B. B. Y.; Heeger, A. J.; Plaxco, K. W. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 10837-10841. Niemeyer, C. M. Angew. Chem., Int. Ed. 2001, 40, 4128-4158. Saha, K.; Agasti, S. S.; Kim, C.; Li, X. N.; Rotello, V. M. Chem. Rev. 2012, 112, 27392779. Dykman, L.; Khlebtsov, N. Chem Soc Rev 2012, 41, 2256-2282. Wang, W. J.; Chen, C. L.; Qian, M. X.; Zhao, X. S. Anal. Biochem. 2008, 373, 213-219. Das, J.; Aziz, M. A.; Yang, H. J. Am. Chem. Soc. 2006, 128, 16022-16023. Li, L. D.; Chen, Z. B.; Zhao, H. T.; Guo, L.; Mu, X. J. Sens. Actuator B-Chem. 2010, 149, 110-115. Cheng, A. K. H.; Ge, B.; Yu, H. Z. Anal. Chem. 2007, 79, 5158-5164. Truong, P. L.; Choi, S. P.; Sim, S. J. Small 2013, DOI: 10.1002/smll.201202638. Wang, W.; Wu, W. Y.; Zhong, X. Q.; Wang, W.; Miao, Q. A.; Zhu, J. J. Biosens. Bioelectron. 2011, 26, 3110-3114. Pavlov, V.; Xiao, Y.; Shlyahovsky, B.; Willner, I. J. Am. Chem. Soc. 2004, 126, 1176811769. Chen, Y. M.; Yu, C. J.; Cheng, T. L.; Tseng, W. L. Langmuir 2008, 24, 3654-3660. Sarikaya, M.; Tamerler, C.; Jen, A. K. Y.; Schulten, K.; Baneyx, F. Nat. Mater. 2003, 2, 577-585. De, M.; You, C. C.; Srivastava, S.; Rotello, V. M. J. Am. Chem. Soc. 2007, 129, 1074710753. Fischler, M.; Simon, U. J. Mater. Chem. 2009, 19, 1518-1523. Gao, L.; Zhuang, J.; Nie, L.; Zhang, J.; Zhang, Y.; Gu, N.; Wang, T.; Feng, J.; Yang, D.; Perrett, S.; Yan, X. Nat. Nanotechnol. 2007, 2, 577-583. Li, X. N.; Wen, F.; Creran, B.; Jeong, Y. D.; Zhang, X. R.; Rotello, V. M. Small 2012, 8, 3589-3592. Asati, A.; Santra, S.; Kaittanis, C.; Nath, S.; Perez, J. M. Angew. Chem., Int. Ed. 2009, 48, 2308-2312. Ornatska, M.; Sharpe, E.; Andreescu, D.; Andreescu, S. Anal. Chem. 2011, 83, 42734280. Comotti, M.; Della Pina, C.; Matarrese, R.; Rossi, M. Angew. Chem., Int. Ed. 2004, 43, 5812-5815. Zheng, X. X.; Liu, Q.; Jing, C.; Li, Y.; Li, D.; Luo, W. J.; Wen, Y. Q.; He, Y.; Huang, Q.; Long, Y. T.; Fan, C. H. Angew. Chem., Int. Ed. 2011, 50, 11994-11998. Luo, W. J.; Zhu, C. F.; Su, S.; Li, D.; He, Y.; Huang, Q.; Fan, C. H. ACS Nano 2010, 4, 7451-7458.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59.

Page 14 of 25

Taguchi, T.; Isozaki, K.; Miki, K. Adv. Mater. 2012, 24, 6462-6467. Shivhare, A.; Ambrose, S. J.; Zhang, H. X.; Purves, R. W.; Scott, R. W. J. Chem. Commun. 2013, 49, 276-278. Schauermann, S.; Nilius, N.; Shaikhutdinov, S.; Freund, H.-J. Accounts Chem. Res. 2012, DOI: 10.1021/ar300225s. Cuenya, B. R. Accounts Chem. Res. 2012, DOI: 10.1021/ar300226p. Cho, E. J.; Lee, J. W.; Ellington, A. D. Annu. Rev. Anal. Chem. 2009, 2, 241-264. Mascini, M.; Palchetti, I.; Tombelli, S. Angew. Chem., Int. Ed. 2012, 51, 1316-1332. Du, Y.; Li, B.; Wang, E. Accounts Chem. Res. 2012, 46, 203-213. Willner, I.; Zayats, M. Angew. Chem., Int. Ed. 2007, 46, 6408-6418. Liu, J.; Lu, Y. Nat. Protoc. 2006, 1, 246-252. Wang, Y. L.; Li, D.; Ren, W.; Liu, Z. J.; Dong, S. J.; Wang, E. K. Chem. Commun. 2008, 2520-2522. Wang, Y. Y.; Pu, K. Y.; Liu, B. Langmuir 2010, 26, 10025-10030. Song, Y. J.; Xu, C.; Wei, W. L.; Ren, J. S.; Qu, X. G. Chem. Commun. 2011, 47, 90839085. Kumar, S.; Aaron, J.; Sokolov, K. Nat. Protoc. 2008, 3, 314-320. Further optimization of the incubation time and temperature did not make any significant difference in data. Ansar, S. M.; Arneer, F. S.; Hu, W. F.; Zou, S. L.; Pittman, C. U.; Zhang, D. M. Nano Lett. 2013, 13, 1226-1229. Lytton-Jean, A. K. R.; Mirkin, C. A. J. Am. Chem. Soc. 2005, 127, 12754-12755. Casals, E.; Pfaller, T.; Duschl, A.; Oostingh, G. J.; Puntes, V. ACS Nano 2010, 4, 36233632. Cedervall, T.; Lynch, I.; Lindman, S.; Berggard, T.; Thulin, E.; Nilsson, H.; Dawson, K. A.; Linse, S. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 2050-2055. Yang, S. T.; Liu, Y.; Wang, Y. W.; Cao, A. N. Small 2013, 9, 1635-1653. Shugar, D. Biochim Biophys Acta 1952, 8, 302-309. Peluso, P.; Wilson, D. S.; Do, D.; Tran, H.; Venkatasubbaiah, M.; Quincy, D.; Heidecker, B.; Poindexter, K.; Tolani, N.; Phelan, M.; Witte, K.; Jung, L. S.; Wagner, P.; Nock, S. Anal. Biochem. 2003, 312, 113-124. Christianson, D. W.; Cox, J. D. Annu. Rev. Biochem. 1999, 68, 33-57. Ikeda, T.; Hata, Y.; Ninomiya, K.; Ikura, Y.; Takeguchi, K.; Aoyagi, S.; Hirota, R.; Kuroda, A. Anal. Biochem. 2009, 385, 132-137. Zhao, Q.; Gao, J. Chem. Commun. 2013, 49, 7720-7722. Krauss, I. R.; Merlino, A.; Giancola, C.; Randazzo, A.; Mazzarella, L.; Sica, F. Nucleic Acids Res. 2011, 39, 7858-7867. Liu, J. W.; Lu, Y. Angew. Chem., Int. Ed. 2006, 45, 90-94. Vidal, M. L.; Gautron, J.; Nys, Y. J. Agric. Food Chem. 2005, 53, 2379-2385. Medley, C. D.; Smith, J. E.; Tang, Z.; Wu, Y.; Tan, W. Anal. Chem. 2008, 80, 1067-1072. Zhu, G. Z.; Ye, M.; Donovan, M. J.; Song, E. Q.; Zhao, Z. L.; Tan, W. H. Chem. Commun. 2012, 48, 10472-10480. Zhang, J.; Wang, L. H.; Pan, D.; Song, S. P.; Boey, F. Y. C.; Zhang, H.; Fan, C. H. Small 2008, 4, 1196-1200. Wang, L. H.; Liu, X. F.; Hu, X. F.; Song, S. P.; Fan, C. H. Chem. Commun. 2006, 37803782.


Page 15 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

60.


Helwa, Y.; Dave, N.; Froidevaux, R.; Samadi, A.; Liu, J. W. ACS Appl. Mater. Interfaces 2012, 4, 2228-2233.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 25

Figure 1. Lee et al.

Figure 1. (A) A graph of the color-change time (CCT) as a function of the lysozyme concentration. The time-dependent change in absorbance at 400 nm was monitored during the spectral change of the detection mixture (left inset). The CCT-[lysozyme] curve was further investigated at low lysozyme concentrations (right inset). (B) A picture demonstrating the visual color changes of the detection mixtures containing different lysozyme concentrations in vials as the catalytic reaction progresses.


Page 17 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Figure 2. (A) The detection mixtures containing the aptamer-AuNP probes and different types of proteins (lysozyme (Lys), ovalbumin (Ova), ribonuclease A (Rib), conalbumin (Con), αlactalbumin (α-La), casein (Cas), trypsin (Try), bovine serum albumin (BSA), and a blank (cont)) at 1.0 μg/mL, (B) 0.1 mg/mL, (C) 0.15 mg/mL, and (D) 1.5 mg/mL. (E) UV-vis spectra of the detection mixtures containing the proteins at 1.0 μg/mL.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 25


Figure 3. The CCT-[lysozyme] curves obtained using different types of aptamer-AuNP probes. Note that the aptamer-AuNPs with different binding affinities were synthesized by introducing diluent DNA sequences on the particle surface, or by shortening the aptamer sequence itself.


Page 19 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Figure 4. (A) The UV-vis spectra of (1) the substrate (Micrococcus lysodeikticus) for lysozyme, (2) substrate and 400 nM of lysozyme, (3) substrate and 4 μM of lysozyme, (4) substrate and aptamer-AuNPs conjugated with lysozyme, and (5) aptamer-AuNPs conjugated with lysozyme. The UV-vis spectrum of the substrate only after its possible reaction with the aptamer-AuNPs conjugated with lysozyme (6) was obtained by subtracting the spectrum of the aptamer-AuNPs conjugated with lysozyme (5) from that of the initial mixture (4). (B) The quantitative analysis based on the relative extinction at 450 nm of the spectra in Figure 4(A). Note that the extinction of the substrate after its possible reaction with the aptamer-AuNPs conjugated with lysozyme (6) is almost the same as that of the initial substrate (1), indicating the inactivity of lysozyme conjugated to the aptamer-AuNPs.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 25


Figure 5. A graph of CCT as a function of a thrombin concentration based on the aptamer-AuNP probes. Note that the narrow dynamic range (from 20 to 60 nM of thrombin) could be owing to the larger size of the thrombin molecule.


Page 21 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Figure 6. A histogram describing the distribution of the chicken egg lysozyme concentrations determined using the aptamer-AuNPs. The width of the histogram interval is 40 nM from 200 to 440 nM.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 25

Scheme 1. Lee et al.

Scheme 1. A scheme depicting the colorimetric detection of lysozyme using the aptamer-AuNPs. In the presence of lysozyme, the lysozyme masks the surfaces of the aptamer-AuNP probe effectively, and prohibits the access of 4-nitrophenol to the catalytic AuNP surface. Without lysozyme, however, 4-nitrophenol freely approaches to the AuNP surface through the aptamer layer, and turns to colorless 4-aminophenol.


Page 23 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Lee et al. protein

source

abbreviation

M.W. (g/mol)

pI

lysozyme

chicken egg white

Lys

14300

11.1

ovalbumin

chicken egg white

Ova

45000

4.7

ribonuclease A

bovine pancreas

Rib

13700

9.3

conalbumin

chicken egg white

Con

78000

6.0

α-lactalbumin

bovine milk

α-La

14200

4.8

casein

bovine milk

Cas

N/A

N/A

trypsin

bovine pancreas

Try

24000

10.1-10.5

bovine serum albumin

bovine serum

BSA

69000

4.7

cytochrome c

equine heart

Cyt

12400

10.0-10.5

myoglobin

equine heart

Myo

17500

6.8

hemoglobin

human

Hem

64500

6.8

Table 1. Biological and physical properties of proteins. The data were obtained from the manufacturers or Reference 18.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 25

Supporting Information. Additional figures. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *Email: [email protected].

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (Grant No. NRF-2012R1A1A2A10042814).


Page 25 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents

for TOC only


Masking Nanoparticle Surfaces for Sensitive and Selective

Recommend Documents