Mechanisms for the Influence of Citrus Rootstocks on Fruit Size

Article pubs.acs.org/JAFC

Mechanisms for the Influence of Citrus Rootstocks on Fruit Size Xiangyu Liu,†,∥ Juan Li,*,‡,∥ Min Huang,§ and Jiezhong Chen*,† †

College of Horticulture, South China Agricultural University, Guangzhou 501642, China Department of Horticulture, Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China § Guangdong AIB Polytechnic College, Guangzhou 510507, China ‡

ABSTRACT: To obtain insight into potential mechanisms underlying the influence of rootstock on fruit size, we performed a comparative analysis of ‘Shatangju’ mandarin grafted onto two rootstocks. The results demonstrated that trees grafted onto Canton lemon produced larger fruits through an enhancement of cell expansion in the ripening period. The difference in fruit size may be due to greater auxin levels in fruits from trees on Canton lemon, and different auxin levels may be produced by parent trees as the result of AUX1 upregulation. Rootstocks also modulate auxin signaling by affecting the transcription of several auxin response factor genes. There were higher abscisic acid concentrations in fruits of ‘Shatangju’/Trifoliate orange, resulting in an inhibition of fruit growth and cell expansion through suppression of the synthesis of growth promoting hormones. Furthermore, expansins may be involved in the regulation of final fruit size by influencing cell expansion. Multiple pathways likely exist in citrus rootstocks that regulate fruit size. KEYWORDS: citrus, rootstock, fruit size, auxin, expression analysis, ARF, expansin

■

INTRODUCTION Citrus is one of the most important fruit crops worldwide and is beloved by consumers for its aesthetic appearance, delicious taste, and high nutritional value. Citrus is now grown in over 140 countries in tropical, subtropical, and Mediterranean climates and occupies a very important position in the international trade of agricultural products.1 Although numerous citrus species exist, the commercial citrus are categorized into several main groups: orange, grapefruit, mandarin, lemon, lime, and pummelo. ‘Shatangju’ (Citrus reticulate Blanco) is a mandarin cultivar that produces orange-red fruits that are high in soluble solids, seedless, and easy-peeling and have an excellent quality of taste. The fruits of ‘Shatangju’ mandarin ripen from late December to January in South China. The ‘Shatangju’ mandarin industry has rapidly expanded over the past five years because of the attractive high quality. This mandarin is now one of the most economically valuable fruits in South China. Citrus trees cultivated for commercial production consist of a scion and a rootstock. Previous studies have demonstrated that the choice of the citrus rootstock exerts a substantial influence on the scion fruit characteristics such as fruit size,2 rind appearance,3 and internal flavor,4 which are all important fruit quality parameters. Shafieizargar et al.2 reported that ‘Queen’ orange trees grafted on ‘Volkamer’ lemon produced the largest fruit but with the lowest total soluble solids (TSS) content, whereas ‘Queen’ orange trees grafted on ‘Cleopatra’ mandarin produced the smallest fruit with the lowest juice contents. Cantuarias-Avilés et al.5 investigated the horticultural performance of ‘Folha Murcha’ sweet orange grafted on 12 rootstocks and found that fruits from trees grafted on ‘Rangpur’ lime had a higher weight. This finding was consistent with the results of a previous study by Stenzel et al.,6 who demonstrated that ‘Rangpur’ lime rootstock induces heavier fruits to this scion. Tazima et al.7 reported the effect of nine rootstocks on ‘Okitsu’ © 2015 American Chemical Society

Satsuma mandarin and found that the Trifoliate orange rootstocks induced fruits with lower weight than those produced by trees on ‘Rangpur’ lime. Cantuarias-Avilés et al.8 also reported that Trifoliate orange as a rootstock induced fruit with better internal quality but with a smaller fruit size compared with the fruit from trees grafted on ‘Rangpur’ lime. The mechanisms underlying the influence of the rootstock on the fruit quality of a scion has been a very important subject of study in plant physiology. However, few studies have been published on this subject. Castle3 noted that the water and nutrient uptake capacities of rootstocks and in particular plant growth regulators may be among the most important factors involved. In this study, we investigated the role of rootstock in regulating citrus fruit size, one of the most important fruit qualities for citrus production and consumption. In recent years, our knowledge regarding the control of plant organ size has increased considerably due to research that has been conducted in model plants. Several genes related to the control of plant organ size, such as several auxin response factor (ARF) genes and expansin (EXP) genes, have been identified in the model plants Arabidopsis and tomato.9−11 In addition, the citrus genome has recently been sequenced,12 which can help increase the understanding of the mechanisms underlying the effects of citrus rootstocks on scion fruit size. Citrus fruit development is divided into three distinct phases.13 Phase I corresponds to the period between anthesis and physiological drop in June. In this phase, fertilization occurs, and cell division plays a leading role in the increase of fruit size. In Phase II, cell expansion, rather than cell division, plays a leading role, and the fruit rapidly increases in size for Received: Revised: Accepted: Published: 2618

December 5, 2014 January 31, 2015 February 19, 2015 February 19, 2015 DOI: 10.1021/jf505843n J. Agric. Food Chem. 2015, 63, 2618−2627

Article

Journal of Agricultural and Food Chemistry Table 1. Relevant Gene Information and Primers for Real-Time PCR Analysis accession no.

gene name

description

primer sequence (5′ to 3′)

Cs7g31320.1 Cs6g07990.1 Cs2g16620.1 Cs2g13710.1 Cs3g01570.1 Cs7g19770.1 Cs4g04520.1 Cs2g09440.1 Cs3g18940.1 Cs7g25670.1 Cs5g10820.1 Cs8g18640.1 Cs7g29830.1 Cs1g05000.1

AUX1 LAX2 PIN1 PIN-LIKES 2 ARF1 ARF2 ARF5 ARF6 ARF17 ARF18 EXP1 EXP3 EXP10 Actin

auxin transporter protein 1 auxin transporter-like protein 2 auxin efflux carrier component 1 auxin efflux carrier component auxin response factor 1 auxin response factor 2 auxin response factor 5 auxin response factor 6 auxin response factor 17 auxin response factor 18 expansin-A1 expansin-A3 expansin-A10 actin-7

CGGTTGCCTGTGGTGATACACGGTGAAGCTGACCAAGAG TTGTGTGGGAGAAGGTAATCGTGCGGAGTTGATAGGACCA GCAGCAACAACAACAACAGCTCCTCCTTCAGAGACAGGTGA CACACCCAAGACAGCAAATGAACGCTTTCACCCAATTCAG AGTTGGGAGGGCTGTTGATTGACCACTTGCCACTTCTTGG AATGAGGCAGCAGGGTAATGGGGCTTGTTCTTGGCTTGTA CACTTCACCTTCCACAAACAACCAGATTGAGCCACTTCCTCTC AGTCGGGTTCCTTCGGTAACATTAAAGCAGTCTATCACAC TGCTTGAGGTTACTTGGGATGGGAGGGAATGCGGTATGAAG GAAGTAAAGACACCCCACATCCAGAACCAGAACCATCAGAAG AATGCTCTCCCAAACAATGCATGCCTCCCTTCCTACTGC ACGGGTTCCGCTACTTCAACGCTCATCCAGCCAGTTCTTG CAAGAGCAAAGGCAAAGACGGAAATGACCCTCCTCGCTTC CCAAGCAGCATGAAGATCAAATCTGCTGGAAGGTGCTGAG

For fruit growth analysis, five fruit samples per tree were collected in accordance with the following schedule: October 16, 2012; November 15, 2012; December 5, 2012; December 25, 2012; and January 13, 2013. The collected fruits were transported to the laboratory on dry ice and immediately separated into the peel and flesh components, frozen in liquid nitrogen, and stored at −80 °C until further analysis. Cell-Size Measurements. Samples of ‘Shatangju’ mandarin fruits produced on the two rootstocks were collected on the designated sampling dates, and healthy peel sections along the equatorial region were removed and fixed in an FAA (formaldehyde, acetic acid, and ethanol) fixative. The fixed peel samples were dehydrated with ethanol and then embedded in paraffin according to the method previously described by Cajuste et al.16 The embedded tissues were sliced into 8 μm sections and stained with a 0.5% hematoxylin staining solution. For each fruit, three to five sections of peel were analyzed. The cell diameter, as an indicator of cell size, was measured in the flavedo layer, which comprises the exocarp for a citrus fruit, excluding the outer epidermal layer and the oil-gland region. The mean cell size was calculated for each section. Phytohormone Determinations. Fruit tissues were powdered in liquid nitrogen, extracted with 80% (v/v) methanol, containing 1 mM butylated hydroxy−toluene (BHT), for 4 h at 4 °C in the darkness, and then, centrifuged for 15 min at 6000 rpm before the supernatants were collected. The residue was extracted a second time as above, the supernatants were combined, and the volume was recorded. The supernatants were purified on a C18 Sep-Pak cartridge (Waters, Milford, MA, USA), evaporated to dryness in vacuum, and redissolved in a phosphate-buffered saline solution (pH 7.5). The contents of endogenous indole-3-acetic acid (IAA), zeatin riboside (ZR), gibberellins (GAs), and abscisic acid (ABA) were quantified by an enzyme-linked immunosorbent assay (ELISA) according to previously described procedures.17,18 The ELISA kit was purchased from China Agricultural University. The absorbance of each well was measured at 490 nm using a Microplate Reader (Infinite M200, Tecan, Austria). Two replicates were performed for each measurement. RNA Extraction and cDNA Synthesis. Total RNA was extracted from the frozen peel and pulp tissues of ‘Shatangju’ mandarin with TRIzol reagent according to the manufacturer’s protocol (TaKaRa, Otsu, Japan), and was then treated with DNase I (TaKaRa). UV absorption spectrophotometry and gel electrophoresis were employed to assess RNA quality and quantity. Subsequently, single-stranded cDNA was synthesized from the extracted total RNA using oligo(dT) primers and M-MLV reverse transcriptase (TaKaRa) following the manufacturer’s instructions. Sequence Retrieval, Primer Design, and Quantitative RealTime PCR Analysis. Gene sequences were retrieved from the NCBI (http://www.ncbi.nlm.nih.gov/) and orange genome bank (http:// citrus.hzau.edu.cn/orange/index.php) by performing keyword searches as well as homology searches. All of the gene-specific primers for realtime polymerase chain reaction (PCR) were designed using the Primer

four to six months. Finally, in Phase III, fruit growth is mostly arrested, and the fruit undergoes a nonclimacteric ripening process.13 Therefore, the final sizes of citrus fruit are determined by both the cell number and the cell size, which are determined by the processes of cell division and cell expansion, respectively. Any perturbations to the two processes may cause alterations in final fruit size.14 Numerous studies have demonstrated that rootstocks exert a significant influence on fruit quality under diverse cultivation conditions. To gain insight into the potential mechanisms by which rootstocks influence fruit size, we investigated the effects of two citrus rootstocks on the fruit growth of ‘Shatangju’ mandarin. The rootstock genotypes chosen were Trifoliate orange (Poncirus trifoliata (L.) Raf.) and Canton lemon (Citrus limonia Osbeck), which are known to confer low and high scion vigor, respectively, in China.15 We also conducted a hormone analysis and an expression-profiling study of the fruit from the two graft combinations.

■

MATERIALS AND METHODS

Plant Materials. This study was conducted at a commercial orchard in Yangchun, Guangdong Province, China (latitude 22°06′ N; longitude 111°42′ E; altitude 12.5 m). This area has a subtropical monsoon climate with a mean annual precipitation of 2380 mm, a mean annual temperature of 22.3 °C, and an annual mean of 1748.2 h of sunshine. The soil was classified as a red soil, with a pH of 5. The evaluated rootstocks were Trifoliate orange and Canton lemon, two rootstocks that are widely employed in China citrus production. Virusfree budwood of the ‘Shatangju’ mandarin was budded onto these rootstocks in January 2003, and the grafted plants were planted in spring 2004 at a spacing of 2.5 m × 3.0 m. The terms ‘Shatangju’/ Trifoliate orange and ‘Shatangju’/Canton lemon are used to refer specifically to the ‘Shatangju’ mandarin grafted on either the Trifoliate orange rootstock or the Canton lemon rootstock, respectively. The experimental design was a randomized complete block with five replicates, and the experimental unit was a single tree per plot. Disease and pest control measures were performed according to an integrated pest management method. Fruit quality was assessed from 2009 to 2012. Each year, 10 fruits were collected from each citrus tree in late December. For fruit quality analysis, the fruits were collected from the four quadrants of each plant, and the fruit fresh weight and fruit diameter were measured. The TSS content, which is expressed in °Brix, was assessed using a digital refractometer. The titratable acidity (TA) was determined by titration with 0.31 N NaOH. For the evaluations of tree growth in 2011 and 2012, the trunk diameter at 10 cm above the grafting line, the canopy volume, and the yield were measured. The canopy volume was calculated using the equation for one-half of a prolate spheroid. 2619

DOI: 10.1021/jf505843n J. Agric. Food Chem. 2015, 63, 2618−2627

Article

Journal of Agricultural and Food Chemistry 5 and BatchPrimer3 programs. The actin gene was used as a reference gene to normalize the expression of other genes. The primer sequences are listed in Table 1. Standard curves were created by analyzing a dilution series of mixed cDNA (spanning five orders of magnitude) to calculate the gene-specific PCR efficiency and the regression coefficient for each gene. Quantitative real-time PCR was performed in 384-well plates in a LightCycler 480 instrument (Roche, Basel, Switzerland) using the LightCycler 480 SYBR Green I Master kit. Each reaction mixture contained 5 μL of SYBR Green I Master, 3.2 μL of PCR-grade water, 1 μL of cDNA, and 0.4 μL of each of the 10 μM forward and the 10 μM reverse gene-specific primers for a final volume of 10 μL. Quantitative real-time PCR analysis was performed using the manufacturer’s recommended cycling parameters. The final relative expression levels of the target genes were calculated by the formula 2−ΔΔCT.19 Gene expression values represent the means of three biological replicates for each treatment. Statistical Analysis. Data were subjected to a t test using the SPSS 18.0 software (SPSS Inc., Chicago, IL, USA), and the figures were created using OriginPro 8.5 (OriginLab Corporation, Northampton, MA, USA).

during which the fruit weight steadily increased until December 5, the rate of increase becomes very slow, broadly resembling a flat line (constant weight) on ‘Shatangju’/Trifoliate orange, resulting in a final fruit weight and size of only 68.3 g and 54.9 mm, respectively (Figure 1A, B). In contrast, the weight and size of fruits of ‘Shatangju’/Canton lemon continued to increase linearly to approximately 86 g and 61 mm, respectively, which were approximately 26% and 11% heavier and larger than the corresponding ‘Shatangju’/Trifoliate orange values (Figure 1A, B). No difference in fruit size was observed between the trees on both rootstocks before December, which is consistent with our previous investigation of the 2011 growing season (data not shown). A classic example of the effect of rootstock on fruit size is provided by a comparison of sour orange and Rough lemon rootstocks. Fruits from trees grafted on Rough lemon were larger, compared to fruits from trees grafted on sour orange.20 Other studies have also reported that fruits from trees grafted on vigorous rootstocks, such as Rangpur lime, ‘Volkamer’ lemon, and ‘Orlando’ tangelo, are generally larger than those produced by trees on dwarfing rootstocks, for example, Trifoliate orange.2,5,8 Furthermore, ‘Shatangju’/Trifoliate orange trees produced fruits with higher TSS contents and TA values. No significant effects of rootstock on other fruit quality characteristics such as seed number and peel thickness were observed (Table 3). Studies have demonstrated that fruit size is correlated with the number of seeds per fruit21 and the crop load.22 Our results revealed that the seed numbers (Table 3) and the fruit yields (Table 2) did not differ significantly between the rootstocks, indicating that the effect of the citrus rootstock on the fruit size may be independent of any effect on the seed number or the fruit yield in this study. Meanwhile, the mean size of the flavedo cells was determined in cross sections of the equatorial regions of the epicarp (Figure 1C). Differences in the fruit size can be attributed to differences in cell size, cell number, or the amount of intercellular space.14 During the ripening period, the normal progression of cell expansion was arrested in the flavedo cells in the ‘Shatangju’/ Trifoliate orange, while the cell size of the ‘Shatangju’/Canton lemon continued to increase linearly, which induced a 11.6% greater final cell diameter than ‘Shatangju’/Trifoliate orange at the time of harvest (Figure 1C). In short, the results suggest that an enhancement of cell size, caused by increased cell enlargement, contributed greatly to the increase in the fruit size in ‘Shatangju’/Canton lemon compared with ‘Shatangju’/ Trifoliate orange. Hormone Levels. An increase in the IAA levels was observed in both the peel and the pulp of ‘Shatangju’/Canton lemon after December 5, whereas the IAA levels in fruits of ‘Shatangju’/Trifoliate orange remained stable, resulting in

■

RESULTS AND DISCUSSION Fruit Growth and Development. The choice of rootstock had a significant effect on tree vigor. The ‘Shatangju’ mandarin trees grafted on Canton lemon produced a greater canopy volume in both years and a larger trunk diameter (Table 2), Table 2. Tree Size and Yield of ‘Shatangju’ Mandarin on Canton Lemon and Trifoliate Orange Rootstocks, Average of the Years 2011 and 2012a rootstock Canton lemon Trifoliate orange

trunk diameter 10 cm above grafting line (cm)

canopy volume (m3)

yield (kg)

32.6 ± 1.6*

11.1 ± 0.4*

39.71 ± 4.1

24.6 ± 0.4

9.05 ± 0.3

45.58 ± 4.2

Data are means ± standard error of two years. Within a column, * indicates a significant difference on the basis of the independentsample t test at P < 0.05.

a

which showed more vigorous growth compared with the trees that were grafted onto Trifoliate orange. The ‘Shatangju’ mandarin trees produced similar fruit yields on the two rootstocks (Table 2). Fruit quality was determined for each commercial harvest from 2009 to 2012 (fifth to seventh year after planting) (Table 3). Trees grafted on Canton lemon produced larger fruit in terms of fruit weight and fruit transverse diameter, which were 25% and 9% greater, respectively, than the corresponding values for the ‘Shatangju’/Trifoliate orange fruits. Furthermore, the growth of ‘Shatangju’ mandarin fruit was significantly influenced by rootstocks (Figure 1). After a period

Table 3. Mean Values of Fruit Quality Variables for ‘Shatangju’ Mandarin Grafted on Either Canton Lemon or Trifoliate Orange Rootstocks, for the Period from 2009−2012a rootstock Canton lemon Trifoliate orange

fruit weight (g)

fruit transverse diameter (mm)

fruit vertical diameter (mm)

peel thickness (mm)

edible portion (%)

TSS (°Brix)

seed no. per fruit

TA (%)

71.94 ± 3.0*

54.47 ± 1.2*

44.19 ± 0.9

2.31 ± 0.15

68.46 ± 1.6

10.67 ± 0.5*

14.37 ± 2.0

0.29 ± 0.02*

57.55 ± 3.1

49.99 ± 1.5

41.81 ± 0.9

2.13 ± 0.12

70.84 ± 1.7

12.50 ± 0.3

12.71 ± 1.6

0.36 ± 0.02

TSS, total soluble solids; TA, titratable acidity. Data are means ± standard error of four years. Within a column, * indicates a significant difference on the basis of the independent-sample t test at P < 0.05.

a

2620


Article

Journal of Agricultural and Food Chemistry

Figure 1. Comparison of fruit growth of ‘Shatangju’ mandarin grafted on two rootstocks during the 2012 growing season. (A) Fruit fresh weight. (B) Fruit transverse diameter. (C) Cell size for the equatorial region of the flavedo portion. Error bars show the standard error of five biological replicates. * indicates a significant difference on the basis of the independent-sample t test at P < 0.05.

significantly higher IAA concentrations in ‘Shatangju’/Canton lemon during the ripening stage (Figure 2). The importance of auxins for fruit growth and maturation has been well established for a wide array of climacteric and nonclimacteric fruits. A number of studies have demonstrated that the IAA concentrations are typically high during the beginning of the cell expansion stage and then decline to low levels at the onset of ripening.23,24 By drawing on literature, it is clear that auxins are responsible for the increase in cell enlargement in fruit tissues.25−27 Applications of synthetic auxins after physiological drop have been demonstrated to increase late-stage citrus fruit growth and the final fruit size by affecting cell enlargement, rather than cell division, during juice vesicle development.28,29 Meanwhile, auxins may also play a relevant role in the control of fruit ripening.30 Applications of exogenous auxin delayed fruit ripening.31 For example, a preveraison auxin treatment delayed grape berry ripening, as measured by TSS, anthocyanins, and the onset of berry size increase, but increased the final fruit size.32 Thus, we concluded that the higher IAA levels in fruits of ‘Shatangju’/Canton lemon likely promoted cell enlargement, resulting in relatively larger fruit size during the later stages of fruit growth. Moreover, numerous studies have also described the effects of synthetic auxins on a range of citrus cultivars during the preharvest stage. Modise et al.33 suggested that the preharvest application of synthetic auxin inhibits the natural fall of orange fruit and increases the weight of the fruits that are retained, but contrasting results were described by Almeida et al.,34 who reported no significant effect of synthetic auxin on the fruit size. GAs have been known for a long time for their role in fruit set and development and promote both cell division and expansion.30 During the later stage of fruit development, the GA concentrations remained at a very low level after a decline in both tissues of ‘Shatangju’ mandarin fruit, and there was no difference in GA levels between the rootstocks (Figure 2). Meanwhile, the ZR concentrations in the fruit of ‘Shatangju’ mandarin decreased with ripening and were not significantly affected by the choice of rootstock except December 5 in the peel (Figure 2).

The ABA concentrations gradually increased in the peel during fruit development and ripening, and the ABA concentration was significantly greater in ‘Shatangju’/Trifoliate orange after December 5 (Figure 2). In the pulp, the ABA concentration time series followed a flattened curve, and the ABA concentration of the peel from the ‘Shatangju’/Trifoliate orange was greater compared with the peel from the ‘Shatangju’/Canton lemon. The ABA level is usually very low in the unripe fruit but increases as a fruit ripens.35,36 It was found that dwarfing rootstocks could induce higher ABA levels in the grafted trees.37 So, the higher ABA level in the fruit of ‘Shatangju’/Trifoliate orange may be attributed to a rootstock dwarfing effect induced by Trifoliate orange. ABA plays a positive role in fruit ripening, particularly for nonclimacteric fruit,38 but exerts an inhibiting effect on plant growth.39 Several studies have indicated that ABA, which serves as an antagonist to the other growth promoting hormones,40,41 had a negative impact on cell division by blocking or slowing the cell cycle progression42,43 and inhibited IAA-induced cell enlargement.44,45 The higher ABA levels in ‘Shatangju’/Trifoliate orange may inhibit the fruit growth and cell expansion through suppressing the synthesis of growth promoting hormones, such as GA and auxin. Expression Levels of Auxin-Related Genes in the Fruit. Auxin is generally produced in the young developing regions of plants such as the shoot apex, emerging leaves, developing lateral roots, primary root tips, and developing seeds.46 During the cell expansion stage of the fruit, auxin is transported from the seeds, which are an important site of auxin biosynthesis, to the fruit pedicel and the parent plant.47 As fruits mature and the seeds become dormant, auxin biosynthesis and export from the seeds are inhibited, and the concentrations in the fruit decrease.30,48 In this study, the final IAA concentrations in the seeds did not differ between the rootstocks (data not shown). Regarding the fruit, the explanation for the increased IAA levels in the fruits of ‘Shatangju’/Canton lemon during the later stages of fruit growth is considered. Auxin transport or distribution is known to passively occur through the bulk flow in the mature phloem and actively 2621


Article


Figure 2. Hormone levels in the fruit of ‘Shatangju’ mandarin grafted on two rootstocks during the 2012 growing season. (A) Changes in hormone levels in the peel. (B) Changes in hormone levels in the pulp. Error bars show the standard error of five biological replicates. * indicates a significant difference on the basis of the independent-sample t test at P < 0.05.

through carrier-mediated cell-to-cell movement.46,49 The PIN and AUX/LAX proteins have been suggested to function as the auxin efflux and influx carriers, respectively.49 The results presented in Figure 3A demonstrate that the expression of AUX1 and LAX2 genes were upregulated and exhibited significantly higher levels in the peel of ‘Shatangju’/Canton lemon at the later stage. The accumulation of AUX1 transcript was also markedly higher in the pulp of ‘Shatangju’/Canton lemon (Figure 3B). In contrast, the majority of the PIN family genes was scarcely expressed in the ‘Shatangju’ mandarin except PIN1 and PIN-LIKES 2, which showed considerably irregular expression patterns in the fruit, suggesting that, in fruit, the auxin influx may be promoted and may be greater than the auxin efflux at this stage. Previous studies have reported that AUX1 can regulate auxin transport between (and within) IAA source and sink tissues and facilitate auxin uptake in sink tissues.50,51 LAX3, another homologous gene, has been suggested to maintain the auxin sink-strength in sink tissues.52 Hence, we conclude that the higher IAA levels in fruits of ‘Shatangju’/Canton lemon may be attributed to an increased

IAA import from locations in the parent tree such as the leaves or roots. To strengthen our understanding of the role of IAA in fruit development and ripening, the relative expression levels of ARFs were assessed by qPCR analyses (Figure 4). ARFs bind to auxin response elements (AuxREs) in the promoters of auxin-regulated genes and mediate auxin signaling by activating or repressing the transcription of these genes.53 ARFs appear to act at the core of the auxin signal transduction pathway. When the auxin concentrations are low, ARFs dimerize with the Aux/ IAA protein, resulting in the repression of auxin response genes. In contrast, higher auxin concentrations cause degradation of the Aux/IAA protein through the 26S proteasome and the release of ARF transcription factors to modulate the expression of early auxin response genes.54 Recent studies have reported that ARFs are involved in the regulation of various aspects of fruit development.48,55 In this study, ARF2 expression gradually decreased in fruits of ‘Shatangju’/Canton lemon, whereas the pattern differed and the level of accumulation was significantly higher in ‘Shatangju’/ Trifoliate orange during the ripening period (Figure 4). A 2622


Article


Figure 3. Expression levels of auxin transport genes in the fruit of ‘Shatangju’ mandarin grafted on two rootstocks during the 2012 growing season. (A) Expression levels in the peel. (B) Expression levels in the pulp. Error bars show the standard error of three biological replicates. * and ** indicate significant differences on the basis of the independent-sample t test at P < 0.05 and P < 0.01, respectively.

Arabidopsis59 and is a cleavage target of the microRNA miR167.61 Devoghalaere et al.48 reported that ARF6 was upregulated in the later stage of apple fruit development, which is consistent with our study. The genetic marker developed from ARF6 was also mapped to the fruit size QTL, although this marker is not the strongest in that region.48 These results indicate that ARF genes are involved in the control of fruit size and that citrus rootstocks may modulate auxin signaling by affecting the ARF gene transcription levels in fruit, resulting in changes in fruit size. Expansin Gene Expression Levels in Fruit. Expansins are cell-wall-loosening proteins that induce the hydrolysis of matrix polymers, enabling the extension of plant cell walls.62 We evaluated the changes in expansin gene expression levels in ‘Shatangju’ mandarin grafted on two rootstocks because expansins have been suggested to play key roles in cell expansion and fruit softening during fruit growth and ripening.63 The accumulation patterns for EXP1 transcripts were similar for the peel and pulp of ‘Shatangju’ mandarin fruit (Figure 5). EXP1 expression gradually increased before December 5 and

similar behavior was also observed for ARF1, which has been suggested to share redundant functions with ARF2 in Arabidopsis.56 In Arabidopsis, arf 2 mutants exhibit pleiotropic effects, including elongated hypocotyls and larger organ sizes because of the increases in cell division and cell expansion.57 However, the role of the ARF2 protein in auxin signaling remains largely unknown. Several studies have reported that arf 2 mutations do not affect auxin signaling nor the endogenous free auxin content,56,58 suggesting that ARF2 does not participate in the auxin response pathway. ARF2 is thought to act as a transcriptional repressor and to have strong binding activity to synthetic auxin response elements.59 ARF2 may mask the effect of AuxREs and prevent the binding of other ARFs, especially ARF transcriptional activators.56,60 Furthermore, in this study, the accumulation of ARF6 transcripts increased with increasing ripening in the peel and pulp, and the transcript level was markedly higher in ‘Shatangju’/Canton lemon during the later stages of fruit development (Figure 4), suggesting that ARF6 may be involved in the regulation of ‘Shatangju’ mandarin fruit size. ARF6 is believed to function as a transcriptional activator in 2623


Article


Figure 4. Expression levels of ARF genes in the fruit of “Shatangju” mandarin grafted on two rootstocks during the 2012 growing season. (A) Expression levels in the peel. (B) Expression levels in the pulp. Error bars show the standard error of three biological replicates. *and ** indicate significant differences on the basis of the independent-sample t test at P < 0.05 and P < 0.01 respectively.

then steadily decreased; at this time, the level of EXP1 expression was greater in the fruit of ‘Shatangju’/Canton lemon than in ‘Shatangju’/Trifoliate orange in both tissues. The EXP10 gene in the pulp was upregulated during the ripening period, and the expression levels were also higher in ‘Shatangju’/Canton lemon at the later stage. The observed increase in EXP1 expression levels was in accordance with the results of Rose et al.,64 who reported that EXP1 is specifically expressed in ripening tomato fruit, suggesting that expansins

may contribute to cell wall disassembly and fruit softening. In addition, transgenic experiments have demonstrated increased cell elongation and organ dimensions in plants overexpressing EXPA165 or EXP10.66 The EXP3 expression patterns were irregular in the pulp, but the expression level in the peel was greater in ‘Shatangju’/Canton lemon than in ‘Shatangju’/ Trifoliate orange (Figure 5). Hence, the larger fruit size of ‘Shatangju’/Canton lemon is likely related to the higher activity of expansins, which function endogenously, because the activity 2624


Article


Figure 5. Expression levels of expansin genes in the fruit of ‘Shatangju’ mandarin grafted on two rootstocks during the 2012 growing season. (A) Expression levels in the peel. (B) Expression levels in the pulp. Error bars show the standard error of three biological replicates. * and ** indicate significant differences on the basis of the independent-sample t test at P < 0.05 and P < 0.01, respectively.

loosening because of higher expansin gene transcript levels and through the concomitant higher water uptake associated with the more extensive rooting system of this vigorous rootstock. The results of this study imply that multiple pathways may influence citrus rootstocks regarding fruit growth, and an understanding of these mechanisms may optimize the production of high quality citrus fruits.

of cell-wall-loosening agents contribute to cell expansion. The reason for the change in expansin activity of citrus fruit on various rootstocks is obscure. However, the activity of expansins may be regulated by either auxin,67 ethylene, or the cell wall pH.68 In conclusion, our results have demonstrated that citrus rootstocks exert a significant effect on fruit size through the regulation of cell size. The difference in fruit size was closely related to the increase in the IAA levels in the fruit of ‘Shatangju’/Canton lemon, which may result from the enhanced IAA import from parent trees. Multiple ARF genes, such as the transcriptional repressors ARF1 and ARF2 and the transcriptional activator ARF6, were significantly affected by the choice of rootstock and may be involved in the control of the fruit size. Although the IAA level in the ‘Shatangju’ mandarin fruit is closely related to the fruit size control induced by rootstocks, further studies are needed to confirm this relationship on other scions that are grafted onto different rootstocks and to survey whether the application of synthetic auxins strengthens or weakens the rootstock effect on fruit growth regulation. In addition, the ABA concentrations in the fruit of ‘Shatangju’/Trifoliate orange were greater than those in ‘Shatangju’/Canton lemon at the later stage of fruit development. The higher ABA levels in ‘Shatangju’/Trifoliate orange may inhibit the fruit growth and cell expansion through suppression of the synthesis of growth promoting hormones. Moreover, our present results indicate that the larger fruit of ‘Shatangju’/Canton lemon may be attributed to the enhanced cell expansion, which is achieved through increased cell wall

■

AUTHOR INFORMATION

Corresponding Authors

* (J. L.) Phone: +86 137 5177 4213; e-mail: 13751774213@ 139.com. *(J. C.) Phone: +86 020-8528 6902; e-mail: [email protected]. cn. Author Contributions ∥

Juan Li and Xiangyu Liu contributed equally to this work.

Funding

We are grateful to the Natural Science Foundation of Guangdong Province (S2013010013223), the National Natural Science Foundation of China (no. 31372008), the Training program of outstanding young teacher in Guangdong Province (no. yq2013095), and the Agricultural Industry Technology System of Fruit in Guangdong Province for financial support. Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED TSS, total soluble solids; TA, titratable acidity; ARFs, auxin response factors; EXP, expansin; ELISA, enzyme-linked 2625


Article


(20) Castle, W. S.; Tucker, D. P. H.; Krezdorn, A. H.; Youtsey, C. O. Rootstocks for Florida Citrus; University of Florida: Gainesville, FL, 1993. (21) Ketsa, S. Effects of seed number on fruit characteristics of tangerine. Seed 2010, 8 (16), 24. (22) Stopar, M.; Bolcina, U.; Vanzo, A.; Vrhovsek, U. Lower crop load for cv. Jonagold apples. J. Agric. Food Chem. 2002, 50 (6), 1643− 1646. (23) Buta, J. G.; Spaulding, D. W. Changes in indole-3-acetic acid and abscisic acid levels during tomato (Lycopersicon esculentum Mill.) fruit development and ripening. J. Plant Growth Regul. 1994, 13 (3), 163− 166. (24) Zhang, X.; Luo, G.; Wang, R.; Wang, J.; Himelrick, D. G. Growth and developmental responses of seeded and seedless grape berries to shoot girdling. J. Am. Soc. Hortic. Sci. 2003, 128 (3), 316− 323. (25) Teale, W. D.; Paponov, I. A.; Palme, K. Auxin in action: Signalling, transport and the control of plant growth and development. Nat. Rev. Mol. Cell Biol. 2006, 7 (11), 847−859. (26) Stern, R. A.; Flaishman, M.; Ben-Arie, R. Effect of synthetic auxins on fruit size of five cultivars of Japanese plum (Prunus salicina Lindl.). Sci. Hortic. (Amsterdam, Neth.) 2007, 112 (3), 304−309. (27) Gillaspy, G.; Ben-David, H.; Gruissem, W. Fruits: A developmental perspective. Plant Cell 1993, 5 (10), 1439−1451. (28) Agustí, M.; Almela, V.; Aznar, M.; El-Otmani, M.; Pons, J. Satsuma mandarin fruit size increased by 2,4-DP. HortScience 1994, 29 (4), 279−281. (29) El-Otmani, M.; Agustí, M.; Aznar, M.; Almela, V. Improving the size of ‘Fortune’ mandarin fruits by the auxin 2,4-DP. Sci. Hortic. (Amsterdam, Neth.) 1993, 55 (3−4), 283−290. (30) McAtee, P.; Karim, S.; Schaffer, R.; David, K. A dynamic interplay between phytohormones is required for fruit development, maturation, and ripening. Front Plant Sci. 2013, 4, 79. (31) Davies, C.; Boss, P. K.; Robinson, S. P. Treatment of grape berries, a nonclimacteric fruit with a synthetic auxin, retards ripening and alters the expression of developmentally regulated genes. Plant Physiol. 1997, 115 (3), 1155−1161. (32) Bottcher, C.; Harvey, K.; Forde, C. G.; Boss, P. K.; Davies, C. Auxin treatment of pre-veraison grape (Vitis vinifera L.) berries both delays ripening and increases the synchronicity of sugar accumulation. Aust. J. Grape Wine Res. 2011, 17 (1), 1−8. (33) Modise, D. M.; Likuku, A. S.; Thuma, M.; Phuti, R. The influence of exogenously applied 2, 4-dichlorophenoxyacetic acid on fruit drop and quality of navel oranges (Citrus sinensis L.). Afr. J. Biotechnol. 2009, 8 (10), 2131−2137. (34) Almeida, I. M. L. D.; Rodrigues, J. D.; Ono, E. O. Application of plant growth regulators at pre-harvest for fruit development of ‘PÊ RA’ oranges. Braz. Arch. Biol. Technol. 2004, 47, 511−520. (35) Richardson, G. R.; Cowan, A. K. Abscisic acid content of citrus flavedo in relation to colour development. J. Hortic. Sci. Biotechnol. 1995, 70 (5), 769−774. (36) Setha, S. Roles of abscisic acid in fruit ripening. Walailak J. Sci. Technol. 2012, 9 (4), 297−308. (37) Yadava, U. L.; Dayton, D. F. The relation of endogenous abscisic acid to the dwarfing capability of East Malling apple rootstocks. J. Am. Soc. Hortic. Sci. 1972, 97, 701−705. (38) Jia, H. F.; Chai, Y. M.; Li, C. L.; Lu, D.; Luo, J. J.; Qin, L.; Shen, Y. Y. Abscisic acid plays an important role in the regulation of strawberry fruit ripening. Plant Physiol. 2011, 157 (1), 188−99. (39) Jarret, R.; Gawel, N. Abscisic acid-induced growth inhibition of sweet potato (Ipomoea batatas L.) in vitro. Plant Cell, Tissue Organ Cult. 1991, 24 (1), 13−18. (40) Mahouachi, J.; Gómez-Cadenas, A.; Primo-Millo, E.; Talon, M. Antagonistic changes between abscisic acid and gibberellins in citrus fruits subjected to a series of different water conditions. J. Plant Growth Regul. 2005, 24 (3), 179−187. (41) Sun, J.; Li, C. Cross talk of signaling pathways between ABA and other phytohormones. In Abscisic Acid: Metabolism, Transport and

immunosorbent assay; IAA, indole-3-acetic acid; ZR, zeatin riboside; ABA, abscisic acid

■

REFERENCES

(1) Liu, Y.; Heying, E.; Tanumihardjo, S. A. History, global distribution, and nutritional importance of citrus fruits. Compr. Rev. Food Sci. Food Saf. 2012, 11 (6), 530−545. (2) Shafieizargar, A.; Awang, Y.; Shukor Juraimi, A.; Othman, R. Yield and fruit quality of ‘Queen’ orange [Citrus sinensis (L) Osb.] grafted on different rootstocks in Iran. Aust. J. Crop Sci. 2012, 6 (5), 777−783. (3) Castle, W. S. Rootstock as a fruit quality factor in citrus and deciduous tree crops. N. Z. J. Crop Hortic. Sci. 1995, 23 (4), 383−394. (4) Benjamin, G.; Tietel, Z.; Porat, R. Effects of rootstock/scion combinations on the flavor of citrus fruit. J. Agric. Food Chem. 2013, 61 (47), 11286−11294. (5) Cantuarias-Avilés, T.; Mourão Filho, F. D. A. A.; Stuchi, E. S.; Da Silva, S. R.; Espinoza-Nuñez, E. Horticultural performance of ‘Folha Murcha’ sweet orange onto twelve rootstocks. Sci. Hortic. (Amsterdam, Neth.) 2011, 129 (2), 259−265. (6) Stenzel, N. M. C.; Neves, C. S. V. J.; Scholz, M. B. D. S.; Gomes, J. C. Comportamento da laranjera ‘Folha Murcha’ em sete portaenxertos no noroeste do Paraná. Rev. Bras. Frutic. 2005, 27, 408−411. (7) Tazima, Z. H.; Neves, C. S. V. J.; Yada, I. F. U.; Leite Júnior, R. P. Performance of ‘Okitsu’ Satsuma Mandarin on nine rootstocks. Sci. Agric. (Piracicaba, Braz.) 2013, 70, 422−427. (8) Cantuarias-Avilés, T.; Mourão Filho, F. D. A. A.; Stuchi, E. S.; Silva, S. R. D.; Espinoza-Núñez, E. Tree performance and fruit yield and quality of ‘Okitsu’ Satsuma mandarin grafted on 12 rootstocks. Sci. Hortic. (Amsterdam, Neth.) 2010, 123 (3), 318−322. (9) Gre, L. B.; Magyar, Z.; López-Juez, E. New clues to organ size control in plants. Genome Biol. 2008, 9 (7), 226. (10) Gonzalez, N.; Beemster, G. T.; Inze, D. David and Goliath: What can the tiny weed Arabidopsis teach us to improve biomass production in crops? Curr. Opin. Plant Biol. 2009, 12 (2), 157−64. (11) Ariizumi, T.; Shinozaki, Y.; Ezura, H. Genes that influence yield in tomato. Breed Sci. 2013, 63 (1), 3−13. (12) Xu, Q.; Chen, L.; Ruan, X.; Chen, D.; Zhu, A.; Chen, C.; Bertrand, D.; Jiao, W.; Hao, B.; Lyon, M. P.; Chen, J.; Gao, S.; Xing, F.; Lan, H.; Chang, J.; Ge, X.; Lei, Y.; Hu, Q.; Miao, Y.; Wang, L.; Xiao, S.; Biswas, M. K.; Zeng, W.; Guo, F.; Cao, H.; Yang, X.; Xu, X.; Cheng, Y.; Xu, J.; Liu, J.; Luo, O. J.; Tang, Z.; Guo, W.; Kuang, H.; Zhang, H.; Roose, M. L.; Nagarajan, N.; Deng, X.; Ruan, Y. The draft genome of sweet orange (Citrus sinensis). Nat. Genet. 2012, 45 (1), 59−66. (13) Iglesias, D. J.; Cercós, M.; Colmenero-Flores, J. M.; Naranjo, M. A.; Ríos, G.; Carrera, E.; Ruiz-Rivero, O.; Lliso, I.; Morillon, R.; Tadeo, F. R.; Talon, M. Physiology of citrus fruiting. Braz. J. Plant Physiol. 2007, 19, 333−362. (14) Guo, M.; Simmons, C. R. Cell number counts − The fw2.2 and CNR genes and implications for controlling plant fruit and organ size. Plant Sci. 2011, 181 (1), 1−7. (15) Jiang, X. W.; Zeng, J. W.; Jiang, B.; Yi, G.; Shi, X. H. The effect of rootstocks on change of fruit quality and storage on tree of citrus reticulate ‘Nianju’. Acta Hortic. Sin. 2012, 02, 349−354. (16) Cajuste, J. F.; García-Breijo, F. J.; Reig-Armiñana, J.; Lafuente, M. T. Ultrastructural and histochemical analysis reveals ethyleneinduced responses underlying reduced peel collapse in detached citrus fruit. Microsc. Res. Tech. 2011, 74 (10), 970−979. (17) Teng, N.; Wang, J.; Chen, T.; Wu, X.; Wang, Y.; Lin, J. Elevated CO2 induces physiological, biochemical and structural changes in leaves of Arabidopsis thaliana. New Phytol. 2006, 172 (1), 92−103. (18) He, H. Y.; He, L. F.; Gu, M. H.; Li, X. F. Nitric oxide improves aluminum tolerance by regulating hormonal equilibrium in the root apices of rye and wheat. Plant Sci. 2012, 183, 123−30. (19) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25 (4), 402−408. 2626


Article

Journal of Agricultural and Food Chemistry Signaling; Zhang, D.-P., Ed.; Springer: Dordrecht, Netherlands, 2014; pp 243−253. (42) Smalle, J. The pleiotropic role of the 26S proteasome subunit RPN10 in Arabidopsis growth and development supports a substrateSpecific function in abscisic acid signaling. Plant Cell 2003, 15 (4), 965−980. (43) Swiatek, A.; Lenjou, M.; Van Bockstaele, D.; Inze, D.; Van Onckelen, H. Differential effect of jasmonic acid and abscisic acid on cell cycle progression in tobacco BY-2 cells. Plant Physiol. 2002, 128 (1), 201−211. (44) Tanada, T. Indoleacetic acid and abscisic acid antagonism: II. On the phytochrome-mediated attachment of barley root tips on glass. Plant Physiol. 1973, 51 (1), 154−7. (45) Gehring, C. A.; Irving, H. R.; Parish, R. W. Effects of auxin and abscisic acid on cytosolic calcium and pH in plant cells. Proc. Natl. Acad. Sci. U.S.A. 1990, 87 (24), 9645−9. (46) Michniewicz, M.; Brewer, P. B.; Friml, J. Polar auxin transport and asymmetric auxin distribution. Arabidopsis Book 2007, 5, e0108. (47) Pattison, R. J.; Catala, C. Evaluating auxin distribution in tomato (Solanum lycopersicum) through an analysis of the PIN and AUX/LAX gene families. Plant J. 2012, 70 (4), 585−98. (48) Devoghalaere, F.; Doucen, T.; Guitton, B.; Keeling, J.; Payne, W.; Ling, T. J.; Ross, J. J.; Hallett, I. C.; Gunaseelan, K.; Dayatilake, G. A.; Diak, R.; Breen, K. C.; Tustin, D. S.; Costes, E.; Chagné, D.; Schaffer, R. J.; David, K. M. A genomics approach to understanding the role of auxin in apple (Malus x domestica) fruit size control. BMC Plant Biol. 2012, 12, 7. (49) Petrasek, J.; Friml, J. Auxin transport routes in plant development. Development 2009, 136 (16), 2675−88. (50) Marchant, A.; Bhalerao, R.; Casimiro, I.; Eklof, J.; Casero, P. J.; Bennett, M.; Sandberg, G. AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 2002, 14 (3), 589−97. (51) Vandenbussche, F.; Petrasek, J.; Zadnikova, P.; Hoyerova, K.; Pesek, B.; Raz, V.; Swarup, R.; Bennett, M.; Zazimalova, E.; Benkova, E.; Van Der Straeten, D. The auxin influx carriers AUX1 and LAX3 are involved in auxin-ethylene interactions during apical hook development in Arabidopsis thaliana seedlings. Development 2010, 137 (4), 597−606. (52) Swarup, K.; Benkova, E.; Swarup, R.; Casimiro, I.; Peret, B.; Yang, Y.; Parry, G.; Nielsen, E.; De Smet, I.; Vanneste, S.; Levesque, M. P.; Carrier, D.; James, N.; Calvo, V.; Ljung, K.; Kramer, E.; Roberts, R.; Graham, N.; Marillonnet, S.; Patel, K.; Jones, J. D.; Taylor, C. G.; Schachtman, D. P.; May, S.; Sandberg, G.; Benfey, P.; Friml, J.; Kerr, I.; Beeckman, T.; Laplaze, L.; Bennett, M. J. The auxin influx carrier LAX3 promotes lateral root emergence. Nat. Cell Biol. 2008, 10 (8), 946−54. (53) Guilfoyle, T. J.; Hagen, G. Auxin response factors. Curr. Opin. Plant Biol. 2007, 10 (5), 453−460. (54) Guilfoyle, T. Plant biology: Sticking with auxin. Nature 2007, 446 (7136), 621−2. (55) Kumar, R.; Tyagi, A. K.; Sharma, A. K. Genome-wide analysis of auxin response factor (ARF) gene family from tomato and analysis of their role in flower and fruit development. Mol. Genet. Genomics 2011, 285 (3), 245−260. (56) Okushima, Y.; Mitina, I.; Quach, H. L.; Theologis, A. AUXIN RESPONSE FACTOR 2 (ARF2): A pleiotropic developmental regulator. Plant J. 2005, 43 (1), 29−46. (57) Schruff, M. C.; Spielman, M.; Tiwari, S.; Adams, S.; Fenby, N.; Scott, R. J. The AUXIN RESPONSE FACTOR 2 gene of Arabidopsis links auxin signalling, cell division, and the size of seeds and other organs. Development 2006, 133 (2), 251−61. (58) Ellis, C. M.; Nagpal, P.; Young, J. C.; Hagen, G.; Guilfoyle, T. J.; Reed, J. W. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development 2005, 132 (20), 4563−74. (59) Ulmasov, T.; Hagen, G.; Guilfoyle, T. J. Dimerization and DNA binding of auxin response factors. Plant J. 1999, 19 (3), 309−19.

(60) Lim, P. O.; Lee, I. C.; Kim, J.; Kim, H. J.; Ryu, J. S.; Woo, H. R.; Nam, H. G. Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated leaf longevity. J. Exp. Bot. 2010, 61 (5), 1419−30. (61) Wu, M. F.; Tian, Q.; Reed, J. W. Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development 2006, 133 (21), 4211−8. (62) Cosgrove, D. J. Loosening of plant cell walls by expansins. Nature 2000, 407, 321−326. (63) Kalamaki, M. S.; Powell, A. L. T.; Struijs, K.; Labavitch, J. M.; Reid, D. S.; Bennett, A. B. Transgenic overexpression of expansin influences particle size distribution and improves viscosity of tomato juice and paste. J. Agric. Food Chem. 2003, 51 (25), 7465−7471. (64) Rose, J. K.; Lee, H. H.; Bennett, A. B. Expression of a divergent expansin gene is fruit-specific and ripening-regulated. Proc. Natl. Acad. Sci. U.S.A. 1997, 94 (11), 5955−60. (65) Dal Santo, S.; Fasoli, M.; Cavallini, E.; Tornielli, G. B.; Pezzotti, M.; Zenoni, S. PhEXPA1, a Petunia hybrida expansin, is involved in cell wall metabolism and in plant architecture specification. Plant Signaling Behav. 2011, 6 (12), 2031−2034. (66) Cho, H. T.; Cosgrove, D. J. Altered expression of expansin modulates leaf growth and pedicel abscission in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U.S.A. 2000, 97 (17), 9783−8. (67) Carrera, E.; Ruiz-Rivero, O.; Peres, L. E.; Atares, A.; GarciaMartinez, J. L. Characterization of the procera tomato mutant shows novel functions of the SlDELLA protein in the control of flower morphology, cell division and expansion, and the auxin-signaling pathway during fruit-set and development. Plant Physiol. 2012, 160 (3), 1581−96. (68) Vreeburg, R. A. M.; Benschop, J. J.; Peeters, A. J. M.; Colmer, T. D.; Ammerlaan, A. H. M.; Staal, M.; Elzenga, T. M.; Staals, R. H. J.; Darley, C. P.; McQueen-Mason, S. J.; Voesenek, L. A. C. J. Ethylene regulates fast apoplastic acidification and expansin A transcription during submergence-induced petiole elongation in Rumex palustris. Plant J. 2005, 43 (4), 597−610.

2627


Mechanisms for the Influence of Citrus Rootstocks on Fruit Size

Recommend Documents