Metabolic Engineering of Escherichia coli for ... - ACS Publications

Oct 12, 2016 - *Phone: +86-025-85427962. E-mail: [email protected]. ... For a more comprehensive list of citations to this article, users are encouraged...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

Metabolic Engineering of Escherichia coli for Astragalin Biosynthesis Jianjun Pei,†,‡,§,# Ping Dong,†,‡,# Tao Wu,†,‡ Linguo Zhao,*,†,‡,§ Xianying Fang,†,‡,§ Fuliang Cao,†,‡ Feng Tang,∥ and Yongde Yue∥ †

Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing, China College of Chemical Engineering, Nanjing Forestry University, Nanjing, China § Jiangsu Key Lab of Biomass Based Green Fuels and Chemicals, Nanjing, China ∥ International Centre for Bamboo and Rattan, Beijing, China ‡

S Supporting Information *

ABSTRACT: Astragalin (kaempferol 3-O-glucoside) is used as a standard to assess the quality of Radix astragali and has exhibited a number of biological properties. In this work, we screened several UDP-dependent glycosyltransferases (UGT) for their potential as efficient biocatalysts for astragalin synthesis. The highest astragalin production with 285 mg/L was detected in the recombinant strain expressing UGT from Arabidopis thaliana (AtUGT78D2). To further improve astragalin production, an efficient UDP-glucose synthesis pathway was reconstructed in the recombinant strain by introducing sucrose permease, sucrose phosphorylase, and uridylyltransferase. On the basis of those results, a recombinant strain, BL21-II, was constructed to produce astragalin. By optimizing conversion conditions, astragalin production was increased from 570 to 1708 mg/L. The production was scaled up using a fed-batch fermentation, and maximal astragalin production was 3600 mg/L, with a specific productivity of 150 mg/L/h after 24 h incubation and a corresponding molar conversion of 91.9%, the highest yield reported to date. KEYWORDS: flavonoid-O-glycoside, astragalin, UDP-dependent glycosyltransferase, UDP-glucose, metabolic engineering

■

INTRODUCTION Flavonoids, including the anthoxanthins, flavanones, flavanonols, flavans, and anthocyanidins, are secondary plant metabolites. On the basis of their chemical structures, over 10 000 flavonoids have been characterized from various plants.1 Most flavonoids play important roles as flower and fruit pigments, UV-B protectants, signaling molecules between plants and microbes, and regulators of auxin transport.2,3 In recent years, flavonoids have become an expanding topic of interest for researchers, because they have many pharmacological activities, such as anticancer4 antioxidant,5 antiinflammatory,6 antimicrobial,7 and antiviral7,8 effects. Flavonoid-O-glycosides are the main derivatives of flavonoids, and some have many advantages compared to flavonoids in aspects such as solubility, stability, and bioactivity.9−12 For example, astragalin (kaempferol 3-O-glucoside), a type of flavonoid-O-glycoside, is used as a standard to assess the quality of Radix astragali and has exhibited a number of biological properties, including anti-inflammatory, antioxidant, and antiatopic dermatitis effects.13−16 Thus, far, astragalin has been extracted from Radix astragali or the leaves of Morus alba L.16,17 via solvent extraction, column chromatography, and crystallization. However, it is difficult to extract astragalin from plants because of its low concentration and complex composition.16−19 A possible pathway for preparing astragalin is through glycosylation of kaempferol at the 3C−O position. Chemical methods applied in the synthesis of flavonoid glycosides are limited due to side reactions, additional steps, environmental pollution, and low efficiency. As an alternative, bioconversion has been explored as a way to glycosylate flavonoids in vivo. © 2016 American Chemical Society

Some UDP-dependent glycosyltransferases (UGTs) genes have been cloned, expressed, and characterized,3,20,21and some flavonoid glycosides have already been produced in E. coli encoding different UDP-dependent glycosyltransferases (UGTs), which belong to glycosyltransferase family 1.11,22−24 Many UGT genes from different organisms have been reported, but most research has focused on quercetin as a substrate. Some UGT genes have been screened to produce different quercetin glycosides, including quercetin 3-O-glucoside, 3-Oxyloside, and 3,7-O-bisrhamnoside, or the novel quercetin 3-O(6-deoxytalose).22,23,25−27 To improve the production of flavonoid glycoside production, UDP-dependent glycosyltransferases should catalyze the transglycosylation reaction with high efficiency, and the recombinant strain must also efficiently provide the UDP-glycoside. There are two ways to enhance UDP-glucose synthesis in E. coli.11,28,29 One approach would be to overexpress two key enzymes (phosphoglucomutase and UDP-glucose pyrophosphorylase) in the UDP-glucose synthesis pathway in E. coli, and the other would be to reconstruct a novel UDP-glucose synthesis pathway in E. coli, which would include sucrose phosphorylase (Basp) from Bifidobacterium adolescentis and uridylyltransferase (UgpA) from Bif idobacterium bif idum. These enzymes can use sucrose as an inexpensive and sustainable carbon source to synthesize UDP-glucose.29 In this study, several UDP-dependent glycosyltransferases were screened for astragalin synthesis, and two approaches to Received: Revised: Accepted: Published: 7966

August 1, 2016 October 4, 2016 October 12, 2016 October 12, 2016 DOI: 10.1021/acs.jafc.6b03447 J. Agric. Food Chem. 2016, 64, 7966−7972

Article

Journal of Agricultural and Food Chemistry Table 1. Plasmids and Strains Used in This Study plasmids/strains Plasmids pGEX-2T pACYCDuet-1 pGEX-78D2 pGEX-73B3 pGEX-78D1 pGEX-GbUGT pACYCDuet-Pgm-GalU pACYCDuet-cscB-Basp-UgpA Strains BL21-78D2 BL21-73B3 BL21-78D1 BL21-Gb BL21-I BL21-II

descriptions

references

pBR322 ori; Ampr P15A ori; Cmr pGEX-2T carrying AtUGT78D2 from A. thaliana pGEX-2T carrying AtUGT73B3 from A. thaliana pGEX-2T carrying AtUGT78D1 from A. thaliana pGEX-2T carrying GbUGT from G. biloba pACYCDuet carrying pgm and galU from E. coli K12 pACYCDuet carrying cscB from E. coli W, Basp from B. adolescentis, and ugpA from B. bifidum

GE Novagen this study this study this study this study this study this study

E. E. E. E. E. E.

this this this this this this

coli coli coli coli coli coli

BL21(DE3) BL21(DE3) BL21(DE3) BL21(DE3) BL21(DE3) BL21(DE3)

carrying carrying carrying carrying carrying carrying

pGEX-78D2 pGEX-73B3 pGEX-78D1 pGEX-GbUGT pGEX-78D2 and pACYCDuet-Pgm-GalU pGEX-78D2 and pACYCDuet-cscB-Basp-UgpA

study study study study study study

Table 2. Primers Used for Gene Cloning in This Study gene

primer

sequence (5′-3′)

galU

galU-1 galU-2 pgm-1 pgm-2 cscB-11 cscB-12 cscB-2

CCCAGATCTCATGGCTGCCATTAATACGAA CCCCTCGAGTTACTTCTTAATGCCCATCT CCCCCATGGCAATCCACAATCGTGC CCCGGATCCTTACGCGTTTTTCAGAACTT CCCCCTGCATTAGGACCTATTGACAATTAAAGGCTAAAATGCTATAATTCCACAAATC AAATCAGAAG CCACAAATCAAATCAGAAGAGTATTGCTAATGGCACTGAATATTCCATT CCCCCTGCATTAGGCCGGTTGAGGGATATAGAGC

pgm cscB

phosphoglucomutase gene (pgm, GenBank no. NP_415214.1) was PCR-amplified from the E. coli K12 genomic DNA using the primers Pgm-1 and Pgm-2. The PCR products were digested with Nco I and BamH I and inserted into pACYCDuet-GalU at the Nco I and BamH I sites to produce pACYCDuet-Pgm-GalU. The sucrose permease gene (cscB, GenBank no. ADT76024.1) was amplified via two-step PCR. First, the fragment was PCR-amplified from the E. coli W genomic DNA using the primers cscB-12 and cscB2 (Table 2). Second, cscB was amplified with the fragment as the template using the primers cscB-11 and cscB-2. The PCR products were digested with EcoN I and inserted into pACYCDuet-1 at the EcoN I site to produce the pACYCDuet-cscB. The sucrose phosphorylase gene (Basp, GenBank no. WP_011742626.1) was synthesized to incorporate the E. coli codon. An Nco I site was added to the 5′ end of the genes, and an EcoR I site was added to the 3′ end of the gene. The synthesized gene (Basp) was subcloned into pACYCDuet-cscB at the Nco I and EcoR I sites to create pACYCDuet-cscB-Basp. The UTP-glucose-1-phosphate uridylyltransferase gene (ugpA, GenBank no. YP_003971086.1) was also synthesized to incorporate the E. coli codon. An Nde I site was added to the 5′ end of the gene, and a KpnI site was added to the 3′ end of the gene. The synthesized gene (ugpA) was subcloned into pACYCDuet-cscB-Basp at the Nde I and KpnI sites to produce pACYCDuet-cscB-Basp-ugpA. Purification and Characterization of AtUGT78D2. Strain BL21-78D2 was induced to express recombinant AtUGT78D2 by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM at an OD600 of approximately 1.0 and was then induced at 20 °C for 12 h. Then 200 mL of the strain BL21-78D2 was harvested by centrifugation at 5000g for 10 min at 4 °C, washed twice with distilled water, resuspended in 10 mL of pH 7.4 PBS buffer, and passed through a French pressure cell press three times with 1200 psi. The cell extracts were centrifuged (20 000g, 4 °C, 30 min). The resulting supernatants were loaded on to a glutathione-S-transferase (GST) affinity column (Sangon Biotech, China) and eluted with

enhancing UDP-glucose synthesis in E. coli were compared. The fermentation conditions for producing astragalin with a recombinant strain were determined.

■

MATERIALS AND METHODS

Plasmids, Bacterial Strains, And Chemical Reagents. All plasmids and strains used in this research are listed in Table 1. Escherichia coli JM109 and BL21 (DE3) strains were grown at 37 °C in Luria−Bertani medium (LB) and supplemented with antibiotics when required. The genomic DNA of E. coli W and E. coli K12 was purchased from DSMZ (www.dsmz.de). Kaempferol and astragalin were purchased from MUST Bio-Technology (Chengdu, China). DNA manipulation and Plasmid Constructions. A Qiagen Plasmid Kit and a Qiagen MinElute Gel Extraction Kit (Qiagen, Valencia, CA) were employed for the purification of the plasmids and PCR products. The DNA restriction and modification enzymes used were purchased from TaKaRa (Dalian, China). DNA transformation was performed via electroporation using Gene Pulser (Bio-Rad, Hercules, CA). AtUGT78D2 (GenBank no. NP_197207.1), AtUGT73B3 (GenBank no. NP_567953.1), AtUGT78D1 (GenBank no. NP_564357.1), and GbUGT (GenBank no. AEQ33588) were synthesized to incorporate the E. coli codon. For AtUGT78D2, AtUGT73B3, and AtUGT78D1, the BamH I site was added to the 5′ ends of the genes, and the EcoR I site was added to the 3′ ends of the genes. The synthesized genes (AtUGT78D2, AtUGT73B3, AtUGT78D1, and GbUGT) were digested with BamH I and EcoR I and subcloned into the expression vector pGEX-2T at the BamH I and EcoR I sites to create the pGEX-78D2, pGEX-73B3, pGEX-78D1, and pGEXGbUGT constructs, respectively (Table 1). The UDP-glucose pyrophosphorylase gene (galU, Genbank no. NP_415752.1) was PCR-amplified from the E. coli K12 genomic DNA using the primers GalU-1 and GalU-2. The PCR products were digested with BglII and Xho I and inserted into pACYCDuet-1 at the BglII and Xho I sites to produce pACYCDuet-GalU. The 7967

DOI: 10.1021/acs.jafc.6b03447 J. Agric. Food Chem. 2016, 64, 7966−7972

Article

Journal of Agricultural and Food Chemistry elution buffer (pH 7.4 PBS buffer containing 30 mM glutathione [GSH]). The resulting proteins were examined by SDS-PAGE. The reaction mixture, which contained 50 mM Tris-HCl buffer (pH 7.5), 2 mM kaempferol as a substrate, 2 mM UDP-glucose, and a certain amount of AtUGT78D2 in 100 μL, was incubated for 10 min at 35 °C. The reaction was stopped by adding 400 μL of methanol and was assayed via high-performance liquid chromatography (HPLC). One unit of enzyme activity was defined as the amount of enzyme necessary to liberate 1 μmol of astragalin of per minute under the assay conditions. The optimum pH for AtUGT78D2 activity was determined by incubation at 35 °C for 10 min in 50 mM Tris-HCl buffer from pH 7.0 to 9.5, 50 mM phosphate buffer from pH 7.0 to 8.0, bicine buffer from pH 8.0 to 8.5, or glycine buffer from pH 8.5 to 10.0. The optimum temperature for the enzyme activity was determined in a standard assay ranging from 20 °C to 50 °C in 50 mM Tris-HCl buffer, pH 7.5. The results are expressed as percentages of the activity obtained at either the optimum pH or the optimum temperature. The kinetic constant of AtUGT78D2 was determined by measuring the initial rates at various kaempferol concentrations under standard reaction conditions. Biotransformation of Kaempferol Using Recombinant Strains. To compare astragalin production by recombinant strains harboring different UGT genes, the plasmids pGEX-78D2, pGEX73B3, pGEX-78D1, and pGEX-GbUGT were transformed into E. coli BL21(DE3) cells to obtain the recombinant strains BL21-78D2, BL2178D2, BL21−73B3, BL21-78D1, and BL21-Gb, respectively. Recombinant strains were inoculated into 2 mL of fresh LB medium containing 50 μg/mL ampicillin and were grown at 37 °C until the absorbance at 600 nm reached 1.0. Kaempferol was dissolved at a concentration of 100 g/L in dimethyl sulfoxide (DMSO) as a stock solution. Kaempferol and IPTG were added to final concentrations of 1 g/L and 0.1 mM, respectively. The fermentation broths were incubated at 20 °C and 180 rpm for 24 h. Five volumes of methanol were directly added to the fermentation broths. The supernatant was harvested by centrifugation at 12 000g for 5 min and analyzed by high performance liquid chromatography (HPLC). To compare the effect of astragalin production with two ways to enhance UDP-glucose synthesis in E. coli, the plasmids pGEX-78D2/ pACYCDuet-Pgm-GalU and pGEX-78D2/pACYCDuet-cscB-BaspUgpA were cotransformed into E. coli BL21(DE3) cells to obtain the recombinant strains BL21-I and BL21-II, respectively. The recombinant strains were inoculated into 2 mL of fresh LB medium containing 50 μg/mL ampicillin and 40 μg/mL chloramphenicol and were grown at 37 °C until the absorbance at 600 nm reached 1.0. Then 1 g/L kaempferol, 0.1 mM IPTG, and 1% glucose were added to the recombinant strain BL-I, or 1 g/L kaempferol, 0.1 mM IPTG, and 1% sucrose were added to the recombinant strain BL-II. The fermentation broths were incubated at 20 °C and 180 rpm for 24 h. The samples were measured using a similar method as the one described above. Optimizing Bioconversion Conditions in Shake Flasks. The recombinant strain BL-II was used in shake flasks to optimize the bioconversion conditions. BL-II was inoculated into 20 mL of fresh LB medium in 100 mL shake flasks containing 50 μg/mL ampicillin and 40 μg/mL chloramphenicol and was grown at 37 °C. The effect of induction temperature (ranging from 20 °C to 50 °C) on astragalin production was determined. The effects of cell concentration (OD600 = 0.4, 0.8, 1.5, 2.5, or 3.0), IPTG concentration (0, 0.05, 0.1, 0.2, 0.4, or 0.8 mM) and sucrose concentration (0, 0.1, 0.5, 1, 2, or 4%) on astragalin production were also determined. The samples were measured using a similar method as the one described above. Astragalin Production in a Fermentor System. Fermentation conditions were determined in a 1-L glass autoclavable fermentor system (NBS, USA) with a working volume of 500 mL. The temperature, pH, and rotor speed were constantly maintained at 37 °C, 7.4, and 350 rpm, respectively. LB medium with the appropriate antibiotics was used as a culture broth. Dissolved oxygen (DO) was maintained above 50% during the experiment.

The strain BL-II was inoculated into 100 mL of fresh LB medium in 500 mL shake flasks containing 50 μg/mL ampicillin and 40 μg/mL chloramphenicol and was grown at 37 °C until the absorbance at 600 nm reached 2.0. Then, 1 g/L kaempferol, 0.05 mM IPTG, and 0.5% glucose were added to the culture broth. The fermentation broths were incubated at 37 °C and 180 rpm for 24 h. The broth culture was harvested by removing the cells and a tiny amount of insoluble kaempferol, which was applied to a HPD400 column macroporous resin (2.5 × 30 cm, Jianghua, China) equilibrated with the distilled water and was eluted with 80% ethanol. The ethanol was evaporated to dryness, and the product was analyzed by HPLC and liquid chromatography/mass spectrometry (LC/MS). HPLC and LC/MS Analysis. HPLC analysis of kaempferol and astragalin was performed using an HPLC 1200 system (Agilent, Santa Clara, CA) and a C18 (250 by 4.6 mm; i.d., 5 μm) column with methanol (A) and distilled water (B) at A/B ratios of 55:45 for 15 min. The flow rate was 0.8 mL/min, and detection was performed by monitoring absorbance at 368 nm. LC/MS for astragalin was analyzed in an LTQ Orbitrap XL LC/MS in negative mode and an ion trap analyzer. The ion spray was operated at 25 Arb N2/min, 3.5 kV, and 300 °C. Sucrose and fructose were analyzed in an HPLC 1200 and a Prevail Carbohydrate ES 5u column (250 mm × 4.6 mm; Grace, Columbia, MD) with acetonitrile (A) and distilled water (B) at A/B ratios of 75:25, 55:45, 75:25, 75:25, with run times of 0, 13, 13.5, and 16 min, respectively. The flow rate was 0.8 mL/min, and the products were detected using an evaporative light-scattering detector maintained with 2.0 L air/min at 100 °C. Structural Identification. The structure of the product from recombinant strain BL-II was determined using proton and carbon nuclear magnetic resonance (1H NMR, 13C NMR) (Bruker AVANCE IIII 400), and DMSO-d6 was used as the solvent. 1H NMR (DMSO, 400 MHz) δ: ppm 12.62 (1H, s), 10.87 (1H, s), 10.19 (1H, s), 8.04 (d, J = 8 Hz, 2H), 6.89 (d, J = 4 Hz, 2H), 6.44 (d, J = 4 Hz, 1H), 6.21 (1H, s), 5.47 (d, J = 4 Hz, 1H), 5.36 (d, J = 4 Hz, 1H), 5.07 (d, J = 4 Hz, 1H), 4.96 (d, J = 4 Hz, 1H), 4.27 (t, J = 4 Hz, 1H), 3.57 (q, J = 4 Hz, 1H), 3.16−3.22 (m, 3H), 3.08 (d, J = 4 Hz, 2H). 13C NMR (DMSO, 100 MHz) δ: 177.94, 164.67, 161.70, 160.42, 156.86, 156.71, 133.66, 131.36, 121.38, 115.57, 104.46, 101.33, 99.17, 94.13, 77.97, 76.89, 74.69, 70.37, 61.31, 49.07. Statistical Analysis. Data are expressed as mean ± SD. Student’s t test was used for statistical analyses of the data. All statistical analyses were conducted using SPSS 10.0 statistical software (SPSS, Chicago, IL). Cases in which P values of 0.01) between b and d, a and c. There was a significant difference (P < 0.01) between h and f, h and g, h and e.

Figure 1. Comparison of astragalin production levels for different strains. Data are the mean ± SEM of three independent experiments. There was a significant difference (P < 0.01) between b and a, b and c, b and d.

Figure 2. SDS-PAGE analysis of recombinant AtUGT78D2 in the recombinant strain BL21-78D2. Lane M: protein marker, lane 1, 3, 5: total protein from the recombinant strain BL21-78D2; lane 2, 4, 6: soluble protein from the recombinant strain BL21-78D2; lane 7: purified recombinant AtUGT78D2. Figure 5. Optimization of bioconversion conditions for astragalin production by the recombinant strain BL21-II. (A) The effects of bioconversion temperature on astragalin production. (B) The effects of IPTG concentration on astragalin production. (C) The effects of sucrose concentration on astragalin production. (D) The effects of cell concentration on astragalin production. Data are the mean ± SEM of three independent experiments. Astragalin production has a significant difference (P < 0.01) between at 37 °C and at 20 °C, 30 °C, or 45 °C, between 0.05 mM IPTG and 0 mM IPTG, between 0.5% sucrose and 0%, 0.1% or 4% sucrose, between OD600 = 3 or OD600 = 2.5 and OD600 = 0.4, 0.8, or 1.5. Astragalin production has no significant difference (P > 0.01) between at 37 °C and at 40 °C, between 0.05 mM IPTG and 0.1, 0.2, 0.4, or 0.8 mM IPTG, between 0.5% sucrose and 1% or 2% sucrose, between OD600 = 3 and OD600 = 2.5.

Figure 3. Effects of pH and temperature on the activity the recombinant AtUGT78D2. (A) Effect of pH on AtUGT78D2 activity. (B) Effect of temperature on AtUGT78D2 activity.

mM IPTG decreased the inclusion body formation (Figure 2). It is a common problem for recombinant protein aggregates to form inclusion bodies when some genes from thermophilic bacteria and fungi are overexpressed in E. coli.30,31 The recombinant AtUGT78D2 in the cell-free extract was purified to gel electrohomogeneity after a GST affinity purification. The final preparation produced a single band on an SDS-PAGE gel, and the molecular mass of the enzyme was estimated to be 77 kDa (Figure 2). The biochemical properties of AtUGT78D2 were investigated using purified recombinant AtUGT78D2. The optimal pH of AtUGT78D2 was determined to be 7.5 with Tris-HCl buffer (Figure 3A), while the maximum activity of recombinant AtUGT78D2 using glycine buffer was about 2 times higher

astragalin production was detected in the recombinant strain BL21-78D2:285 mg/L with a corresponding molar conversion of 36.4% (Figure 1). The production level was three times higher than those in strains BL21-73B3. It has been reported that the recombinant strain harboring 73B3 can produce more quercetin-3-O-glucoside than the recombinant strain harboring 78D2 for quercetin as a substrate.25 These data indicate that recombinant strain BL21-78D2 is superior for astragalin production. Purification and Characterization of AtUGT78D2. The recombinant AtUGT78D2 was overexpressed by adding 0.1 mM IPTG at 37 °C or 30 °C for approximately 6 h. However, AtUGT78D2 overexpression resulted in the production of a large amount of inclusion bodies; expression at 20 °C with 0.1 7969

DOI: 10.1021/acs.jafc.6b03447 J. Agric. Food Chem. 2016, 64, 7966−7972

Article

Journal of Agricultural and Food Chemistry

followed Michaelis−Menten kinetics. The apparent Km and Vmax values for kaempferol were 0.3 mM and 27.6 U/mg, respectively, and the Kcat/Km value was 118 mM−1 s−1. These data showed that recombinant AtUGT78D2 could be a potent candidate for astragalin production. Engineering UDP-Glucose Synthesis Pathway for Astragalin Production. UGTs are group-transfer enzymes that catalyze the transfer of a sugar molecule from its activated form to an acceptor. The most commonly used sugar donors are sugar nucleotides such as UDP-glucose.32 To increase astragalin production, it is necessary to increase the supply of UDP-glucose in E. coli. In this paper, the supply of UDPglucose in E. coli occurred via two methods.11,28 The first method was to overexpress phosphoglucomutase and UDPglucose pyrophosphorylase from E. coli by pACYCDuet-1. The second method was to introduce sucrose permease (cscB) from E. coli W, sucrose phosphorylase (Basp) from B. adolescentis, and uridylyltransferase (ugpA) from B. bif idum into E. coli to reconstruct a novel UDP-glucose synthesis pathway, which can use sucrose as a carbon source to synthesize UDP-glucose. Because sucrose permease is a membrane-binding protein and overexpression of cscB can affect membrane functions, cscB transcription was controlled by the Braatsch 10 promoter, which was a moderate promoter.33 To compare the effect of the supply of UDP-glucose through different methods, astragalin production in the recombinant strains BL21-78D2, BL21-I, and BL21-II was determined. Although it has been reported that the supply of UDP-glucose in E. coli can be enhanced by overexpressing phosphoglucomutase and UDP-glucose phrophosphorylase, astragalin production levels in the strain BL21-I were 378 and 225 mg/ L with LB medium containing 2% glucose or no glucose, respectively (Figure 4A). There were no significant differences in astragalin production in the BL21-78D2 strain. In contrast, astragalin production in BL21-II was 570 mg/L with LB medium containing 1% sucrose, which was 2 times higher than the production in BL21-78D2 and was 2.7 times higher than the production in BL21-II with LB medium (Figure 4B). The results showed that the second method was more effective in the supply of UDP-glucose. By introducing a sucrose permease, a sucrose phosphorylase, and a uridylyltransferase, E. coli BL21(DE3) has the capacity to assimilate and split sucrose into fructose and UDP-glucose. It is a novel synthesis pathway for UDP-glucose and is different from the original pathway in E. coli. Optimizing the Bioconversion Conditions in Shake Flasks. Astragalin production was optimized with the BL21-II strain. To simplify the process, LB medium containing sucrose was used as the growth and induction medium. Lowtemperature induction contributed to reducing inclusion body formation for some proteins from plants.31 For example, the optimal induction temperature for the BL21-78D2 strain was 20 °C. However, it is interesting that the optimal induction temperature for the BL21-II strain was 37 °C (Figure 5A). At the induction temperature, astragalin production in strain BL-II was 1306 mg/L, which was two times higher than the production at 20 °C. Further research showed that the strain BL-II did not increase the amount of soluble AtUGT78D2 under the induction at 37 °C (data not shown), compared to strain BL21-78D2, which was induced at 37 °C. Induction at 37 °C resulted in the production of large amount of inclusion bodies, and the soluble recombinant AtUGT78D2 was estimated to be about 5% of inclusion bodies by a

Figure 6. Time course for astragalin production under optimal conditions. Astragalin (filled diamonds); sucrose (filled squares); fructose (filled triangles). Data are the mean ± SEM of three independent experiments. Astragalin production at 12 h, 8 h, 4 h, 2 h, or 0 h has a significant difference (P < 0.01). Astragalin production between at 12 and 24 h has no significant difference (P > 0.01).

Figure 7. Astragalin production of in a 1-L bioreactor by fed-batch fermentation. (A) The concentration of astragalin and kaempferol. (B) The concentration of sucrose and fructose. Astragalin (filled diamonds); kaempferol (empty diamonds); sucrose (filled triangles); fructose (empty triangles). Data are the mean ± SEM of three independent experiments. Astragalin production among at 24 h, 16 h, 12 h, 8 h, 6 h, 4 h, 2 h, or 0 h has a significant difference (P < 0.01). Astragalin production between 24 and 28 h has no significant difference (P > 0.01). The concentration of fructose between at 16 and 8 h, 6 h, 4 h, 2 h, or 0 h has a significant difference (P < 0.01).

than that using Tris-HCl buffer (Figure S1, Supporting Information). The result was the same as reported in other literature.21 The optimal temperature of the enzyme was 35 °C, and the AtUGT78D2 activity at this temperature was higher than 60% of the maximum activity in the temperature range from 30 °C to 50 °C (Figure 3B). The dependence of the rate of the enzymatic reaction on the substrate concentration 7970

DOI: 10.1021/acs.jafc.6b03447 J. Agric. Food Chem. 2016, 64, 7966−7972

Article

Journal of Agricultural and Food Chemistry

Figure 7A,B. The rate of sucrose metabolism was high during the entire bioconversion period, indicating that sucrose permease could transfer sucrose effectively. However, the BL21-II strain cannot sustain the high rate of fructose metabolism, which led to fructose accumulation after 6 h; the fructose concentration reached 4.5 g/L at 16 h (Figure 7B). At the beginning of bioconversion, the specific productivity was 203 mg/L/h after 6 h of incubation. With the increase of astragalin concentration and the aging of cells, the specific productivity gradually decreased. The specific productivities was 165 and 116 mg/L/h, respectively, in the first and second periods in the feed. After 24 h, 3600 mg/L of astragalin was produced with a corresponding molar conversion of 91.9% (Figure 7A). Among all relevant research flavonoid glycosylation, this study produced the highest yield of flavonoid-Oglycosides reported to date.22,24

densitometric scan of SDS-PAGE (Figure 3). These results indicated that AtUGT78D2 expression was not the key factor in astragalin production. Kaempferol transportation and the UDP-glucose supply could be the rate-limiting steps of astragalin biosynthesis. Strain BL21-II could efficiently transport kaempferol and provide UDP-glucose for the glycosylation reaction at 37 °C. Sucrose provided fructose to be used as the carbon source and provided UDP-glucose to be used as sugar donors. Astragalin production was remarkably improved by adding sucrose. Maximal astragalin production reached 1470 mg/L for LB medium containing 0.5% sucrose after 24 h (Figure 5C). Sucrose was split into UDP-glucose and fructose, and acetate and lactic acid were then produced through fructose metabolism, which could be the main reason why the high concentration of sucrose was not conducive to astragalin production. Cell and IPTG concentrations can affect relationships between the strain growth and expression of recombinant proteins. In this study, the optimal cell and IPTG concentrations were OD 600 = 2.5−3.0 and 0.05 mM, respectively (Figure 5B,D). The astragalin production at OD600 = 2.5 was 1708 mg/L, which was 1.35 times higher than its production at OD600 = 0.8. These results indicated that the biomass was crucial to astragalin biosynthesis, and induction at the end of the log phase was better compared to early log phase because flavonoids could inhibit E. coli growth.34 Under the optimal conditions, the time-courses for sucrose consumption and astragalin production are given in Figure 6. After 12 h of incubation and when 1600 mg/L kaempferol was added to the medium, the astragalin production was 1666 mg/ L and the specific productivity was 134 mg/L/h. The sucrose was fully consumed after 4 h, and the extracellular fructose concentration was increased to 2.6 g/L after 4 h. Subsequently, the fructose concentration and culture pH were decreased due to the metabolism. These results indicated that astragalin production could be increased by sucrose feeding and controlling the pH. Structural Elucidation of Astragalin. AtUGT78D2 has been proved to glycosylate flavonoids at the 3C−O position.25 The molecular weight and structure of the bioconversion product by BL-II were determined through LC/MS and NMR. A comparison of the m/z of molecular ions [M − H]− of the bioconversion product (447.0926) showed that differences corresponded to a D-glucose residue of kaempferol (Figures S2 and S3, Supporting Information). Furthermore, the 1H NMR and 13C NMR spectra were analyzed and compared to those of reference compounds18,24 (Figure S4, Supporting Information). These results confirmed that the bioconversion product was astragalin. Astragalin Production in a Fermentor System. To improve astragalin production, a 1-L fermentor was used to produce astragalin, because some factors involved in the growth of E. coli such as pH and dissolved oxygen could not be controlled in the flask. On the basis of the conditions for astragalin fermentation in flasks, 1000 mg/L kaempferol, 0.05 mM IPTG, and 0.5% sucrose were added to the culture at an induction temperature of 37 °C when the OD600 of the BL21-II strain reached 2.5. To improve astragalin production, 750 mg/L kaempferol and 0.5% sucrose were added at 6 and 12 h because the kaempferol solubility was low, and a high concentration might inhibit cell growth. A kinetic analysis of sucrose consumption and astragalin production over time is shown in

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b03447. Comparison of amino acid sequence homologies of different UGT genes. pH profiles. Spectral data for astragalin and kaempferol (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +86-025-85427962. E-mail: [email protected]. Author Contributions #

These authors contributed equally to this work

Funding

This work was supported by the Special Fund for Forest Scientific Research in the Public Welfare (grant no. 201404601), the Natural Science Foundation of the Jiangsu Province of China (grant no. BK20131423), the 11th Six Talents Peak Project of Jiangsu Province (grant no. 2014-JY011), the Qing Lan Project, and the A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Nijveldt, R. J.; van Nood, E.; van Hoorn, D. E.; Boelens, P. G.; van Norren, K.; van Leeuwen, P. A. Flavonoids: a review of probable mechanisms of action and potential applications. Am. J. Clin. Nutr. 2001, 74, 418−25. (2) Dixon, R. A.; Paiva, N. L. Stress-Induced Phenylpropanoid Metabolism. Plant Cell 1995, 7, 1085−1097. (3) Yonekura-Sakakibara, K.; Tohge, T.; Niida, R.; Saito, K. Identification of a flavonol 7-O-rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by transcriptome coexpression analysis and reverse genetics. J. Biol. Chem. 2007, 282, 14932−41. (4) Ren, W.; Qiao, Z.; Wang, H.; Zhu, L.; Zhang, L. Flavonoids: Promising anticancer agents. Med. Res. Rev. 2003, 23, 519−34. (5) Prochazkova, D.; Bousova, I.; Wilhelmova, N. Antioxidant and prooxidant properties of flavonoids. Fitoterapia 2011, 82, 513−23. (6) Pan, M. H.; Lai, C. S.; Ho, C. T. Anti-inflammatory activity of natural dietary flavonoids. Food Funct. 2010, 1, 15−31. (7) Orhan, D. D.; Ozcelik, B.; Ozgen, S.; Ergun, F. Antibacterial, antifungal, and antiviral activities of some flavonoids. Microbiol. Res. 2010, 165, 496−504.

7971

DOI: 10.1021/acs.jafc.6b03447 J. Agric. Food Chem. 2016, 64, 7966−7972

Article

Journal of Agricultural and Food Chemistry (8) Kang, S. Y.; Kang, J. Y.; Oh, M. J. Antiviral activities of flavonoids isolated from the bark of Rhus verniciflua stokes against fish pathogenic viruses In Vitro. J. Microbiol. 2012, 50, 293−300. (9) Kren, V.; Martinkova, L. Glycosides in medicine: ″The role of glycosidic residue in biological activity″. Curr. Med. Chem. 2001, 8, 1303−28. (10) Bowles, D.; Isayenkova, J.; Lim, E. K.; Poppenberger, B. Glycosyltransferases: Managers of small molecules. Curr. Opin. Plant Biol. 2005, 8, 254−63. (11) De Bruyn, F.; Van Brempt, M.; Maertens, J.; Van Bellegem, W.; Duchi, D.; De Mey, M. Metabolic engineering of Escherichia coli into a versatile glycosylation platform: production of bio-active quercetin glycosides. Microb. Cell Fact. 2015, 14, 138. (12) Matsukawa, N.; Matsumoto, M.; Chiji, H.; Hara, H. Oligosaccharide promotes bioavailability of a water-soluble flavonoid glycoside, alpha G-rutin, in rats. J. Agric. Food Chem. 2009, 57, 1498− 505. (13) Ke, M.; Hu, X. Q.; Ouyang, J.; Dai, B.; Xu, Y. The effect of astragalin on the VEGF production of cultured Muller cells under high glucose conditions. Biomed Mater. Eng. 2012, 22, 113−9. (14) Kim, M. S.; Kim, S. H. Inhibitory effect of astragalin on expression of lipopolysaccharide-induced inflammatory mediators through NF-kappaB in macrophages. Arch. Pharmacal Res. 2011, 34, 2101−7. (15) Li, F.; Wang, W.; Cao, Y.; Liang, D.; Zhang, W.; Zhang, Z.; Jiang, H.; Guo, M.; Zhang, N. Inhibitory effects of astragalin on lipopolysaccharide-induced inflammatory response in mouse mammary epithelial cells. J. Surg. Res. 2014, 192, 573−81. (16) Kwon, H. J.; Park, Y. D. Determination of astragalin and astragaloside content in Radix Astragali using high-performance liquid chromatography coupled with pulsed amperometric detection. J. Chromatogr A 2012, 1232, 212−7. (17) Choi, J.; Kang, H. J.; Kim, S. Z.; Kwon, T. O.; Jeong, S. I.; Jang, S. I. Antioxidant effect of astragalin isolated from the leaves of Morus alba L. against free radical-induced oxidative hemolysis of human red blood cells. Arch. Pharmacal Res. 2013, 36, 912−7. (18) Wei, Y.; Xie, Q.; Fisher, D.; Sutherland, I. A. Separation of patuletin-3-O-glucoside, astragalin, quercetin, kaempferol and isorhamnetin from Flaveria bidentis (L.) Kuntze by elution-pump-out high-performance counter-current chromatography. J. Chromatogr A 2011, 1218, 6206−11. (19) Xue, Y. L.; Miyakawa, T.; Hayashi, Y.; Okamoto, K.; Hu, F.; Mitani, N.; Furihata, K.; Sawano, Y.; Tanokura, M. Isolation and tyrosinase inhibitory effects of polyphenols from the leaves of persimmon, Diospyros kaki. J. Agric. Food Chem. 2011, 59, 6011−7. (20) Paquette, S.; Moller, B. L.; Bak, S. On the origin of family 1 plant glycosyltransferases. Phytochemistry 2003, 62, 399−413. (21) Devaiah, S. P.; Owens, D. K.; Sibhatu, M. B.; Sarkar, T. R.; Strong, C. L.; Mallampalli, V. K.; Asiago, J.; Cooke, J.; Kiser, S.; Lin, Z.; Wamucho, A.; Hayford, D.; Williams, B. E.; Loftis, P.; Berhow, M.; Pike, L. M.; McIntosh, C. A. Identification, Recombinant Expression, and Biochemical Analysis of Putative Secondary Product Glucosyltransferases from Citrus paradisi. J. Agric. Food Chem. 2016, 64, 1957− 69. (22) Kim, B. G.; Kim, H. J.; Ahn, J. H. Production of bioactive flavonol rhamnosides by expression of plant genes in Escherichia coli. J. Agric. Food Chem. 2012, 60, 11143−8. (23) Kim, H. J.; Kim, B. G.; Ahn, J. H. Regioselective synthesis of flavonoid bisglycosides using Escherichia coli harboring two glycosyltransferases. Appl. Microbiol. Biotechnol. 2013, 97, 5275−82. (24) Malla, S.; Pandey, R. P.; Kim, B. G.; Sohng, J. K. Regiospecific modifications of naringenin for astragalin production in Escherichia coli. Biotechnol. Bioeng. 2013, 110, 2525−35. (25) Lim, E. K.; Ashford, D. A.; Hou, B.; Jackson, R. G.; Bowles, D. J. Arabidopsis glycosyltransferases as biocatalysts in fermentation for regioselective synthesis of diverse quercetin glucosides. Biotechnol. Bioeng. 2004, 87, 623−31.

(26) Pandey, R. P.; Malla, S.; Simkhada, D.; Kim, B. G.; Sohng, J. K. Production of 3-O-xylosyl quercetin in Escherichia coli. Appl. Microbiol. Biotechnol. 2013, 97, 1889−901. (27) Yoon, J. A.; Kim, B. G.; Lee, W. J.; Lim, Y.; Chong, Y.; Ahn, J. H. Production of a novel quercetin glycoside through metabolic engineering of Escherichia coli. Appl. Environ. Microbiol. 2012, 78, 4256−62. (28) Mao, Z.; Shin, H. D.; Chen, R. R. Engineering the E. coli UDPglucose synthesis pathway for oligosaccharide synthesis. Biotechnol. Prog. 2006, 22, 369−74. (29) De Bruyn, F.; De Paepe, B.; Maertens, J.; Beauprez, J.; De Cocker, P.; Mincke, S.; Stevens, C.; De Mey, M. Development of an in vivo glucosylation platform by coupling production to growth: Production of phenolic glucosides by a glycosyltransferase of Vitis vinifera. Biotechnol. Bioeng. 2015, 112, 1594−603. (30) Sevastsyanovich, Y. R.; Alfasi, S. N.; Cole, J. A. Sense and nonsense from a systems biology approach to microbial recombinant protein production. Biotechnol. Appl. Biochem. 2010, 55, 9−28. (31) Ray, M.; Mishra, P.; Das, P.; Sabat, S. C. Expression and purification of soluble bio-active rice plant catalase-A from recombinant Escherichia coli. J. Biotechnol. 2012, 157, 12−9. (32) Osmani, S. A.; Bak, S.; Moller, B. L. Substrate specificity of plant UDP-dependent glycosyltransferases predicted from crystal structures and homology modeling. Phytochemistry 2009, 70, 325−47. (33) Braatsch, S.; Helmark, S.; Kranz, H.; Koebmann, B.; Jensen, P. R. Escherichia coli strains with promoter libraries constructed by Red/ ET recombination pave the way for transcriptional fine-tuning. BioTechniques 2008, 45, 335−7. (34) Plaper, A.; Golob, M.; Hafner, I.; Oblak, M.; Solmajer, T.; Jerala, R. Characterization of quercetin binding site on DNA gyrase. Biochem. Biophys. Res. Commun. 2003, 306, 530−6.

7972

DOI: 10.1021/acs.jafc.6b03447 J. Agric. Food Chem. 2016, 64, 7966−7972