Methylated Cytosine Maintains G-Quadruplex Structures during

Subscriber access provided by NEW YORK UNIV

From the Bench

Methylated cytosine maintains G-quadruplex structures during PCR and contributes towards allelic drop-out Aaron J. Stevens, and Martin Alexander Kennedy Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00480 • Publication Date (Web): 22 Jun 2017 Downloaded from http://pubs.acs.org on July 4, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

table of contents image 85x47mm (300 x 300 DPI)

ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Sequence of MEST promoter region indicating key features. MEST promoter sequence (hg19 coordinates chr7:130131340-130132187). Features indicated are the four G4 sequences (grey shading, with the extended G4MEST1L region indicated by a dashed underline), the three SNPs (arrow-heads with rs IDs as indicated), CpG dinucleotides within the G4 regions (bold), the transcription start site (TSS, horizontal arrow), and the fluorescently labelled primers used for FOPE (green represents the HEX label and blue represents the FAM label). Nucleotides are numbered at the start of each row and these correspond to nucleotide numbering used in subsequent Figures. Image reused from Stevens et al. (2017) 27.

85x90mm (300 x 300 DPI)


Page 2 of 18

Page 3 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. FOPE performed on the MEST promoter region A. FOPE performed using five cycles of PCR amplification on a 551 bp template that encompasses all G4 forming motifs. Peaks above the line represent FOPE performed in 1 x PCR buffer (50 mM KCl, 1.5 mM MgCl2) and peaks below the line represent FOPE performed in the low KCl buffer. B. FOPE performed on a 551 bp template using 7-deaza-ATP at a 3:1 ratio with dATP. The col-oured arrows represent the direction of primer extension. Blue bars represent extension products originating from the reverse (FAM labelled) primers and green bars represent extension products originating from the forward (HEX labelled) primers. Relative fluores-cence units are illustrated on the Y-axis and basepairs (numbers) are represented on the xaxis, and correspond to the sequence pre-sented in Figure 1.

160x129mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. PCR amplification of heterozygous DNA sample Sanger sequencing results from PCR amplification of hetero-zygous DNA sample. Primers Pf1 and Pr3c (nonfluorescent primers equivalent to Pf1HEX and Pr3cFAM in Fig.1) were used for PCR amplification and Sanger sequencing, black box-es denote the position of SNP rs73724326. A. Amplification using low potassium buffer 9. B. Amplification using 7-deaza-ATP in the PCR buffer.

85x39mm (300 x 300 DPI)


Page 4 of 18

Page 5 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4. Polymerase arrest by individual G4 motifs Previously characterised G4 forming motifs were assessed using FOPE performed on three individual short templates (results from which are collated in this figure). Blue bars represent extension products originating from the reverse (FAM labelled) primers and green bars represent extension products originating from the forward (HEX labelled) primers. Basepairs (numbers) are represented on the x-axis and correspond to the sequence presented in Figure 1, which also illustrates the primer combinations used to generate the three templates. Relative fluorescence units are illustrated on the y-axis and this is proportional to the amount of primer incorporated into the extension product at each peak.

160x90mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. FOPE performed across 35 cycles of PCR on methylated and non-methylated templates FOPE performed on a 551 bp template which encompasses all G4 forming motifs of the MEST promoter region. Extension was performed using primers Pf1HEX and Pr3cFAM. Blue bars represent extension products originating from the reverse (FAM labelled) primer and green bars represent extension products originating from the forward (HEX labelled) primer. Assays performed on methylated template DNA are presented on the top half of each graph and assays performed on non-methylated template DNA are presented on the bottom half of each graph. Only key cycles showing significant changes are presented A. Cycle 8, B. Cycle 18, C. Cycle 25, D. Cycle 35

160x90mm (300 x 300 DPI)


Page 6 of 18

Page 7 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6. Sanger sequencing of ADO model amplicons Genotyping results at SNP rs73724326 (black box) on PCR products with artificially delayed amplification of one allele. The MEST GCG haplotype template was added to a PCR (con-taining the ATA haplotype) at A: prior to cycle 1; B: after cycle 1; C: after cycle 2; D: after cycle 3; E: after cycle 4. Amplifica-tion was achieved using primers Pf1 and Pr3 on artificial PCR product (Pf1/Pr3c).

85x90mm (300 x 300 DPI)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 18

Methylated cytosine maintains G-quadruplex structures during PCR and contributes towards allelic drop-out. Aaron J. Stevens1*, Martin A. Kennedy1 1

Department of Pathology, University of Otago, Christchurch, New Zealand.

KEYWORDS (G-quadruplex, polymerase arrest, allelic drop-out, PCR, cytosine methylation”) Supplementary File one ABSTRACT: The promoter of human imprinted genes, like MEST are often differentially methylated with respect to the parent of origin and may contain several non B-DNA motifs that are capable of forming G-quadruplexes. These factors can contribute towards a consistent allelic drop-out (ADO) of the maternally methylated DNA during polymerase chain reaction (PCR) analysis of such gene regions. Here, we directly investigate the cause of allelic drop-out by applying fluorescent techniques to visualize polymerase amplification and arrest during PCR of differentially methylated DNA templates. We demonstrate that polymerase arrest corresponds to previously characterized G-quadruplex forming motifs at the MEST promoter region and occurs at equivalent sites on both methylated and non-methylated DNA templates. However, during PCR, polymerase arrest is observable on the methylated template for several cycles longer than on the nonmethylated template, and this results in an amplification lag and lower yield of full length amplicons. We demonstrate that this delay in amplification is sufficient to cause complete ADO during PCR, providing a mechanistic basis for the previously observed genotyping error at this locus.

During polymerase chain reaction (PCR) amplification of DNA, allelic drop-out (ADO) can occur when one allele fails to amplify, and is therefore not detected. This can be caused by a variety of mechanisms and the misrepresentation of genomic information can profoundly influence research procedures and molecular diagnostics 1-6. DNA structures such as G-quadruplexes (G4) can sterically hinder Taq DNA polymerase 7, 8, and this characteristic may cause ADO through PCR amplification bias 3, 4, 9, 10. G4 are non B-DNA structures that can form in genomic DNA at repetitive purine rich DNA motifs through Hoogsteen bonds 7, 11. Four guanine nucleotides can associate to form a square planar arrangement called a G-tetrad, and when a DNA motif contains the correct sequence, multiple G-tetrads can stack above each other to form a G4. The structural formation and conformation of the G4 is then modulated by the integration of a cation (e.g potassium), into the tertiary structure 12-14, making PCR buffer an optimal environment for G4 formation. There is extensive variation in how DNA strands can fold, and this results in a large potential for structural diversity 15-17. In addition to G4, both i-motif 4, 18-20 and triplex structures 11, 21, 22 can form at similar DNA regions. DNA triplexes can be broadly categorized as a polypurine repeat with a high guanine content and a small (0–3) fraction of pyrimidine nucleotides. Triplexes consist of two DNA strands bound by Watson-Crick basepairing, where the adenine and guanine nucleotides can bind a third strand

through Hoogsteen bonds 22, 23. In dsDNA, if a motif on one strand comprises a polypurine mirror repeat, the DNA can fold around the central point of symmetry to donate the third strand. This forms a hairpin like structure (H-DNA) which has been shown to arrest DNA polymerase during extension 24, 25. G4 sequences may contain polypurine mirror repeats and therefore, distinguishing G4 from triplex structure can be technically difficult. The i-Motif structure consist of four cytosine rich DNA strands, bound in antiparallel orientation by cytosine-cytosine+ base pairs 26. Consequently, formation of i-Motifs are often observed at, but constrained to the DNA sequence complementary to that of G4 forming motifs. We initially reported complete ADO of the maternal allele during PCR amplification of the differentially methylated human MEST promoter region 9. ADO was directed by the combination of both parent-of-origin methylation and G-quadruplex (G4) formation, and was alleviated by performing PCR amplification in a KCl free buffer. We subsequently demonstrated that this parentof-origin ADO is not restricted to MEST and can occur at other imprinted loci 10, however, we focus our current analysis on the well characterized MEST promoter region 27. Previously the conformations and stability of methylated and non-methylated G4 structures at the MEST promoter have been characterized by CD, native polyacrylamide gel electrophoresis, DMS footprinting and single strand specific nuclease footprinting assays 27,28. The MEST promoter region contains three SNPs in complete linkage disequilibrium, and at least four G4 motifs (G4MESTA, G4MEST1L, G4MEST2 and G4MEST3), three of which reside on a single strand (Figure 1) 9, 27. Under standard PCR conditions inclusion of any of these G4 is sufficient to cause robust ADO and the specific topological conformation of the G4 does not appear to be a strong contributing factor 10, 27. Although G4 were the predominant non B-DNA structure to form in ssDNA and dsDNA, H-DNA formation also appeared possible at G4MEST2 and G4MEST3 27. Therefore, the potential contribution of H-DNA towards ADO is also addressed in this current investigation. Previously, CD spectroscopy demonstrated that cytosine methylation paradoxically decreased the stability of MEST G4 structures in PCR buffer 9. This finding was contrary to those of lin et al. 29, and may indicate that the influence of methylation on G4 stability is dependent on the DNA sequence being investigated. Consistent with the observations previously published by Hardin et al. 30, we observed that the presence of at least one methylated cytosine was sufficient to promote rapid G4 re-association after thermal denaturation, and furthermore, this effect was enhanced by MgCl2 27.


Page 9 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

In this analysis we aimed to test how non B-DNA and cytosine methylation interact to cause ADO during PCR. To achieve this, we used fluorescently labelled DNA to monitor the length and quantity of forward and reverse strands amplified during each cycle of PCR, for both methylated and non-methylated DNA templates. The sites of arrest were then mapped against the template DNA sequence to determine if arrest corresponded to either methylated CpGs, G4 motifs, or triplex motifs. We then applied these findings to a model of ADO using standard PCR, to test whether the observed amplification bias is sufficient to explain ADO. Based upon the combination of these findings and prior investigation 9, 10, 27, we provide a model that explains how G4 structures cause ADO of methylated DNA.

Figure 1. Sequence of MEST promoter region indicating key features. MEST promoter sequence (hg19 coordinates chr7:130131340130132187). Features indicated are the four G4 sequences (grey shading, with the extended G4MEST1L region indicated by a dashed underline), the three SNPs (arrowheads with rs IDs as indicated), CpG dinucleotides within the G4 regions (bold), the transcription start site (TSS, horizontal arrow), and the fluorescently labelled primers used for FOPE (green represents the HEX label and blue represents the FAM label). Nucleotides are numbered at the start of each row and these correspond to nucleotide numbering used in subsequent Figures. Image reused from Stevens et al. (2017) 27. EXPERIMENTAL PROCEDURES PCR amplification was carried out in a total reaction volume of 25 µl containing 1 x PCR reaction buffer with 1.5mM MgCl2 (Roche Diagnostics), 0.5µM of each primer (IDT, Singapore), 0.2 µM each deoxynucleotide triphosphate (dNTP), 1 M betaine, 0.5U Fisher Taq-ti polymerase (Fisher Biotec, Wembley WA, Australia) and ~10 ng of plasmid DNA. Standard thermal cycling conditions consisted of an initial denaturation step of 95oC for 2 min, followed by 35 cycles of 95oC for 30 sec, 63oC annealing for 15 sec and 72oC for 45 sec with a final extension of 72oC for 5 min. The identity of each amplicon was verified using Sanger sequencing as previously described 9.

In vivo, the human MEST promoter is differentially methylated with respect to the parent of origin. In order to mimic the methylation status of genomic DNA, in vitro methylation was performed using M.SssI methyltransferase (New England Biolabs Inc, Ipswich, MA, USA), which methylates every cytosine of a CpG dinucleotide. Successful in vitro methylation by M.SssI was assessed by incubating each methylated sample with the restriction enzymes MspI and its methylation-sensitive isoschizomer HpaII, and visualized by gel electrophoresis (data not shown). All enzymatic treatments were performed according to the manufacturer’s protocol. Analyses were then separately performed on methylated and non-methylated templates, to determine the contribution of methylation to polymerase arrest. Fluorescent oligonucleotide primer extension (FOPE) was performed as previously described in Stevens et al.28. This technique involves the extension of fluorescently labelled oligonucleotide primers along a DNA template, where the nascent fluorescent strand is then sized using automated capillary electrophoresis. By comparing the length of the nascent strand with the sequence of the template, the production of full length templates or arrest products can be determined. Where a short terminated product is produced, this can be compared with the corresponding base sequence to determine the site of early polymerase arrest. This assay was performed using linearized wild-type MEST plasmid DNA templates, which contained 636 bp of the MEST promoter region, including all four G4 forming motifs. These were the same templates previously used to demonstrate G4 directed ADO of methylated DNA during PCR 9. FOPE assays were performed in a total reaction volume of 30 µl containing 1 x PCR 10 mM Tris based buffer (pH 8.3) with 1.5 mM MgCl2, 50 mM KCl, 0.25 µM of each fluorescently labelled primer, 200 µM, 0.5U Hot-start Taq DNA polymerase (Fisher) and ~60 ng of plasmid DNA. Negative controls were performed in the same buffer without the addition of KCl. This buffer was selected for negative controls, as it was previously used to alleviate ADO during PCR of the MEST promoter region 9. Cycling conditions consisted of an initial denaturation step of 95oC for 2 min, followed by one to five cycles of 95oC for 30 sec, 58oC annealing for 15 sec and extension at 72oC for 1 min. Polymerase extension was terminated through the addition of phenol:chloroform and brief vortexing, after which the aqueous phase was removed and concentrated by centrifugal evaporation at 55oC. DNA samples were then re-suspended directly in deionized formamide and analysed by automated capillary electrophoresis on an AB3130XL Genetic Analyser. Each assay was repeated at least three times and each consisted of three technical repeats (a total of nine times). Results shown are the average from three technical repeats. Where required, 7deazaadenosine-5'-triphosphate (7-deaza-ATP) (TriLink Biotechnologies, CA) was used at a 3:1 ratio with standard dATP. In a separate analysis, the FOPE technique was modified to investigate polymerase arrest during the course of PCR. For this analysis, a single PCR master mix was split into 35 reactions of 20 ul each, and one reaction was removed after each PCR cycle. In order to quantify the amount of DNA produced from each reaction, samples were concentrated using centrifugal evaporation and resuspended directly in highly deionized formamide prior to automated capillary gel electrophoresis (AB3130XL). The input plasmid concentration used for this assay was equivalent to 1 ng per 20 ul reaction. Raw data were visualized on Applied Biosystems Peak Scanner v2.0 software and subsequently exported into Microsoft Excel (2007). The inferred nucleotide size of each peak was rounded to the nearest whole number, and peaks of a size less than or equal to the primer were removed, as these were not relevant. The peak


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

sizes were then manually plotted such that the x-axis represented the template DNA strand (DNA sequence or amplicon size) and the y-axis represented relative fluorescence units (RFU) for each peak height, which reflects the amount of primer incorporated into the products at each peak. To integrate experimental repetitions (minimum of three), the RFU was averaged at each nucleotide position, with error bars representing the standard error. RESULTS G4 mediated polymerase arrest during amplification of the MEST promoter region. FOPE was first performed using the primers Pf1HEX and Pr3cFAM which amplify a 551 bp region from the MEST promoter. Polymerase arrest was assessed in the presence and absence of KCl, and the results represent visualization after the first five PCR cycles, as this time point provided optimum detection of full length DNA produced in the absence of KCl (Figure 2). Extension of the G-rich template strand, using the primer Pr3cFAM revealed that the major arrest site corresponded with the positions of G4MEST3 (455 bp) and two other sites (393 bp and 515 bp) (Table 1). Arrest at G4MEST3 occurred in the one nucleotide link between G-tract 1 and 2 (Table 1), indicating that the first five G-tracts were traversed prior to polymerase arrest. Polymerase arrest at 393 bp occurred within a G-rich motif (Table 1) that only has a moderate propensity for G4 formation, as assessed using QGRS mapper (data not shown) 31. Polymerase arrest at 515 bp (Table 1) occurred after the FAM labelled primer had extended approximately 20 bp into the template. Although the corresponding DNA sequence was purine rich, it did not appear likely that arrest at this position was caused by non B-DNA formation. Extension of the C-rich strand, using primer Pf1HEX demonstrated arrest that corresponded with the positions of G4MESTA (87 bp) and G4MEST1L (160 bp) (Table 1). Arrest at G4MEST1L was not expected as the corresponding G4 motif resides on the newly synthesized strand rather than the template strand, however, this observation is not unique 32. Furthermore, the motif sequence does not appear to fulfil the necessary parameters for H-DNA formation, and i-motif formation in PCR buffer is not observed (Supplementary File One). Previously, we demonstrated that ADO during PCR of this region could be alleviated by performing PCR in a low potassium KCl buffer (Figure 3A), which is expected to reduce G4 formation 9 . Therefore, we repeated the polymerase arrest assays in this PCR buffer to test whether this effected the pattern of polymerase arrest (Figure 2A). In the absence of KCl, substantial amounts of full length amplicon products (represented by peaks at 1 bp and 551 bp) were generated, however, polymerase arrest was still observed at the same sites seen in the presence of KCl. The increase in arrest product at G4MEST3 indicates that minor polymerase arrest may occur on de novo synthesized strands during the first five PCR cycles.


Page 10 of 18

Page 11 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. FOPE performed on the MEST promoter region A. FOPE performed using five cycles of PCR amplification on a 551 bp template that encompasses all G4 forming motifs. Peaks above the line represent FOPE performed in 1 x PCR buffer (50 mM KCl, 1.5 mM MgCl2) and peaks below the line represent FOPE performed in the low KCl buffer. B. FOPE performed on a 551 bp template using 7-deaza-ATP at a 3:1 ratio with dATP. The coloured arrows represent the direction of primer extension. Blue bars represent extension products originating from the reverse (FAM labelled) primers and green bars represent extension products originating from the forward (HEX labelled) primers. Relative fluorescence units are illustrated on the Y-axis and basepairs (numbers) are represented on the x-axis, and correspond to the sequence presented in Figure 1. amplification and Sanger sequencing, black boxes denote the position of SNP rs73724326. A. Amplification using low potassium buffer 9. B. Amplification using 7-deaza-ATP in the PCR buffer.

Figure 3. PCR amplification of heterozygous DNA sample Sanger sequencing results from PCR amplification of heterozygous DNA sample. Primers Pf1 and Pr3c (non-fluorescent primers equivalent to Pf1HEX and Pr3cFAM in Fig.1) were used for PCR

Differentiating between DNA triplex and G4 based polymerase arrest using 7-deaza-ATP. In addition to G4 formation, G4MEST2 and G4MEST3 appear to fulfil the necessary sequence requirements for formation of H-DNA, which could arrest polymerase during amplification of the C-rich strand 25, 33. Although the absence of polymerase arrest at these motifs during amplification of the C-rich template indicates that H-DNA formation is unlikely, we tested this hypothesis using 7-deaza-ATP. Unlike G4 structures, triplex structures are likely to require adenine Hoogsteen bonds between the template DNA and newly synthe-


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

sized DNA strand 25, 33. 7-deaza-ATP is a synthetic nucleotide no longer capable of contributing towards Hoogsteen bond formation 34 . To investigate if adenine Hoogsteen bonds contribute to polymerase arrest or ADO, we included 7-deaza-ATP in the PCR buffer at a 3:1 ratio with standard dATP. Inclusion of 7-deazaATP into the PCR buffer did not significantly influence the pattern of polymerase arrest (Figure 2B). Furthermore, 7-deaza-ATP did not alleviate ADO during PCR amplification of a known heterozygous DNA sample, as assessed by Sanger sequencing (Figure 3B). These assays reinforce prior observations that indicated G4 as the predominant non B-DNA structure present at the MEST promoter, and not DNA triplexes. Polymerase arrest performed on each G4 motif in isolation. The initial observation of ADO at the MEST promoter proved robust to multiple primer combinations 9. However, several of these primer combinations, excluded the predominant sites of primer arrest demonstrated in Figure 2. Therefore, a more focused analysis of polymerase arrest was performed by individually assessing arrest at each G4 motif in isolation. This experiment consisted of three separate primer combinations, with the results presented in a single figure (Figure 4). Primers Pf1HEX and Pr4FAM were used to investigate a 284 bp region that included the motifs G4MESTA and G4MEST1L. Primers Pf3aHEX and Pr4aFAM were used to investigate a 213 bp region that included the motif G4MEST2. Primers Pf5HEX and Pr3cFAM were used to investigate a 142 bp region that included the motif G4MEST3. This assay was also performed on DNA templates that were artificially methylated using M.SssI, however, polymerase arrest occurred at equivalent sites with non-methylated templates and these results are not presented. Analysis of the G-rich (FAM labelled primers) strand revealed more extensive arrest then previously indicated, with polymerase arrest occurring at five major sites (125 bp, 185 bp, 295 bp, 460 bp and 515 bp) (Figure 4). The peaks at 125 bp and 185 bp closely correspond with G4MEST1L and may indicate the formation of alternative G4 at this motif. Polymerase arrest at the position of 295 bp approximately corresponds with the link between G-tract 2 and 3 of G4MEST2. The peaks at 460 bp and 515 bp are consistent with Figure 2, where the peak at 460 bp corresponds with G4MEST3 (Figure 2). The minor arrest peaks observed around 360 bp, occur within 10 bp of the primer Pr4aFAM, and are unlikely to result from secondary structure formation. Extension of the C-rich strand (HEX labelled primers) demonstrated significant arrest that corresponds with G4MESTA (80 bp) (Figure 4). Minor arrest was also observed at 250 bp and 495 bp. The peak at 495 bp corresponds with a G-rich motif in the template sequence, however, the peak at 250 bp originates from an unknown source.


Page 12 of 18

Page 13 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4. Polymerase arrest by individual G4 motifs Previously characterised G4 forming motifs were assessed using FOPE performed on three individual short templates (results from which are collated in this figure). Blue bars represent extension products originating from the reverse (FAM labelled) primers and green bars represent extension products originating from the forward (HEX labelled) primers. Basepairs (numbers) are represented on the x-axis and correspond to the sequence presented in Figure 1, which also illustrates the primer combinations used to generate the three templates. Relative fluorescence units are illustrated on the y-axis and this is proportional to the amount of primer incorporated into the extension product at each peak. Modelling allelic failure using FOPE. We next modified the FOPE protocol to quantify full length and arrested products generated during PCR. Analysis was performed using primers Pf1HEX and Pr3cFAM after each of 35 PCR cycles, however, only the cycles that demonstrated significant changes are presented (Figure 5). This modified assay was separately performed on methylated and non-methylated DNA. The sites of polymerase arrest were consistent with prior analysis, and were not affected by the methylation status of the DNA template. However, comparing the results from methylated and non-methylated treatments demonstrated that full length amplicons (represented at 1 bp and 551 bp) were produced from nonmethylated DNA at earlier cycles and this corresponded with the production of substantially more end product (Figure 5). An increase in the production of full length amplicons from nonmethylated DNA correlated with a decrease in the height of polymerase arrest peaks, and this effect was most apparent after cycle 18 (Figure 5). This suggests that arrest products are eventually extended and contribute towards the synthesis of full length products. During amplification of the methylated DNA, polymerase arrest was maintained throughout the PCR, and the corresponding peaks increased in height at what appeared to be a linear rate. This corresponded with the production of fewer full length amplicons and at cycle 25 there was approximately twice the proportion of full length amplicons generated from non-methylated DNA, compared with methylated. This difference increased by cycle 35

(Figure 5 C and D) indicating that the PCR performed on methylated DNA templates operated with significantly reduced efficiency. This substantial delay in the synthesis of full length amplicons from methylated DNA was equivalent to at least 10 PCR cycles.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 18

F Figure 5. FOPE performed across 35 cycles of PCR on methylated and non-methylated templates FOPE performed on a 551 bp template which encompasses all G4 forming motifs of the MEST promoter region. Extension was performed using primers Pf1HEX and Pr3cFAM. Blue bars represent extension products originating from the reverse (FAM labelled) primer and green bars represent extension products originating from the forward (HEX labelled) primer. Assays performed on methylated template DNA are presented on the top half of each graph and assays performed on non-methylated template DNA are presented on the bottom half of each graph. Only key cycles showing significant changes are presented A. Cycle 8, B. Cycle 18, C. Cycle 25, D. Cycle 35 Modelling ADO during PCR using Sanger sequencing. The aim of this investigation was to determine the minimum number of cycles of delayed amplification during PCR that would lead to complete ADO. Delayed amplification was mimicked using nonmethylated MEST templates of different haplotypes where one MEST haplotype (ATA) was included in the PCR master mix. An equivalent amount of the opposite MEST haplotype (GCG) was added at the end of cycles 0-10. PCR products were examined for the allelic distribution at SNP rs73724326 by Sanger sequencing. Templates mixed prior to PCR (cycle 0) returned a T/C genotype, where each peak was of equivalent height (Figure 6A). Addition of the GCG haplotype after cycle one caused a ~50% decrease in detection of the “C” haplotype (Figure 6B), and addition after cycle two caused a ~75% decrease (Figure 6C). When addition of the GCG haplotype was delayed by three cycles, the “C” SNP was barely detectable (Figure 6D). A four cycle delay caused complete drop-out of the GCG haplotype (Figure 6E).

Figure 6. Sanger sequencing of ADO model amplicons Genotyping results at SNP rs73724326 (black box) on PCR products with artificially delayed amplification of one allele. The MEST GCG haplotype template was added to a PCR (containing the ATA haplotype) at A: prior to cycle 1; B: after cycle 1; C: after cycle 2; D: after cycle 3; E: after cycle 4. Amplification was achieved using primers Pf1 and Pr3 on artificial PCR product (Pf1/Pr3c).


Page 15 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

DISCUSSION We previously demonstrated that both guanine Hoogsteen bonds and cytosine methylation were factors that contribute towards ADO during PCR of the MEST promoter. In this analysis, we aimed to clarify the underlying mechanism whereby methylation and G4 contribute towards ADO at the MEST promoter region. We confirmed that each of the previously characterised G4 motifs can contribute to polymerase arrest. G4 specific polymerase arrest was validated by excluding potassium from the PCR buffer, which enabled production of full length amplicons. This observation is in accordance with previous findings where correct genotypes were obtained in the same buffer 9. When the template contained multiple G4 (G4MESTA, G4MEST1L, G4MEST2 and G4MEST3), the first G4 appears to act as the dominant barrier to amplification. Once this G4 is bypassed (presumably once it denatures), extension proceeds, but subsequent G4 did not appear to arrest amplification to the same extent. Genotyping of the MEST promoter using Sanger sequencing is not possible without PCR amplification through at least one G4 forming motif, and this likely explains why extensive primer re-design did not alleviate ADO. ADO through the formation of H-DNA. Formation of H-DNA remained a plausible explanation for ADO, as the interaction between the nascent strand and the template strand could trap polymerase during amplification 17, 21, 24, 25, 35. Furthermore, the presence of cytosine methylation may alleviate the strict pH requirements of triplex formation 36-38. G4 formation is experimentally difficult to discern from triplex formation, however, the formation of triplex DNA is likely to require a combination of guanine and adenine Hoogsteen bonds. We therefore tested the contribution of adenine Hoogsteen bonds towards ADO using a synthetic dATP analogue (7-deaza-ATP) that cannot participate in Hoogsteen bonds. Incorporation of 7-deaza-ATP into the nascent PCR strands prevents Hoogsteen interactions with the DNA template, thus decreasing triplex stability. The inclusion of 7-deaza-ATP did not appear to significantly influence polymerase arrest, indicating that adenine Hoogsteen bonds originating at the nascent strand are not a strong contributing factor. We further reinforced this observation by demonstrating that 7-deaza-ATP in the PCR buffer does not alleviate ADO, during genotyping of a known heterozygous sample. Furthermore, polymerase arrest was not observed during extension along the C-rich motif, as would be expected with formation of H-DNA. Together these observations strongly support the view that G4 are the primary structures responsible for polymerase arrest and ADO at the MEST promoter. Influence of both G4 formation and cytosine methylation on ADO during PCR. To investigate how G4 and cytosine methylation contribute towards ADO, we performed FOPE on differentially methylated templates and monitored the accumulation of partial and full length extension products during a 35 cycle PCR. Extension was arrested at equivalent sites on both methylated and non-methylated DNA, confirming that methylation alone does not direct polymerase arrest. Polymerase arrest during PCR continued during amplification of methylated DNA, and this corresponded with the production of fewer full length amplicons. These observations confirm that G4 and cytosine methylation present a more stable barrier to polymerase extension, than G4 alone. This effect was equivalent to delaying amplification of one allele during PCR by approximately 10 cycles. We have developed a novel fluorescent primer extension method that gave a visual read-out on extension products from either template strand in a single reaction. The majority of G4 motifs occur on one DNA strand (the G-rich strand) and when this strand

served as the template, substantial polymerase arrest was observed. Amplification products from the G-rich strand contained the FAM label, and synthesis of full length products consistently lagged behind those from the C-rich strand (HEX labelled). This effect was especially evident at cycle 35 for the methylated template (Figure 5D) where the relative proportion of full length products differed by approximately 50%. Because each newly synthesized DNA strand is non-methylated, it is possible that amplification of the G-rich DNA strand occurs by copying the newly synthesized C-rich strands, rather than the original methylated DNA. To test if the observed delay in amplification of methylated DNA was sufficient to explain ADO, we modelled delayed amplification of one allele during PCR. To achieve this, we used nonmethylated templates of opposing haplotypes (GCG vs ATA), where the amplification of one haplotype was artificially delayed by adding it to the PCR at the end of cycles 0 - 10. This experiment demonstrated that delaying amplification of one allele by as few as four cycles was sufficient to cause complete ADO of that allele. The previous FOPE analysis indicated that the amplification of methylated DNA is delayed by approximately 10 cycles compared with non-methylated DNA, and therefore, this appears ample to cause complete ADO. Using CD spectroscopy, we previously demonstrated that in PCR buffer, the addition of methylated cytosine to G4 oligonucleotides enhanced the re-association after denaturation, compared with non-methylated oligonucleotides 27. This observation is similar to those of Hardin et al. (1993) 30. This is likely to explain why polymerase arrest is maintained at G4 positions for an unusually high number of cycles during PCR. We propose that rapid reassociation of methylated G4 during PCR causes ADO by maintaining G4 structures on the maternally methylated DNA during PCR and preventing amplification of full length products from such templates. Full length amplification from non-methylated templates appears to proceed after the G4 structures have denatured. Early arrest products can contribute towards the production of full length amplicons as they appear to be extended in subsequent cycles. During PCR of genomic DNA, methylated and nonmethylated DNA is amplified in a single reaction. This implies that arrest products generated from methylated templates may subsequently re-anneal to non-methylated template and be extended, contributing towards full length templates. When SNPs are positioned between the G4 motif and the primer, this biased amplification may have significant implications for genotyping DNA because, in addition to the potential ADO, “template switching” could generate artefactual haplotypes. We have demonstrated that ADO at differentially methylated gene regions is of potential widespread implications through the genome 10 and is likely to also be a significant hindrance to the study of random inactivation at X-linked CpG islands 39, 40. In vivo, cytosine methylation is an important epigenetic regulator of the transcriptome, and although cytosine methylation does not alter the DNA sequence, it is widely accepted that the presence of methylation correlates with altered gene expression 41-43. If methylated G4 presents a significant barrier to the synthesis of DNA in vitro by Taq DNA polymerase, it is worth considering whether there may be a similar in vivo effect on both DNA and RNA polymerases. Halder et al. found significantly reduced levels of methylation at G4 forming motifs, suggesting that the colocalisation of G4 and methylation throughout the genome may be generally deleterious, or have a specific in vivo function 44. The question of in vivo impacts of G4 co-localisation with methylation is therefore worthy of further study. Conclusion.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

In this paper we describe Taq polymerase arrest at G4 motifs during PCR amplification of both methylated and non-methylated DNA. The fluorescent assay described here allows relative quantification of PCR amplification products, and distinguishes extension products from full length amplification products, which cannot be achieved using other methods such as qPCR. This novel technique allows examination of the products of polymerase action on each strand of the DNA template, providing a high resolution mechanistic analysis of ADO. With this method we have shown that despite the decreased stability of methylated G4 9, polymerase arrest at G4 structures in methylated DNA is sufficiently persistent to cause strand specific ADO. We propose that polymerase arrest results from re-association of structures such as G4, which is aided by methylated cytosine.

ASSOCIATED CONTENT Supporting Information Supplementary File One contains a structural analysis of imotif formation in PCR buffer using circular dichroism spectroscopy. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *To whom correspondence should be addressed, Department of Pathology, University of Otago, Christchurch, P.O. Box 4345, Christchurch, New Zealand. Email: [email protected], phone: +643 364 0530

Author Contributions AJS conceived and carried out majority of experimental work, and drafted the manuscript. MAK contributed expertise and resources, and edited manuscript.

Funding Sources This research was supported by the Marsden Fund (11-UOO-175 BMS) Council from New Zealand Government funding, administered by the Royal Society of New Zealand, and by the Carney Centre for Pharmacogenomics, University of Otago.

Notes The authors declare no competing financial interests.

ACKNOWLEDGMENT We acknowledge the support of the University of Otago Graduate Research Committee by providing a Postgraduate Publishing Bursary (Doctoral) to AJS. We also thank Allison Miller for constructive advice.

ABBREVIATIONS PCR: Polymerase Chain Reaction. G4: G-quadruplex. ADO: Allelic Drop-out 7-deaza-ATP: 7-deazaadenosine-5'-triphosphate. FOPE: Fluorescent oligonucleotide primer extension. MEST: Mesoderm expressed sequence transcript.


Page 16 of 18

Page 17 of 18

Biochemistry

REFERENCES

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1. Lam, C.-W. and Mak, C. M. (2013) Clin. Chim. Acta 421, 208-212. 2. Wenzel, J. J. , Rossmann, H., Fottner, C., Neuwirth, S., Neukirch, C., Lohse, P., Bickmann, J. K., Minnemann, T., Musholt, T. J., Schneider-Ratzke, B., Weber, M. M., and Lackner, K. J. (2009) Clin. Chem. 55, 1361-1371. 3. Boan, F., Blanco, M. G., Barros, P., Gonzalez, A. I. and Gomez-Marquez, J. (2004) Febs Lett. 571, 112-118. 4. Saunders, C. J., Friez, M. J., Patterson, M., Nzabi, M., Zhao, W. W., and Bi, C. P. (2010) Genet. Test. Mol. Biomark. 14, 241-247. 5. Hussain Askree, S., Hjelm, L. N., Ali Pervaiz, M., Adam, M., Bean, L. J., Hedge, M., and Coffee, B. (2011) The J. Mol. Diagn. 13, 108-112. 6. Landsverk, M. L., Douglas, G. V., Tang, S., Zhang, V. W., Wang, G. L., Wang, J., and Wong, L. J. C. (2012) Genet. Med. 14, 877-882. 7. Chambers, V. S., Marsico, G., Boutell, J. M., Di Antonio, M., Smith, G. P., and Balasubramanian, S. (2015) Nat. Biotechnol. 33, 877-881. 8. Weitzmann, M. N., Woodford, K. J., and Usdin, K. (1996) J. Biol. Chem. 271, 20958-20964. 9. Stevens, A. J., Stuffrein-Roberts, S., Cree, S. L., Gibb, A., Miller, A. L., Doudney, K., Aitchison, A., Eccles, M. R., Joyce, P. R., Filichev, V. V., and Kennedy, M. A. (2014) PLoS One 9, 1-24. 10. Stevens, A. J., Taylor, M. G., Pearce, F. G., and Kennedy, M. A. (2017) G3: Genes, Genomes, Genet. 7, 1019-1025. 11. Zhao, J. H., Bacolla, A., Wang, G. L., and Vasquez, K. M. (2010) Cell. Mol. Life Sci. 67, 43-62. 12. Biffi, G., Tannahill, D., and Balasubramanian, S. (2012) J. Am. Chem. Soc. 134, 11974–11976. 13. Maizels, N. (2015) EMBO Rep., e201540607. 14. Ambrus, A., Chen, D., Dai, J., Jones, R. A., and Yang, D. (2005) Biochemistry 44, 2048-2058. 15. Koshlap, K. M., Schultze, P., Brunar, H., Dervan, P. B., and Feigon, J. (1997) Biochemistry 36, 2659-2668. 16. Radhakrishnan, I., and Patel, D. J. (1993) Structure 1, 135-152. 17. Radhakrishnan, I., and Patel, D. J. (1994) Biochemistry 33, 11405-11416. 18. Guéron, M., and Leroy, J.-L. (2000) Curr. Opin. Struct. Biol. 10, 326-331. 19. Zhou, J., Wei, C., Jia, G., Wang, X., Feng, Z., and Li, C. (2010) Mol. BioSyst. 6, 580-586. 20. Dai, J., Hatzakis, E., Hurley, L. H. and Yang, D. (2010) PLoS ONE 5 DOI: 10.1371/journal.pone.0011647. 21. Frank-Kamenetskii, M. D., and Mirkin, S. M. (1995) Ann. Rev. Biochem. 64, 65-95. 22. Buske, F. A., Bauer, D. C., Mattick, J. S., and Bailey, T. L. (2012) Genome Res. 22, 1372-1381. 23. Gaddis, S. S., Wu, Q., Thames, H. D., Digiovanni, J., Walborg, E. F., MacLeod, M. C., and Vasquez, K. M. (2006) Oligonucleotides 16, 196-201.

24. Raghavan, S. C., Houston, S., Hegde, B. G., Langen, R., Haworth, I. S., and Lieber, M. R. (2004) J. Biol. Chem. 279, 46213-46225. 25. Samadashwily, G., Dayn, A., and Mirkin, S. (1993) EMBO J. 12, 4975. 26. Day, H. A., Pavlou, P., and Waller, Z. A. (2014) Bioorg. Med. Chem. 22, 4407-4418. 27. Stevens, A. J., and Kennedy, M. A. (2017) PLoS One 12, e0169433. 28. Stevens, A. J., Kennedy, H. L., and Kennedy, M. A. (2016) Biochemistry 55, 3714-3725. 29. Lin, J., Hou, J. Q., Xiang, H. D., Yan, Y. Y., Gu, Y. C., Tan, J. H., Li, D., Gu, L. Q., Ou, T. M., and Huang, Z. S. (2013) Biochem. Biophys. Res. Commun. 433, 368-373. 30. Hardin, C. C., Corregan, M., Brown II, B. A., and Frederick, L. N. (1993) Biochemistry 32, 5870-5880. 31. Kikin, O., D’Antonio, L., and Bagga, P. S. (2006) Nucleic Acids Res. 34, W676-W682. 32. Lormand, J. D., Buncher, N., Murphy, C. T., Kaur, P., Lee, M. Y., Burgers, P., Wang, H., Kunkel, T. A., and Opresko, P. L. (2013) Nucleic Acids Res. 41, 1032310333. 33. Dayn, A., Samadashwily, G. M., and Mirkin, S. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 11406-11410. 34. Schneider, K., and Chait, B. T. (1995) Nucleic Acids Res. 23, 1570-1575. 35. Cheng, A. J., Wang, J. C., and Van Dyke, M. W. (1998) Antisense Nucleic Acid Drug Dev. 8, 215-225. 36. Lee, J. S., Woodsworth, M. L., Latimer, L. J., and Morgan, A. R. (1984) Nucleic Acids Res. 12, 6603-6614. 37. Leitner, D., Schröder, W., and Weisz, K. (2000) Biochemistry 39, 5886-5892. 38. Xodo, L. E., Manzini, G., Quadrifoglio, F., van der Marel, G. A., and van Boom, J. H. (1991) Nucleic Acids Res. 19, 5625-5631. 39. Gimelbrant, A., Hutchinson, J. N., Thompson, B. R., and Chess, A. (2007) Science 318, 1136-1140. 40. Kucera, K. S., Reddy, T. E., Pauli, F., Gertz, J., Logan, J. E., Myers, R. M., and Willard, H. F. (2011) Hum. Mol. Genetics 20, 3964-3973. 41. Razin, A., and Riggs, A. D. (1980) Science 210, 604-610. 42. Rottach, A., Leonhardt, H., and Spada, F. (2009) J. Cell. Biochem. 108, 43-51. 43. Maunakea, A. K., Nagarajan, R. P., Bilenky, M., Ballinger, T. J., D’Souza, C., Fouse, S. D., Johnson, B. E., Hong, C., Nielsen, C., and Zhao, Y. (2010) Nature 466, 253-257. 44. Halder, R., Halder, K., Sharma, P., Garg, G., Sengupta, S., and Chowdhury, S. (2010) Mol. BioSyst. 6, 2439-2447.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 18

Table 1. Major polymerase arrest sites Peak Size (nt)

Corresponding template sequence 5’ to 3’ *,**

Name

Strand

1

Full length product

N/A

FAM

37

CCTGCTCCCATCCCTCGTTCGAAGCGTGGGTACTGA

Unknown

HEX

87

GGTGCCGGCCGTGGGGTCTCGGGACGACGGG

G4MEST

HEX

G4MEST1

HEX

A 160

CCACAAACCCCACAGGCCGCCCACAAACCC L

393

GGTGGTAGAGCGGCTGGGAGGGG

Unknown

FAM

455

GGGCGGGCTAGGGGCGGGGCGCGGGTGGG

G4MEST3

FAM

515

CTCCGCGCTGCCGCGGCAACCAGCAC

Unknown

FAM

551

Full length product

N/A

FAM

* The nucleotide associated with each termination site is underlined ** Where applicable, G-tracts are indicated in grey shading


Methylated Cytosine Maintains G-Quadruplex Structures during

Recommend Documents