Anal. Chem. 1994,66, 1021-1026
Multiple Sheath-Flow Gel Capillary-Array Electrophoresis for Multicolor Fluorescent DNA Detection Satoshi Takahashi, Katsuhiko Murakami, Takashl Anazawa, and Hideki Kambara' Central Research Laboratory, Hitachi Ltd., Kokubunji, Tokyo 185, Japan
Gel capillary-array electrophoresis has been developed to achieve a high-sensitivity and high-throughput DNA analysis using real-time fluorescencedetection. To eliminateexcitation light scattering at the capillary surfaces and to irradiate all the migration tracks simultaneously, the capillary tubes were removed from the irradiated region. DNA fragments were eluted from the gel capillaries and flowed into the lower open capillaries. Multiple sheath flows of buffer solution around all the capillaries were produced to prevent DNA band diffusion in the gel-free irradiated region. The fluorescence image was detectedwith a two-dimensional detectorcoupledwith an imagesplitting prism having four color filters. As the background fluorescence from the sheath-flow region was very small, the minimumdetectableconcentrationof fluorophore-labeled DNA was 10-13M in one-color mode (Texas Red was used), and it was 2 X lo-" M in four-colormode (fluorophoresfrom Applied Biosystems were used). The experiment was carried out with the 20 capillaries and the base reading speed of 200 b a s e s h However, it is easy to increase the number of capillaries and the electrophoresis speed to achievevery high throughput DNA analysis. High-sensitivity, high-speed, and high-throughput DNA analysis is important for the Human Genome Project.' Various automated DNA sequencers have already been developed,24 and various efforts have been made to achieve high-speed analysis. These include optimization of the gel electrophoresis conditions,6 the use of thin slab gels,' and the use of gel-filled capillaries.*-15 Among these, the gel-filled capillary seems attractive because it is easy to handle and (1) Wada, A. Nature 1987, 325, 771-772. (2) Smith, L. M.; Sanders, J. 2.; Kaizer, R. J.; Hughes, P.; Dodd, C.; Connell, C. R.; Heiner, C.; Kent, S. B. H.; Hood, L. E.Nature 1986, 321, 674-679. (3) Prober, J. M.; Trainor, G. L.; Dam, R. J.; Hobbs, F. W.; Robertoson, C. W.; Zagursky, R. J.; Cocuzza, A. J.; Jensen, M. A,; Baumeister, K. Science 1987, 238, 336-341. (4) Ansorge, W.; Sproat, B. S.;Stegemann, J.; Schwager, C. J. Biochem. Biophys. Methods 1986, 13, 315-323. ( 5 ) Middendorf, L. R.; BNW, J. C.; Bruce, R. C.; Eckles, R. D.; Grone, D. L.; Roemer, S.C.; Sloniker, G. D.; Steffens, D. L.; Sutter, S. L.; Brumbaugh. J. A.; Patonay, G. Electrophoresis 1992, 13, 487494. (6) Kambara, H.; Nishikawa, T.; Katayama, Y.;Yamaguchi, T.Bio/ Technology 1988, 6, 816-821. (7) Kostichka, A. J.; Marchbanb, M. L.; Brumley, R. L., Jr.; Drossman, H.; Smith, L. M. BiolTechnology 1992, 10, 78-81. (8) Luckey. J. A.; Drossman, H.; Kostichka, A. J.; Mead, D. A.; D'Cunha, J.; Norris, T. B.; Smith, L. M. Nucleic Acids Res. 1990, 18, 44174421. (9) Cohen, A. S.;Najarian. D. R.; Karger, B. L. J. Chromatogr. 1990,516,49-60. (10) Swerdlow, H.; Wu, S.; Harke, H.; Dovichi, N. J. J . Chromorogr. 1990,516, 61-67. (11) Smith, L. M. Nature 1991, 349,812-813. (12) Karger, A. E.;Harris, J. M.; Gesteland, R. F. Nucleic Acids Res. 1991, 19,
49554962.
(13) Swerdlow, H.; Zhang, J. 2.; Chen, D. Y.; Harke, H. R.; Grey, R.; Wu, S.; Dovichi, N. J.; Fuller, C. Anal. Chem. 1991, 63, 2835-2841. (14) Huang, X.e.;Quesada, M. A.; Mathies, R. A. Anal. Chem. 1992,64,21492154. (15) Guttman, A.; Cooke, N. A w l . Chem. 1991, 63, 2038-2042.
0003-2700/94/0366102 1$04.50/0 0 1994 American Chemical Society
inject samples. In general, DNA migration speed can be increased by using a higher electric field. However, the resultant Joule heating widens the DNA bands and thus reduces resolution. Capillary gel electrophoresis (CGE) coupled with laser-excited fluorescenceis therefore a promising technique not only because capillary gels are easy to handle, but also because a high electric field can be applied to a capillary without resulting in a large amount of Joule heating or a significant temperature gradient. Although CGE provides rapid analysis, its throughput is not so large, so multiple capillaries must be used. A critical problem with capillaryarray systems is how to irradiate all the capillaries without producing a large background signal due to light scattering at the capillary surfaces. Huang et al. recently reported capillary-array electrophoresis using a confocal detection system that eliminated the background signals from the capillary surfaces.16 We have independently developed another kind of capillary-array gel electrophoresis system,17 which we have modified for four-color detection. In this paper, we show that this new system based on a multiple sheath-flow technique coupled with multicolor detection has both very high sensitivity and high throughput.
EXPER I MENTAL SECTION Multiple Sheath-Flow Assembly for Capillary Array. In most laser-excited fluorescence detection schemes, the fluorescence detector is placed perpendicular to the direction of the excitation light in order to minimize the background light due to scattering. However, it is difficult to configure a detection system using this geometry for an array of capillaries, because the laser beam would be scattered and refracted at the first capillary and would not irradiate all the capillaries simultaneously. This problem was overcome by removing the capillaries in the irradiated region as shown in Figure 1. The electrophoresis lanes thus consist of three parts: the gel-filled capillaries, the gel-free optical cell, and the gel-free open capillary. Twenty capillaries (0.1 mm id., 0.2 mm 0.d.) were lined up at a 0.35" pitch, and their outflow ends were placed in the optical cell, 1 mm away from the lower capillaries (0.2 mm i.d., 0.35 mm 0.d.) (Figure 2). The cell is filled with a buffer solution that flows into the lower capillaries in response to a small pressure on the buffer solution in the cell. This arrangement results in sheath flows around each of the electrophoresis lanes, and the sheath-flow rate was adjustable by changing the position of the buffer vessel connected to the optical cell. The cell was made of stainless steel with four (16) Huang, X.C.; Quesada, M. A.; Mathics, R. A. A w l . Chem. 1992,64,967-
972.
(17) Kambara, H.; Takahashi, S. Nature 1993, 361, 565-566.
Analytical Chemistry, Vol. 66, No. 7, April 1, 1994
1021
7
buffer vessel
1-1
I-filled capillary
DNA fragments
gel-filled(:apillary
optical cell
\
Ar' laser
bufl mirror
bu
laser
-
sheath-flow
mm
I /I II I / I/11 I/II I/il II 11 II I/I I ~ I I I
JL
jjj((;
:iih\ 'image splitting prism I \
optical filters
open capillary
0.35 mm
Flgure 1. Schematic view of the multiple sheath-flow cell. Twenty gel-filled capillaries are aligned at a 0.35-mm pitch in an optical cell (26 mm X 26 mm X 4 mm). The end of each capillary faces an open capillary 1 mm away. The cell is filled with buffer solution and is connected to a buffer vessel which supplies buffer solution to the cell. Sheath flows are produced around the capillaries and flow into the lower open capillaries. The flow rate is determined by the position of the buffer vessel. DNA fragments eluted from the gel-filled capillaries are drawn into the lower open capillaries by the sheath-flow stream. capillary tube guide
1
gel,-filled capillary 0.1 mm i.d., 0.2 mm 0.d.
+
__ 1 mm
3-
I
open capillary 0.2 mm i.d., 0.35 mm 0.d.
Flgure 2. Photograph of the capillary-arraycell. The capillary array is alignedIn the center of two quartz windows placed 2 mm apart from each other.
windows to pass the laser light and fluorescence. The capillaries were sandwiched between two quartz plates placed 2 mm apart. Capillary tube guides were used to centralize the capillaries between the two quartz plates. DNA fragments separated in the gel-filled capillaries are eluted into the sheath flow in the cell and flow out through the lower capillaries. They are irradiated and emit fluorescence in the sheath-flow region. The background fluoresence is very low because the irradiated region is gel-free. FIuoresenceDetection System. We have already developed a highly sensitive DNA sequencer for a slab gel system that uses fluorescence detection. * * This sequencer uses side-entry laser irradiation, which can irradiate all the migration lanes simultaneously, and it detects fluorescence with a highly (18)'Kambara,H.; Nagai, K.; Kawamoto, K. Electrophoresis 1992,13,542-546.
1022 AnalyticalChemistry, Vol. 66, No. 7, April 1, 1994
computer Flgure 3. Schematic view of the multicolor detecting capillary-array system. Two lasers (Ar+ 488 nm, and YAG 532 nm) are used for excitation. The fluorescenceline image is split Into four different color images with a polyhedral image-splitting prism coupled with optical filters.
sensitive two-dimensional camera system from a direction perpendicular to the incident laser beam. The fluorescence from the irradiated region produces a line image on the twodimensional detector, which consists of a cooled CCD camera coupled with a cooled image intensifier (ICCD-576, Princeton Instruments, Inc.), and this detector is connected to a workstation (2050, Hitachi Ltd.). We adapted this detection system for the multiple sheath-flow capillary array by decreasingthe distance between the irradiated region and the detector, because the length of the irradiated region required for the measurement was only 10 mm. The image magnification factor was 1, which is 6 times bigger than that in the case of a slab gel. This improved the fluorescencecollecting efficiency by 1 order of magnitude to 1% in the case of single-color detection. Although this efficiency is not as high as the reported efficiency of 12% achieved in a single-capillary detection system,19the overall efficiency (taking the duty cycle, which is generally smaller than 0.01, into account) is much higher than that of any scanning system because all the lanes are irradiated and their fluorescence is recorded simultaneously. The repeat cycle for data sampling was 1s (adjustable between 0.5 and 10 s). The excitation light source was a He-Ne laser (594 nm, 5 mW) and the labeling fluorophore for single-color detection was Texas Red (hx = 594 nm, &m = 615 nm). For DNA sequencing, the system was modified for fourcolor detection using the following labeling fluorophores: FAM (LX= 493 nm, &m = 519 nm), JOE (hx= 526 nm, &, = 548 nm), TAMRA (Lx = 559 nm, &m = 578 nm), and ROX (bx= 580 nm, b m = 605 nm) from Applied Biosystems, a division of Perkin-Elmer Corp. (Foster City, CA). Although these fluorophores are excited with an Ar+ laser (488 and 514.5 nm) in the Applied Biosystems system, we used two lasers, an Ar+ laser (488 nm, 6 mW) and a YAG laser (532 nm, 6 mW), for the excitation light in order to obtain a higher excitation efficiency for all the fluorophores. The YAG laser beam was reflected with a dichroic mirror to irradiate the migration lanes. The Ar+ laser beam was reflected with an
-
(19) Zhang, J. 2.;Chen, D. Y.; Wu, S.; Harke, H. R.; Dovichi, N. J. Clin. Chem. 1991,37, 1492-1496.
100
0
8
450
490
530 570 wavelength (nm)
610
650
Figure 4. Fluorescencespectra and transmittanceof band-pass filters. Four fluorophores from Applied Biosystemswere used. The solid lines are the fluorescence spectra for FAM, JOE, TAMRA, and ROX, as indicated. The dashed lines are the corresponding transmission characteristics of the optical band-pass filters.
c
.-C
a,
C 0
a,
cn
F
0 2 -c
4 n
I
'"I
-0
0 "
position (mm)
Flgure 5. Fluorescence image In the one-color mode during laser
aluminum-coated mirror and passed through the dichroic mirror where it was mixed with the YAG laser beam. The combined laser beam irradiated the migration lanes simultaneously. The detection system was also modified for multicolor detection. There are several ways of achieving this, but we used the simplest method that uses an imagesplitting prism, as previously demonstrated in two-color and four-color slab gel detection system^.^^^^ The image-splitting prism was placed between two focusing lenses to produce four separated fluorescence line images on the detector. Each image passed through a different optical filter to produce color-separated line images (dotted line images). A schematic view of the multicolor system is shown in Figure 3. The characteristics of the optical band-pass filters are shown in Figure4 together with theemissionspectra of the fluorophores. In the capillary-array system, an image of the capillary array was also observed in the detector (see Figure 5 ) , due to irradiation by scattered laser light. If this image were overlaid on the fluorescence image of the DNA fragments, it would cause an increase in background light intensity and a smaller signal-to-noise ratio (S/N). This drawback was overcome by .adjusting the distance between neighboringfluorescencelines by changing the prism angle. The angle between neighboring prism surfaces at the light exit side was 4". Details of the image-splitting method are given in ref 21. This multicolor detection method operates faster and more stably than the moving color wheel method because it involves no moving parts. Preparation of Capillary Gel Columns. The preparation of the capillary gel columns is very important for obtaining good DNA separation, and a lot of studies have been made in this area.22-26In a gel capillary sheath-flowsystem, modification of the inner wall of the capillaries is indispensable because without the modification some gel would come out of the (20) Kambara, H.; Nagai, K.; Hayasaka, S. BiolTechnology 1991, 9, 648-651. (21) Hitachi Ltd., US. Pat 5,062,942, April 12, 1990. (22) Baba, Y.; Matsuura, T.; Wakamoto, K.; Morita, Y.; Nishitsu, Y.; Tsuhako, M. Anal. Chem. 1992,64, 1221-1225. (23) Yin, H.-F.; Lux, J. A.; Schomburg, G. J. High Resolut. Chromatogr. 1990, 13,624-621. (24) Swerdlow,H.; Dew-Jager, K. E.; Brady, K.; Grey, R.; Dovichi, N. J.; Gesteland, R. Electrophoresis 1992, 13, 415483. (25) Heiger, D. N.; Cohen, A. S.; Karger, B. L. J. Chromatogr. 1990,516,3348. (26) Rocheleau, M. J.; Grey, R. J.; Chen, D. Y.; Harke, H. R.; Dovichi, N. J. Electrophoresis 1992, 13, 484-486.
irradiation (a) and fluorescence intensity change along the laser path (b). Texas Red labeled primer is flowing continuously. Although this image was taken with a band-pass filter, intense dotted line images produced by migrating DNA bands and images of the capillaries can be seen. The capillaries are illuminated by scattering laser light.
-0
150 cn c1
100
0
10
20
30
40
50
60
70
80
flow rate (nl / sec /capillary) Figure 6. Relationshipbetween sheath-flow rateand DNA band spread.
capillary tubes and interfere with the laser irradiation. The inner walls of the capillaries were treated with a bifunctional reagent, methacrylic acid 3-(trimethoxysily1)propyl ester (Tokyo Chemical Industry Co., Ltd.), in order to prepare the walls for acrylamide adhesion. This prevented the gel from emerging from the capillaries into the irradiated region. The capillaries were quickly cleaned by flowing NaOH (0.1 M), deionized water, and ethanol. The capillarieswere then treated for 30 min with 0.3% bifunctional reagent solution in ethanol containing 0.3% acetic acid. The solution was removed by passing N2 gas, and the capillaries were dried for 1 h at 110 "C. Two types of gel were investigated and evaluated (4% T, 5% C) and (9% T, 0% C). It was not easy to produce gel in the capillaries without bubbles when the inner wall of capillary was treated with a bifunctional reagent. A mixture of acrylamide gel solution (9% T, 0% C or 4% T, 5% C) in a 1 X TBE buffer (89 mM Tris-boric acid, 2 mM EDTA, pH 8.3) with 7 M urea was filtered with a 0.2-pm filter and degassed under vacuum for 1 h. N,N,N',N'-Tetramethylethylenediamine(TEMED) and ammoniumpersulfate (APS) were added to the gel solution at a final concentration of Analytical Chemistry, Vol. 66, No. 7, April I, 1994
1023
number of capillaries 12345
\\ I I /
~~
Table 1. Average Migration Times and Standard Deviatlons of Given DNA Fragments in Twenty Capillaries
migration time (min)
1819 20
\\ I
base no.
mean
SD
RSDa (% )
71 129 209 305 374
28.3 39.6 56.5 77.7 92.4
1.3 1.8 2.7 3.7 5.1
4.5 4.4 4.7 4.7 5.5
20
30
a
RSD, relative standard deviation.
100 lineup direction of caDillaries n
.-C E
40 v)
W
.E + C
0 .e 2 .-cn
E
% a
13
+0
50
L
?OO
2 E
3
60
c
70
300 main contributing fluorophore
80 Figure 7. Fluorescenceladder pattern of DNA fragments in one-color detection mode. The conditions employed in this separation were as follows: 4 % T, 5 % C gel in 1 X TBE and 7 M urea; gel capillary length 35 cm; Texas Red labeled primer combined with M13 mp 18 DNA "A" fragments; sample injection for 5 s at 4 kV, electrophoresisat 170 V/cm in 3 X TBE. Sample fragmentswere producedusing Sequenase with Mn*+-containing buffer.
-
0.05%. The solution was immediately injected into the capillaries with a syringe and polymerized overnight at room temperature. Twenty percent of the gel capillaries had bubbles in them. Bubble-freegel capillaries were selected for the array. The outflow ends of the gel-filled capillaries were aligned and fixed in grooves on a plate. The ends of the gel-filled columns were then trimmed by about 1 cm away from the edge of the plate and inserted into the optical cell through 0.2-mm holes in its upper surface, so that their outflow ends were positioned 1 mm away from the lower capillaries. The lower capillaries were open capillaries, and their inner walls were treated with reagent for introducing amino residues. Sample Preparation. Fluorescent-labeled DNA fragments were produced by a Sanger sequencing reaction, and the template DNA was M13mp18 DNA. Texas Red labeled primer was obtained from Yuki Gosei Kogyo (Tokyo, Japan) for the one-color experiments. The procedure is described in detail elsewhere.27 In the one-color case, the concentration of each final product was 0.2 pmol/pL, which was almost 10 times higher than that in the slab gel case. For the four-color experiments, fluorescent-labeled DNA sequencing fragments were produced by using the Taq DyeDeoxy Terminator Cycle Sequencing Kit from Applied Biosystems. Sequencing reactions were prepared from 2 pg (27) Nishikawa, T.; Kambara, H. Electrophoresis 1992, 13, 495-499.
1024 Analytical Chemistry, Vol. 66, No. 7, April 1, 1994
Figure 8. Fluorescence image obtained with the four-color system. The four dotted lines correspond to the signals obtained through four different filters.
of M13mp18 single-strand DNA template according to the standard procedure of the kit, and ethanol precipitation was used to prepare the sample for injection. After the ethanol precipitation, the sample was resuspended in 4 pL of formamide, and heated at 90 "C for 2 min prior to sample injection. The sample was electrophoretically injected into the capillaries with a typical injection time of 5-10 s at an electric field strength of 100-160 V/cm. RESULTS AND DISCUSSION Figure 5 shows the fluorescence image in the one-color mode and the intensity trace along the laser path when the labeled primer is flowing continuously. The positions of the fluorescencepeaks correspond to the migration lane centers, and their widths indicate the radial spread to the sample flow. The full width at half-maximum (fwhm) of each radial spread was -0.18 mm, which is almost a half of the pitch between capillaries, and therefore there was no cross-talk between fluorescence signals from different migration lanes. The spread depends on the sheath-flow rate as shown in Figure 6 and is small enough when the per capillary sheath-flow rate is greater than 50 nL/s. This corresponds to a flow speed of 1.6 mm/s in the lower open capillary tubes. Although the flow speed in the irradiated region might be much slower than this, it is still faster than the DNA migration speed in the gel, which is estimated to be about 0.1 mm/s when the migration time of DNA fragments and the migration length are 30 min and 300 mm, respectively. The peak intensities also depend on the flow rate: at low flow rates they are very weak, but they
60 c1 .~
100
number of bases
176
ATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCA~
v)
L=
a,
CI
.-S d>
.->
-c,
m -
?
o 41
177
migration time (min)
76
number of bases
303
TTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTT
76
111
migration time (min)
Flgure 9. DNA fragment spectra in four-color detection. The conditions employed in this separation were as follows: 9 % T, 0% C gel in 1 X TBE and 7 M urea; gel capillary length 30 cm; sample injection for 10 s at 5 kV, electrophoresis at -230 V/cm (the initial strength was lower) in 1 X TBE. Sample fragments were produced using Taq DyeDeoxy Terminator Cycle Sequencing Kit from Applied Biosystems. These four spectra, correponding to four DNA familes, are obtained from the observed spectra after subtracting the contributions from the other families: red, A; blue, C; green, 0; black, T.
increase with increasing flow rate, remaining constant at flow rates of between 50 and 80 nL/s. The low fluorescence intensity at low flow rates is due to the diffusion of DNA fragments into the buffer. To investigatethe sensitivityof this system,the gel capillary array was replaced by an open capillary array and the fluorescencewas detected by using a buffer solution containing Texas Red labeled primer. A He-Ne laser was used for excitation. A buffer solution containing TexaS Red labeled primer at a concentration of lo-" M was detected with an S / N of 200, under the condition that the flow rate of Texas Red solution was 1 nL/s and the sheath-flow rate was 50 nL/s. The estimated detection limit was 1 X 10-13 M (S/N = 2). This is 1 order of magnitude lower than the detection limit in the case of capillary tube irradiation2* and is comparable to the sensitivityobtained with FITC as a labeling fluorophore in sheath-flow experiments using a single-gel capillary.10Jg However, the detection sensitivity in the fourcolor detection mode using FAM, JOE,TAMRA, and ROX decreased to 2 X lo-'* M. This is because the noise level increased by 3 times, the excitation efficiency decreased to one-sixth, and the fluorescence collecting efficiency decreased to one-fourth for each fluorescence. To investigate the reproducibility of electrophoresispatterns and migration speeds from capillary to capillary, "A" fragments were electrokinetically injected into each capillary and electrophoresed. A ladder pattern of the fragments is shown in Figure 7. The vertical direction is the migration time. The (28) Swerdlow, H.; Gesteland, R. Nucleic Acids Res. 1990, 18, 1415-1419.
migration times of a given DNA fragment species depended on the gel capillaries, which may be due to the inhomogeneities of the gel capillaries. Table 1 lists the migration time and the variation in given DNA fragments in 20 capillaries. Although the relative standard deviation was less than 596, it is not recommended to use a one-fluorophore four-lane system for DNA sequencing. A four-color one-lane system has many advantagesin a capillary-array DNA sequencer. The variation in migration time from run to run was 5%. The base reading speed per capillary was 280 bases/h. (Two hundred and eighty fluorescent peaks appear in 1 h.) For the comparison of band broadening in on-column and sheath-flow measurements, DNA fragment spectra were obtained in both modes at the same time. One gel capillary was fixed in the sheath-flow cell. The laser irradiated the sheath-flow region and the light was then refracted to hit the capillary for the on-column measurement. Better resolution was obtained in the spectrum with the sheath-flow measurement whereas the fluorescenceintensities in the long-fragment region under sheath-flow conditions were lower than those obtained under on-column conditions. The number of theoretical plates of 1.8 X lo6 (in the on-column region) and 2.6 X lo6 (in the sheath-flow region) were obtained at 337-base length. This illustrates that the fwhm of the DNA band in the sheath-flowregion is smaller than in the on-column region and higher resolution can be achieved by measurement in the sheath-flow region. This phenomenon is caused by a band spacing between DNA fragments getting relatively longer in the sheath-flow region.
-
AnalyticalChemistry, Vol. 66, No. 7, April 1, 1994
1025
In the four-color detection mode, four dotted line images were produced by the image-splitting prism as shown in Figure 8. The main contributors to these fluorescence lines were ROX, TAMRA, JOE, and FAM from the top downward. The individual DNA fragment spectra corresponding to the four different terminus species were calculated from these mixed fluorescence signals. One set of DNA fragment spectra obtained with 9% T, 0% C (linear) gel is shown in Figure 9. It was possible to determine the base order over 300 bases with enough resolution to separate one base difference at the base reading speed of 200 bases with a -230 V/cm electric field (gel capillary length, 30 cm), which is slower than that obtained with 4% T, 5% C gel. The fwhm (w) and band spacing (d) of a 300-base-length fragment are in the ratio 0.45:0.6. Although this speed is slower than that obtained with a thin gel system, it is much faster than conventional fluorescent DNA sequencers where the base reading speed is 50-80 bases/h. It would be better to use a low-acrylamideconcentation gel for reducing the migration time (Figure 7 ) . It takes 10-20 min to exchange the capillary-array unit. Consequently, sequencing operations (300-base reading) can be carried out every 2 h. Since at least six runs per day are possible, a base reading speed of 36 kilobases/day can be achieved. The number of capillaries can easily be increased to more than 100. In addition to this, the DNA fragment migration speed can be increased by optimizing the electrophoresis conditions, as demonstrated by Kostichka in the case of a thin-gel system.’ Consequently, the turnaround time of sequencing operations can be reduced to 1 h for 400-base readings. As pointed out previously, the injection of samples in a capillary-array system is very easy and suitable for automation. In this system, the gel capillary-array unit (upper gel-filled capillaries in Figure 2) is easily changed by removing the used one and replacing it with a new one. Also, the gel
1028 AnalyticalChemistty, Vol. 66,No. 7, April 1, 1994
matrix in the capillaries can be removed and refilled. Thus, it is possible to reuse the capillary-array unit. If the sample insertion, electrophoresis, and capillary-array exchange or gelrecycling operations are automated (this should be achieved in the near future), it will be possible to attain an extremely high throughput of 800 kilobases/day (100 samples, reading up to 400 bases/h, 20 runs/day). For this ultrahigh throughput, the following developments are necessary: a stable gel preparation technique, a disposable capillary-array cassette or technique for recycling gel, and an automated sample insertion method for repeated operation. The analysis of long DNA fragments is one of the major aspects of DNA analysis. The present electrophoresis method can sequence DNA fragments with up to 400 bases, but the difficulty of analysis increases greatly with the size of the DNA fragments. Even in the analysis of c-DNA, it would be nice if it were possible to analyze full-length c-DNA chains, which are from 2 to 10 kilobases in length. Various approaches have been considered, including new DNA sequencing methods, long base reading by electrophoresis, and primer extension methods. Our technique coupled with primer extension using a set of various primers (it is easy to prepare several hundred primer species) will make a big contribution to this subject.
-
ACKNOWLEDGMENT We express our thanks to Professor Mathies and Professor Smith for their helpful discussions about capillary gel electrophoresis, Dr. Baba of Kobe Women’s College of Pharmacy for his valuable advice on gel preparation methods, and Dr. Nagai and Mr. Nishikawa for their helpful discussion on gel electrophoresis and optical detection. Received for review August 16, 1993. Accepted December 15, 1993.’ a
Abstract published in Advance ACS Abstracts, February 1 , 1994.
