Technical Note pubs.acs.org/ac
Multiplexed microRNA Detection Using Lanthanide-Labeled DNA Probes and Laser Ablation Inductively Coupled Plasma Mass Spectrometry Thomas Christian de Bang,* Pratik Shah, Seok Keun Cho, Seong Wook Yang, and Søren Husted Department of Plant and Environmental Sciences, Faculty of Science, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark ABSTRACT: In the past decade, microRNAs (miRNAs) have drawn increasing attention due to their role in regulation of gene expression. Especially, their potential as biomarkers in disease diagnostics has motivated miRNA research, including the development of simple, accurate, and sensitive detection methods. The narrow size range of miRNAs (20−24 nucleotides) combined with the chemical properties of conventional reporter tags has hampered the development of multiplexed miRNA assays. In this study, we have used lanthanidelabeled DNA probes for the detection of miRNAs on membranes using laser ablation inductively coupled plasma mass spectrometry (LA-ICPMS). Three miRNAs from Arabidopsis thaliana were analyzed simultaneously with high specificity, and the sensitivity of the method was comparable to radioactive detection (low femtomol range). The perspective of the developed method is highly multiplexed and quantitative miRNA analysis with high specificity and sensitivity.
M
Northern blotting is a widely used and well-established method, which remains a popular choice for validation of microarray and RNA deep sequencing data. The method is based on separation of RNA according to size using denaturing polyacrylamide gel electrophoresis (dPAGE) followed by electro-blotting and cross-linking of the RNA onto a membrane. miRNA visualization is facilitated by direct hybridization of specifically designed probes carrying a reporter tag. A range of different tags are available, but typically, 32P or digoxigenin (DIG) labeled DNA probes with or without locked nucleic acid (LNA) modifications are used.9−11 In the past decade, major attention has been given to miRNA detection using Northern blotting and this has resulted in improved sensitivity and reduced analysis time, as well as alternatives to radioactive detection.12 Nevertheless, multiplexed analysis, i.e., the detection of several miRNAs in the same sample simultaneously, remains a challenge due to the chemical properties of the reporter tags combined with the narrow size range of miRNAs. Multiplexed detection is desirable because it enables the direct comparison of several miRNAs in 1 analysis, while simultaneously reducing the associated labor and costs. Recently, several analytical approaches for multiplexed protein analysis based on lanthanide-labeled antibodies combined with inductively coupled plasma mass spectrometry (ICPMS) detection have been developed, including laser ablation (LA) ICPMS of Western blot membranes.13,14 Western blotting is the protein based pendant to Northern blotting and is therefore of special interest in this context. Labeling different antibodies with
icroRNAs (miRNA) are small single stranded RNA molecules that act as regulators of gene expression in both animals and plants. The expression levels of individual miRNAs have been associated with cell development, stress adaptation, and several diseases, including cancer. The biogenesis of miRNA is a multistep process involving the transcription of miRNA genes into primary-miRNAs (primiRNAs), which are 0.5−3 kb large hairpin structured RNA molecules. Subsequent processing of the pri-miRNA eventually results in a mature miRNA (20−24 nucleotides) that associates with a multiprotein complex known as the RNA-inducedsilencing-complex (RISC). The RISC complex guides the matured miRNA to complementary messenger RNA (mRNA) sequences which are silenced upon interaction, by either degradation or translational inhibition.1 By comparing the miRNA profiles between samples of different biological states, it is possible to predict target mRNAs that are up or down regulated as a response to cellular events, external stimuli, internal signaling, or the progression of disease.2,3 Elucidating the miRNA expression patterns associated with a given state is typically carried out using untargeted approaches such as RNA deep sequencing or microarray analysis. Subsequent validation of potentially regulated miRNAs is carried out by targeted approaches, such as RNA blotting (herein referred to as Northern blotting), various types of fluorescence and luminescence based assays, or reverse transcription quantitative PCR (RT-qPCR). The former approaches rely on the direct hybridization of a DNA probe complementary to the miRNA of interest, while RT-qPCR is based on amplification of modified cDNA using specific primers.4−8 © 2014 American Chemical Society
Received: May 8, 2014 Accepted: June 19, 2014 Published: June 19, 2014 6823
dx.doi.org/10.1021/ac5017166 | Anal. Chem. 2014, 86, 6823−6826
Analytical Chemistry
Technical Note
Table 1. miRNA Target and Complementary DNA Probe Sequences, the Content of Guanine (G) and Cytosine (C) Nucleotides in Percentage (%), as well as the Lanthanides Used to Label the Individual DNA Probes oligo
sequence (5′−3′)
GC
label
ath-miR160 probe ath-miR166 probe ath-miR172 probe
UGCCUGGCUCCCUGUAUGCCA HS-TGGCATACAGGGAGCCAGGCA-SH UCGGACCAGGCUUCAUUCCCC HS-GGGGAATGAAGCCTGGTCCGA-SH AGAAUCUUGAUGAUGCUGCAU HS-ATGCAGCATCATCAAGATTCT-SH
62
Tm/Dys
62
Tb
38
Ho
probes using a DNA binding column according to the manufacturer’s instructions (QIAquick Nucleotide Removal Kit, Qiagen). Northern Blotting. Target miRNAs (Integrated DNA Technology, Inc.) were mixed with 5 μL of loading buffer (Gel Loading Buffer II, Ambion) and heated to 75 °C for 10 min before the sample mixture was loaded onto a denaturing 15% polyacrylamide gel containing 7.5 M urea (SequaGel UreaGel System, National Diagnostics). Electrophoresis was carried out at 100 V for 2 h (Mini-protean Tetra System, Bio-Rad) in TBE buffer (45 mM Tris-Borate, 1 mM EDTA, pH = 8.0). Subsequently, the miRNAs were transferred onto a positively charged membrane (Hybond-N+, GE Healthcare) using semidry electrophoretic transfer (Trans-blot SD electrophoretic transfer cell, Bio-Rad) at 20 V for 40 min. Following the electrophoretic transfer, the RNA was cross-linked to the membrane by UV irradiation (720 mJ cm −2 ) using a Stratalinker 2400 (Stratagene). After cross-linking, the membrane was placed in hybridization buffer (Ultrahyb Oligo Hybridization Buffer, Ambion) and incubated with either lanthanide or 32γ-ATPradio-labeled DNA probes (Integrated DNA Technology, Inc.) overnight at 37 °C. 32P labeling was performed using a T4 polynucleotide kinase (New England Biolabs) according to the manufacturer’s instructions. Following hybridization, unbound probes were removed by washing membranes 2 times with 20 min intervals in SSC buffer (0.3 M NaCl, 30 mM Na3C6H5O7, pH 7.0) containing 0.1% sodium-dodecyl-sulfate (SDS). Membranes hybridized with radiolabeled probes were exposed to a storage phosphor screen (Amersham Biosciences), and signals were detected using a variable-mode imager (Typhoon Trio, GE Healthcare). Membranes hybridized with lanthanidelabeled probes were analyzed by LA-ICPMS. LA-ICPMS Analysis. Prior to analysis, the Northern blot membranes were dried and fixed to plastic sheets using doubleadhesive tape. Membrane analyses were carried out by a nanosecond laser ablation unit (NWR193, New Wave Research, ESI) using the following settings; laser energy density = 0.50 GW/cm2, repetition rate = 50 Hz, scan speed = 500 μm s−1, and spot size = 150 μm. The membranes were scanned by consecutive lines distanced by 1 mm, and the created aerosol was transported directly to the ICPMS by a constant helium flow (750 mL min−1). Before reaching the plasma, the aerosol was mixed with argon gas (950 mL min−1). The ICPMS (Agilent 7500ce, Agilent technologies) was tuned according to the manufacturer’s instructions, and afterward, voltage settings of the following ion lenses were fixed; extract 1 = −181 V, extract 2 = −187 V, cell entrance = −40 V, and cell exit = −42 V. A lanthanide calibration series was prepared as previously described,13 and the sensitivity of the hyphenated LA-ICPMS setup was optimized by adjusting the following plasma parameters; RF power, sample depth, and carrier gas flow rate. The following mass to charge ratios (m/z) were analyzed using
different lanthanides enables multiplexed and size-independent analysis of proteins on membranes, attractive features if multiplexed miRNA detection on Northern blots is to be realized. In addition, thiol-maleimide chemistry has been used to label oligonucleotides with lanthanides for the detection of DNA using ICPMS.15,16 These DNA detection methods are based on a dual-probe approach, including a lanthanide-labeled reporter probe and a capture probe, designed to hybridize to each end of the target DNA. This ensures that only DNA bound to both probes is detected, thereby minimizing false-positive results. However, the small size of miRNAs (20−24 nucleotides) is not compatible with dual-probe based detection, as the probe sizes required for miRNA hybridization (10−12 nucleotides) are too small to ensure specific target miRNA recognition, hence resulting in random hybridization and falsepositive results. In the current work, we have combined the use of lanthanidelabeled DNA probes with LA-ICPMS to detect miRNAs on Northern blot membranes. The DNA probes used for hybridization had full sequence complementarity to the miRNA targets, thus ensuring high specificity of the assay. miRNA detection was carried out using LA-ICPMS, thereby enabling multiplexed, sensitive, and quantitative analysis.
■
MATERIALS AND METHODS DNA Probes and Synthetic miRNAs. DNA probes complementary to the Arabidopsis thaliana miRNAs, athmiR160, ath-miR166, and ath-miR172 were used throughout the experiments (Table 1). Probes used for lanthanide labeling were modified with thiol groups in the 5′ and 3′ ends (Eurofins MWG Synthesis GmbH). Target miRNA stock solutions of 100 μM were prepared in 50% formamide to protect RNA from degradation. Probe Labeling. DNA probes were resuspended to 100 μM in TE buffer (10 mM Tris-HCl, 1 mM disodium ethylenediaminetetraacetic acid, pH 7.2). Before conjugation reactions, thiol groups were reduced by mixing equal volumes of the probe solution and 1 mM tris (2-carboxyethyl) phosphine hydrochloride (TCEP) dissolved in TE buffer. The lanthanide chelator 1,4,7,10-tetraazacyclododecane-1,4,7-tris(aceticacid)10-maleimido-ethylacetamide (mma-DOTA, Macrocyclics, USA) was dissolved in ammonium acetate buffer (500 mM, pH = 6.7) to a final concentration of 25 mM. Various chlorides of lanthanides (LnCl3) were dissolved to 100 mM in ammonium acetate buffer (200 mM, pH 6.3). Labeling reactions were carried out at room temperature for 30 min after mixing the individual lanthanide solutions with mma-DOTA in 1.25:1 molar ratios. Subsequently, conjugation was carried out by mixing the reduced DNA probes with a 30-fold molar excess of lanthanide-labeled mma-DOTA. The conjugation reaction was carried out for 60 min at 37 °C with gentle agitation. Excess mma-DOTA was removed from the lanthanide-labeled DNA 6824
dx.doi.org/10.1021/ac5017166 | Anal. Chem. 2014, 86, 6823−6826
Analytical Chemistry
Technical Note
an integration time of 0.1 s per element: 31 (phosphorus), 141 (praseodymium), 159 (terbium), 165 (holmium), and 169 (thulium). The elemental composition of every line scan was measured in time-resolved analysis mode and converted into .csv files. The .csv files were compiled to images using Sigma Plot v. 12.
■
RESULTS AND DISCUSSION Three Arabidopsis thaliana miRNAs, ath-miR160, ath-miR166, and ath-miR172, were Northern blotted individually or in a mixture according to standard procedures and hybridized with lanthanide-labeled DNA probes. The labeling procedure was based on thiol-maleimide chemistry, where DNA probes modified with thiol groups in the 5′ and 3′ ends are conjugated with 1,4,7,10-tetraazacyclododecane-1,4,7-tris(aceticacid)-10maleimido-ethylacetamide (mma-DOTA). Before the conjugation reaction, mma-DOTA was labeled with the lanthanide elements, thulium (Tm), terbium (Tb), holmium (Ho), or praseodymium (Pr), thereby allowing ICPMS detection of the miRNA-probe duplexes (Scheme 1). Scheme 1. miRNAs Were Northern Blotted and Incubated with Lanthanide-Labeled DNA Probesa
Figure 1. Detection of ath-miR160 using LA-ICPMS. (a) Calibration curve based on integrated peak areas of the 141Pr peaks from the dilution series: 1.625−25 and 0.1−2 ng of ath-miR160 (inset). (b) 141Pr line scan recorded at 3.13 ng. (c) LA-ICPMS images of the dilution series based on the P and Pr signals, as well as autoradiography (32P) of the 3 lowest ath-miR160 concentrations.
to-noise ratios, whereas the limit-of-detection (LOD) was approached when trying to detect 0.1 ng (Figure 1c). The LOD was calculated on the basis of the calibration curve (b + 3sy) or the standard deviation of the blank values (mean +3σ) and ranged from 0.12 to 0.01 ng of miRNA, respectively, which corresponds to between 18 and 1.5 femtomol. The Pr background present on the membranes solely came from excess Pr present in the probe mixture added in the hybridization step. Thus, improved purification procedures in combination with the newest ICPMS technology to improve general sensitivity will significantly increase the signal-to-noise ratio of the method. In addition, probe labeling with DOTA polymers17 or lanthanide doped polystyrene microspheres18 will increase the sensitivity even further. In this context, these perspectives of the method constitute an important aspect as increased sensitivity will allow for miRNAs present in very low concentrations to be analyzed concomitantly with highly expressed miRNAs. Analysis of 31P and Normalization Strategies. To test whether the P content of the DNA and RNA back bones could be utilized as an indicator of miRNA presence, the m/z = 31 was analyzed concomitantly. In accordance with the 141Pr analysis, 31 P was detected at all the tested levels (Figure 1c) and thus constitutes a general marker for RNA on Northern blots. Noteworthy, many types of RNAs are transferred to the membrane during Northern blotting of biological samples, e.g., the larger miRNA precursors (pri-miRNA and pre-miRNA). In this context, LA-ICPMS may provide a novel and efficient tool to screen populations for mutants deficient in miRNA biogenesis through the combined analysis of 31 P and lanthanide-labeled probes targeting miRNAs and their precursors. If a change in the lanthanide/P ratio between pri-, pre-, or mature miRNA is evident, this would point to a disruption of the mechanisms responsible for miRNA biogenesis. Uneven transfer of RNAs from the dPAGE gel to the membrane per se represents a potential bias of the Northern blot
a
After hybridization and washing, the membrane was analyzed by laser ablation inductively coupled plasma mass spectrometry (LA-ICPMS). The dry aerosol created by LA was transported to the ICPMS for online detection of the lanthanide composition, thereby enabling multiplex detection of miRNAs.
Linearity and Sensitivity. First, different dilution series of ath-miR160 were prepared in duplicates and hybridized with either 32P-labeled or 141Pr-labeled probes. Detection was carried out by either conventional autoradiography or LA-ICPMS, respectively. A serial dilution ranging from 1.625 to 25 ng of athmiR160 was analyzed to investigate the linearity of 141Pr based detection. As seen in Figure 1c, 141Pr enabled ath-miR160 detection at all levels and the corresponding calibration curve showed good linearity with R2 = 0.99 (Figure 1a). A wide linear dynamic range is of special importance for multiplexed analyses of miRNAs, as the concentrations of different miRNAs vary greatly depending on the type and biological state of the tissue being analyzed. Traditional Northern blot detection methods are limited by the dynamic range, whereas LA-ICPMS based multiplexed detection of lanthanides on membranes was shown to have a wider linear range (0.15−24 ng Ln cm−2).13 In biological samples, miRNAs are typically present in the low ng range, and consequently, we prepared a dilution series covering those concentrations, viz., 0, 0.1, 0.5, 1, and 2 ng of RNA per sample, corresponding to between ∼15 and 300 femtomol of miRNA. Both LA-ICPMS and radioactive detection was able to detect 2, 1, and 0.5 ng with good signal6825
dx.doi.org/10.1021/ac5017166 | Anal. Chem. 2014, 86, 6823−6826
Analytical Chemistry
Technical Note
demonstrate that lanthanide-labeled DNA probes, combined with LA-ICPMS detection, enable multiplexed and quantitative detection of miRNAs on Northern blot membranes with high specificity and sensitivity. Considering the number of lanthanide isotopes available in combination with the use of DOTA polymers or lanthanide nanoparticles, the perspective of this methodology is highly multiplexed miRNA analysis with, until now, unseen sensitivity in biological samples.
method. However, using the approach described in this work, uneven transfer can be accounted for by spiking samples with a synthetic miRNA and using the signal from a corresponding lanthanide-labeled DNA probe for normalization. Furthermore, multielement analysis based on LA-ICPMS is prone to variations between different analytical series, and thus, day-today variation in instrument sensitivity needs to be monitored, e.g., using the multilanthanide calibration procedure described by de Bang et al.13 Multiplexed miRNA Detection. Encouraged by the initial analysis of sensitivity and dynamic range, we prepared a blot with 5 ng of the miRNAs, ath-miR160, ath-miR166, and athmiR172, either as individual samples or as a mixture containing equal amounts of the 3 miRNAs. Identical blots were incubated with a mixture of the complementary DNA probes labeled with either 32P or different lanthanides. Using 32P labeling, the 3 miRNAs were detected in the simplex samples, whereas individual signals in the multiplex sample were indistinguishable (Figure 2b). The signal intensity of ath-miR172 was weaker than
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS Financial support from the Danish Strategic Research Council to the project “NUTRIEFFICIENT” (No. 10-093498) and from the Danish Ministry of Science to the “UNIK Centre of Synthetic Biology” and “Centre for Advanced Bioimaging (CAB) Denmark” is gratefully acknowledged.
■
REFERENCES
(1) Poulsen, C.; Vaucheret, H.; Brodersen, P. Plant Cell 2013, 25 (1), 22−37. (2) Esteller, M. Nat. Rev. Genet. 2011, 12 (12), 861−874. (3) Sayed, D.; Abdellatif, M. Physiol. Rev. 2011, 91 (3), 827−887. (4) Balcells, I.; Cirera, S.; Busk, P. K.; BMC Biotechnol. 2011, 11 (70); DOI: 10.1186/1472-6750-11-70. (5) Shah, P.; Rorvig-Lund, A.; Ben Chaabane, S.; Thulstrup, P. W.; Kjaergaard, H. G.; Fron, E.; Hofkens, J.; Yang, S. W.; Vosch, T. ACS Nano 2012, 6 (10), 8803−8814. (6) Shah, P.; Cho, S. K.; Thulstrup, P. W.; Bhang, Y. J.; Ahn, J. C.; Choi, S. W.; Rorvig-Lund, A., Yang, S. W. Nanotechnology 2014, 25 (4), DOI: 10.1088/0957-4484/25/4/045101. (7) Yang, S. W.; Vosch, T. Anal. Chem. 2011, 83 (18), 6935−6939. (8) Shah, P.; Thulstrup, P. W.; Cho, S. K.; Bhang, Y.-J.; Ahn, J. C.; Choi, S. W.; Bjerrum, M. J.; Yang, S. W. Analyst 2014, 139 (9), 2158− 2166. (9) Varallyay, E.; Burgyan, J.; Havelda, Z. Nat. Protoc. 2008, 3 (2), 190−196. (10) Wegman, D. W.; Krylov, S. N. TrAC, Trends Anal. Chem. 2013, 44, 121−130. (11) Kim, S. W.; Li, Z.; Moore, P. S.; Monaghan, A. P.; Chang, Y.; Nichols, M.; John, B. Nucleic Acids Res. 2010, 38 (7); DOI: 10.1093/ nar/gkp1235. (12) Qavi, A. J.; Kindt, J. T.; Bailey, R. C. Anal. Bioanal. Chem. 2010, 398 (6), 2535−2549. (13) de Bang, T. C.; Pedas, P.; Schjoerring, J. K.; Jensen, P. E.; Husted, S. Anal. Chem. 2013, 85 (10), 5047−5054. (14) Waentig, L.; Jakubowski, N.; Roos, P. H. J. Anal. At. Spectrom. 2011, 26 (2), 310−319. (15) Bruckner, K.; Schwarz, K.; Beck, S.; Linscheid, M. W. Anal. Chem. 2014, 86 (1), 585−591. (16) Han, G.; Zhang, S.; Xing, Z.; Zhang, X. Angew. Chem., Int. Ed. 2013, 52 (5), 1466−1471. (17) Lou, X. D.; Zhang, G. H.; Herrera, I.; Kinach, R.; Ornatsky, O.; Baranov, V.; Nitz, M.; Winnik, M. A. Angew. Chem., Int. Ed. 2007, 46 (32), 6111−6114. (18) Abdelrahman, A. I.; Dai, S.; Thickett, S. C.; Ornatsky, O.; Bandura, D.; Baranov, V.; Winnik, M. A. J. Am. Chem. Soc. 2009, 131 (42), 15276−15283.
Figure 2. Multiplexed detection of miRNA by LA-ICPMS. (a) Line scans with ion intensities of the 3 lanthanide labels 165Ho in blue (miR172), 159Tb in red (miR166), and 169Tm in black (miR160) obtained from the 3-plex sample. (b) LA-ICPMS and autoradiography images of individual samples of ath-miR160, ath-miR166, and athmiR172, as well as a mixture (3-plex). The labels used for miRNA detection are indicated to the right.
the ath-miR160 and ath-miR166 signals, which is due to a relatively lower GC content of that miRNA (Table 1). Consequently, the melting temperature (Tm) of the miRNADNA duplex is lower, hence reducing the optimal hybridization temperature required for ath-miR172 detection. Differences in Tm between miRNAs and their complementary DNA probes constitute an important aspect that needs to be addressed in future developments made within multiplexed analysis of miRNAs. LA-ICPMS analysis of the membrane incubated with lanthanide-labeled DNA probes enabled multiplexed analysis of all 3 miRNAs (Figure 2a,b). The analysis revealed a high degree of specificity of the lanthanide-labeled probes, as no crossreactions were evident from the simplex samples (Figure 2b). This was further supported by the triplex chromatogram, where the small peak shifts directly reflect the minor differences observed in the migration patterns (Figure 2b, 32P).
■
CONCLUSIONS The role of miRNAs in regulation of gene expression and their potential as biomarkers in disease diagnostics has spurred the development of new tools for simple, accurate, and sensitive detection of miRNAs. However, multiplexed and quantitative analysis of miRNAs has remained a challenge. In this work, we 6826
dx.doi.org/10.1021/ac5017166 | Anal. Chem. 2014, 86, 6823−6826
