Mussel-Inspired Nanostructures Potentiate the Immunomodulatory

Subscriber access provided by ROBERT GORDON UNIVERSITY

Biological and Medical Applications of Materials and Interfaces

Mussel-inspired nanostructures potentiate the immunomodulatory properties and angiogenesis of mesenchymal stem cells Tao Li, Hongshi Ma, Hongzhi Ma, Zhenjiang Ma, Lei Qiang, Zezheng Yang, Xiaoxiao Yang, Xiaojun Zhou, Kerong Dai, and Jinwu Wang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b22017 • Publication Date (Web): 22 Apr 2019 Downloaded from http://pubs.acs.org on April 22, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Mussel-inspired nanostructures potentiate the immunomodulatory properties and angiogenesis of mesenchymal stem cells Tao Li,1†, Hongshi Ma,1† Hongzhi Ma,2† Zhenjiang Ma,1 Lei Qiang,3 Zezheng Yang,1 Xiaoxiao Yang,1 Xiaojun Zhou,1* Kerong Dai,1* Jinwu Wang.1* 1. Shanghai Key Laboratory of Orthopaedic Implant, Department of Orthopaedic Surgery, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, P.R. of China. 2. Department of Radiation Oncology, Hunan Cancer Hospital and The Affiliated Cancer Hospital of Xiangya School of Medicine, Central South University, Changsha, Hunan, 410006, China. 3. Southwest Jiaotong University College of Medicine, No.111, North Section, 2nd Ring Road, Chengdu, Sichuan, 610031, China. † Tao Li, Hongshi Ma and Hongzhi Ma equally contributed to this work. * Kerong Dai, Jinwu Wang and Xiaojun Zhou are correspondent authors. Tel： +86 15800577039 / +86 13301773680 Fax: +86 (21) 23271699 E-mail: [email protected], [email protected], [email protected]


Page 2 of 43

Page 3 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract The therapeutic effects of mesenchymal stem cells (MSCs)–material constructs mainly come from the secretion of trophic factors from MSCs, especially the immunomodulatory and angiogenic cytokines. Recent findings indicate the significance of topographical cues from these materials in modulating paracrine functions of MSCs. Here, we developed functionalized three-dimensionalprinted bioceramic (BC) scaffolds with a mussel-inspired surface coating in order to regulate the paracrine function of adipose-derived MSCs (Ad-MSCs). We found that Ad-MSCs cultured on polydopamine-modified

BC

scaffolds

(DOPA-BC)

significantly

produced

more

immunomodulatory and pro-angiogenic factors when compared with those cultured on BC scaffolds or microplates. Functional assays, such as endothelial progenitor cells (EPCs) migration and tube formation and macrophage polarization, were performed to confirm the enhanced paracrine functions of the secreted trophic factors from Ad-MSCs cultured on DOPA-BC scaffolds. Further investigation identified that both focal adhesion kinase- and extracellular signal-related kinase signaling were the required mechano-transduction pathways through which the mussel-inspired surface stimulated the paracrine effect of Ad-MSCs. In a diabetic skin-defect-healing model in rats, conditioned medium received from the Ad-MSCs cultured on DOPA-BC sped wound closure, enhanced vascularization, and promoted macrophage switching from a proinflammatory M1 to a pro-healing and anti-inflammatory M2 phenotype in the wound bed. These results demonstrate that a bio-inspired coating with polydopamine represents an effective method to enhance the paracrine function of MSCs. Our findings illustrate a novel strategy to accelerate tissue regeneration by guiding the paracrine-signaling network. Keywords: polydopamine, mussel-inspired surface, adipose-derived mesenchymal stem cells,



paracrine effect, angiogenesis, immunomodulation. 1. Introduction Mesenchymal stem cells (MSCs) were commonly used in tissue engineering due to their special character for self-renewal and multilineage differentiation potential under different stimuli or culture conditions.1 Additionally, their well-known multilineage differentiation potential, MSCs are able to secrete a number of bioactive factors which can influence adjacent cells through paracrine signaling.2 Current researches imply that the therapeutic benefits of MSCs might substantially result from the paracrine functions rather than the multipotency.3-8 Many bioactive factors, including vascular endothelial growth factor (VEGF), insulin-like growth factor (IGF), fibroblast growth factor (FGF), interleukins (ILs), matrix metalloproteinases (MMPs), hepatocyte growth factor (HGF), and platelet-derived growth factor (PDGF), can be secreted by MSCs.8-11 These factors take part in many biological processes in the field of tissue regeneration, such as immunoregulation, vascularization, cell recruitment and differentiation.12-13 More evidences also indicate that the therapeutic effect after MSCs transplantation might mainly originate from the paracrine effects and trophic function.14 Therefore, the new strategies to improve the secretory profile of MSCs have been tried for an increasing number of researchers, including preconditioning under hypoxic conditions, genetic regulatory, cytokine induction and so on.15-16 However, up to now, there is little information regarding how tissue engineering affects the paracrine secretion of MSCs. Scaffolds are key components in tissue engineering and act as a substrate for cells attachment and growth.17 Because of the unique physical and chemical properties of scaffolds, they show the ability to generate a tailored microenvironment capable of guiding cell behavior based on cell–material interactions.18 Recently, increased attention has focused on the effects of biomaterial properties on


Page 4 of 43

Page 5 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the paracrine behavior of MSCs, especially concerning material-topographical features.18-21 Su et al. reported that fibrous topography of electrospun scaffolds significantly promoted pro-angiogenic and immunomodulatory cytokines secretion from adipose-derived (Ad)-MSCs.18 Furthermore, Wan at al. identified that fiber orientation regulated the paracrine activity of MSCs (especially their immunomodulatory function) through both focal adhesion kinase (FAK)/extracellular signal-related kinase (ERK) and Yes-associated protein/transcriptional coactivator with a PDZ-binding domain (i.e., YAP/TAZ) signaling.21 Additionally, Valles et al. found that MSCs cultured on threedimensional (3D) topographical substrates could produce the anti-inflammatory proteins prostaglandin E2 (PGE2) and tumor necrosis factor-inducible gene 6 (TSG-6) as compared with cultured on two-dimensional substrates.20 These observations suggest that surface modifications that allow specific changes in cell morphology represent an effective method to promote the paracrine effect of MSCs in tissue engineering. Based on the above results, we speculate that controllable and cost-effective manufacturing procedures are required to regulate the paracrine function of MSCs. It has been more than 10 years since the identification of polydopamine (PDA) as a novel material, with this discovery accompanied by its global significance and extensive utilization in scientific research.22 Due to the favourable biocompatibility and biodegradability, PDA exhibits great potentials for tissue engineering applications.23-24 Previous studies demonstrated that PDA effectively increases the roughness and hydrophilicity of biomaterial surfaces and modulates specific biological activities, such as cell proliferation and differentiation.25-26 Recently, several groups reported that PDA enables biomaterials to exert novel functions, which were closely related to the paracrine functions of MSCs. For instance, Lin et al. demonstrated that FAK/ERK signaling



and their respective phosphorylation, one of the paracrine effects related mechano-transduction pathway, were activated when human Ad-MSCs cultured on poly(lactic acid) scaffolds modified with PDA. Meanwhile, upregulated levels of angiopoietin 1 (Ang-1) and von Willebrand factor (vWF) proteins were observed upon increasing PDA content.27 Li et al. reported that exosomes immobilized on poly(lactic-co-glycolic acid)/PDA materials released their cargo slowly and consistently and promoted bone regeneration.28 In addition to these findings, PDA used as a biocompatible layer has been reported to regulate the immune microenvironment of biomaterials. Hong et al. showed that PDA coating greatly reduced the inﬂammatory and immunological responses of biomaterials.29 Zhang et al. demonstrated that inflammation, M1 macrophage polarization, and activation of nuclear factor-kappaB (NF-kB) signaling were significantly inhibited on PDA-pretreated titanium relative to these activities observed on pure titanium.30 These novel functions of PDA describe roles in immune modulation and angiogenesis; however, whether these effects of mussel-inspired nanostructure surfaces involving PDA management through the paracrine function of MSCs were unknown. We previously reported fabrication of 3D-printed polydopamine-modified bioceramic (DOPABC) scaffolds with a uniformly mussel-inspired nanostructured surface that supported cells attachment and proliferation.31 Here, we used DOPA-BC as a model scaffold material to test the effects of the mussel-inspired nanostructured surface on promoting the production of pro-angiogenic and anti-inflammatory factors from rat Ad-MSCs. The functions of these secreted factors were investigated by collecting conditioned medium (CM) and co-culturing with endothelial progenitor cells (EPCs) and macrophages, and treatment on a diabetic skin-wound-healing model. Furthermore, the blocking assays were performed to study the role of substrate-microenvironment-mediated cell–


Page 6 of 43

Page 7 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


material interactions in modulating paracrine behavior of MSCs. The findings suggested that the mussel-inspired nanostructured surface profoundly affected the secretory behavior of Ad-MSCs, producing cytokines which could promote the angiogenesis, immunoregulation, and tissue regeneration. The finding of a close relationship between MSCs paracrine effect and topographical cues of biomaterials shows a new perspective of biomaterial performance not previously studied systematically. Additionally, these results suggested a powerful strategy to manage the paracrinesignaling network through the fabrication of biomaterials with functional surfaces in order to facilitate MSCs-based regenerative therapy.

2. Materials and methods 2.1. Materials Tetraethyl orthosilicate, triethyl phosphate, and Ca(NO3)2 · 4H2O were received from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Matrigel was provided from BD Biosciences (San Jose, CA, USA). Sodium alginate was obtained from Alfa Aesar (Haverhill, MA, USA). Pluronic F-127 and lipopolysaccharide (LPS) were received from Sigma-Aldrich (St. Louis, MO, USA). The QuantiTTM PicoGreen® dsDNA assay kit and TRIzol kit were received from Invitrogen (Carlsbad, CA, USA). The murine macrophage cell line RAW264.7 was obtained from the Shanghai Institute for Biological Science, Chinese Academy of Science (Shanghai, China). 2.2. Cell culture Both Ad-MSCs and EPCs were derived from Sprague-Dawley rats.32, 33 Ad-MSCs were maintained in MEM-α containing 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin. EPCs were maintained in endothelial cell medium (ECM) containing 5% FBS,



penicillin/streptomycin solution, and 1% endothelial-cell growth supplement. RAW264.7 macrophages were maintained in complete DMEM medium. Ad-MSCs and EPCs between passage three and five were used for subsequent experiments. The analysis for the authenticity of Ad-MSCs was performed with Oil red O staining and flow cytometry. 2.3. Fabrication of DOPA-BC scaffolds BC powders (NAGEL, Ca7Si2P2O16) were prepared via a sol-gel method.31 Then the BC ink was obtained by the mixing of BC, sodium alginate and Pluronic F-127 in aqueous solution.25 After stirring to homogeneity, the mixture was printed using a 22G needle, followed by treating with sintering to obtain the final BC scaffolds. The coating of PDA nanolayers on DOPA-BC scaffolds was prepared by soaking in dopamine hydrochloride Tris-HCl (pH 8.5) (4 mg/mL) solution for 3 days, followed by drying at 40 °C overnight. The surface microstructure of samples was observed by scanning electron microscopy (SEM, HITACHI SU8220, Japan). Attenuated total reflectanceFourier transform infrared (ATR-FTIR) spectra were conducted on a Nicolet 6700 spectrometer (Thermo, USA). X-ray diffraction (XRD) patterns were recorded using a D/MAX-2550PC (Rigaku Inc., Japan) diffractometer with the Cu Kα radiation. 2.4. Confocal imaging Briefly, Ad-MSCs were cultured on scaffolds at 2 × 104 per well for 24 h. Then the cells were fixed with 4% paraformaldehyde (PFA) and treated with Rhodamine–Phalloidin (Thermo Fisher Scientific, USA) to stain the F-actin for 1 h and incubated with DAPI (Thermo Fisher Scientific, USA) to stain the nucleus for 5 min in turn. The resultant samples were examined by confocal observation (Leica, Japan). 2.5. Cell proliferation and metabolic assays


Page 8 of 43

Page 9 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For cell viability investigation, 1 mL Ad-MSCs suspension at a concentration of 2 × 104 cells/mL were added into tissue culture plates (TCP), pure BC, and DOPA-BC scaffolds in 24-well plates. The culture medium was changed every day. After 6, 12, 24, 48, 72, and 96 h of culture, the viabilities of Ad-MSCs were assessed using a Cell Counting Kit-8 (CCK-8) method. Metabolic activities were analyzed by MTS assay. The supernatant was taken out and supplemented with 100 μL medium containing 20 μL of CellTiter96 aqueous one solution (Promega, USA). The optical density (OD) values of the supernatant were monitored at 490 nm with a microplate reader device after stored for 2 h in dark at 37 °C. The metabolic activity was expressed as the measured absorbance relative to the cell number, which indicated the single-cell level. 2.6. Evaluation of paracrine behaviors Ad-MSCs was seeded on TCP, pure BC, and DOPA-BC scaffolds in 24-well plates at a density of 1 × 105 cells/well. The scaffolds were transferred to new plates where the cells attached to the scaffolds were counted after a 1 h incubation. To obtain the CM after 24 h of culture with FBS-free MEM- medium, the same procedure was performed according to the previous study.18 The number of remaining cells on the TCP or scaffolds was counted through the DAPI staining using image J software. The consistent concentration of CM relative to the same number of cells in each sample was ensured by adjusting with MEM-α. Enzyme-linked immunosorbent assays (ELISAs) targeting the immunomodulatory factors PGE2, cyclooxygenase (COX)-2, TSG-6, transforming growth factor (TGF)-, IL-1ra, monocyte chemoattractant protein (MCP)-1, and the angiogenic factors VEGF, basic (b) FGF, HGF, and Ang-1 in CM were carried out according to manufacturer instructions (R&D Systems). Furthermore, total RNA of the above mentioned factors from the AdMSCs was extracted to determine the relevant gene expression by real-time quantitative polymerase



chain reaction (RT-PCR). 2.7. Gene expression profiling and polarization of LPS-induced macrophages 2 × 105 RAW264.7 cells per well were planted into 24-well plates for 24 h, and then the medium was replaced with 500 ng/mL LPS for macrophage stimulation. One hour later, the supernatants were completely taken out, and cells were rinsed with Dulbecco's phosphate-buffered saline (DPBS) three times. After that, the cells were incubated with DMEM medium containing 50% v/v CM for 8 h. Total RNA in each sample was extracted and measured by RT-PCR to determine the relevant gene expression. Samples supplemented with LPS alone served as positive controls. Immunofluorescence staining was carried out to identify the polarization of macrophages. The cells were double-stained with antibodies of anti-CD206 (rabbit anti mouse, Alexa Fluor® 488, ab195191, Abcam) and iNOs (rabbit anti mouse, Alexa Fluor®647, ab209027, Abcam). Nuclei were counterstained with DAPI. Images were captured with a confocal microscope. The intensity of CD206+ cells and iNOs+ cells were counted for semiquantitative analysis. 2.8. EPCs migration and tube-formation assay The chemotactic effects of different CM on EPCs migration were investigated using the Transwell system with membranes having an 8-µm pore size. EPCs were introduced into the inserts at 4.5 × 105 cells/cm2 and supplemented with fresh medium. After incubation for 1 h, culture medium was replaced with appropriate CM. The migrated cells were qualitatively observed by Crystal Violet staining. The quantitative analysis was realized through solubilizing the Crystal Violet using 33% acetic acid solution. The absorbances of the solution were detected at 570 nm using a microplate reader. For EPCs tube-formation assays, EPCs were introduced onto Matrigel films at a density of 1 × 104 in 96-well plates and incubated with ECM medium containing 50% v/v CM. After 4 h of


Page 10 of 43

Page 11 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


culture, tubes were imaged under bright-field microscopy, and the number of branch points and tube lengths were quantified by ImageJ software from five random views in each sample. 2.9. Western blot analysis The protein lysate from each sample was collected and loaded on gel electrophoresis according to previous study.21 The following primary antibodies for western-blot were applied: anti-phosphoFAK(Tyr397) (1:1000, SAB4504403, Sigma-Aldrich), anti-phospho-FAK(Tyr925) (1:1000, #3284, Cell Signaling Technology), anti-protein tyrosine kinase-2 (1:1000, SAB4300418, Sigma-Aldrich), anti-p44/42 MAPK (ERK1/2) (1:1000, #9102, Cell Signaling Technology), and anti-phosphorylated p44/42 MAPK (ERK1/2) (1:2000, #4370, Cell Signaling Technology). After the primary antibodies and the corresponding horseradish peroxidase-conjugated secondary antibody (1:10,000, Sungene Biotech, China) treatment, the achieved protein bands were imaged and captured on an enhanced chemiluminescence detection system. The 3-phosphate glyceraldehyde dehydrogenase (GAPDH) was used for normalization to quantify the intensities of target bands. The involvement of FAK and ERK1/2 in the regulation of PDA-associated Ad-MSCs paracrine effects was verified using small molecular inhibitors treatment for 48 h before further testing, including PF573228 (10 µM, SigmaAldrich) and PD98059 (50 µM, Tocris Bioscience). 2.10. Diabetic animal model of full-thickness wound-healing All animal-related procedures were approved by the Animal Care and Experiment Committee of Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine. The diabetic models on Sprague–Dawley rats with 7-mm diameter of full-thickness skin defects were established as reported previously.19 A total of 24 diabetic rats were randomly divided into four groups (Blank, TCP, BC, and DOPA-BC). The collected CM samples from MSCs-TCP, MSC-BC, MSC-DOPA-



BC, or Blank MEM-α culture were concentrated (~30 fold) by ultrafiltration. Each wound was then treated with 200 μL CM solution, with 150 μL solution injecting subcutaneously around the defect and 50 μL solution smearing onto the wound bed. The digital images were captured at days 0, 7, and 14, and the wound area were determined using ImageJ software. The percentage of wound closure was calculated as follows: [(area of original wound − area of actual wound) / area of original wound] × 100%. To assess newly formed blood vessels, the tissues surrounding the wounds (2 × 2 cm) after 13-days surgery were collected. The vascular-infiltration status of samples was captured by digital camera (Leica, Germany), followed by quantification of the number of vessels. 2.11. Histological analysis and immunofluorescence staining The sections for the collected tissue were prepared, and then treated with Hematoxylin and Eosin (H&E) and Masson trichrome staining, immunofluorescence staining of CD31, as well as immunofluorescence staining of CD68 and CD206 for macrophages polarization analysis. The detailed procedures were included in Supporting Information. 2.12. Statistical analysis The obtained data are expressed as mean ± standard deviation (SD). The statistical significance was considered at P < 0.05, P < 0.01, and P < 0.001. One-way analysis of variance was used for statistical analysis, followed by a least significant difference post-hoc test to compare selected data pairs.

3. Results 3.1. Scaffold characterization and biocompatibility BC scaffolds with specific composition (Ca7Si2P2O16) were first fabricated by a 3D-printing method. SEM characterization of the microstructures revealed a uniform nanolayer on the surface of the


Page 12 of 43

Page 13 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DOPA-BC scaffold (Fig. 1A-b1–b4), whereas the pure BC scaffold showed a smooth surface without nanostructure (Fig. 1A-a1–a4). The FTIR (Fig. S1) showed that compared with pure BC scaffold, the new peaks around 1400 and 1500 cm-1 attributing to bending vibration of phenyl and C=C stretching vibration were observed in the DOPA-BC scaffold, indicating the successful modification of PDA on BC scaffold. The XRD patterns of the DOPA-BC and BC scaffolds are shown in Fig. S2. It was significant that the NAGEL characteristic peaks existed in the patterns for both the BC and DOPA-BC scaffolds. However, the intensity of the characteristic peaks in DOPABC scaffold was much lower than that in BC due to the coating of PDA. The microscopic images demonstrated that Ad-MSCs presented the long spindle-shaped and fibroblast-like morphology (Fig. S3-A). After 3 weeks of adipogenic induction, Oil red O staining showed abundant red spots in cell (Fig. S3-B). Flow cytometry showed that Ad-MSCs had high expressions of mesenchymal markers CD29 (91.14%) and CD90 (93.70%) and a low expression of hematopoietic cell surface markers CD45 (0.4%) (Fig. S4). These results suggested that Ad-MSCs were the mesenchymal stem cells. Facilitation of cell adhesion on the PDA layer was confirmed by immunofluorescence imaging (Fig. 1B). In the TCP group, Ad-MSCs demonstrated a typical spread morphology (Fig. 1B), but the filopodia extensions of the Ad-MSCs were more prominent in the BC group as compared with the TCP group. On the DOPA-BC scaffolds, the Ad-MSCs were relatively elongated with more extensive pseudopodia formation relative to that observed in the other groups. The results of cell proliferation showed that Ad-MSCs maintained a high degree of viability, with no statistical difference among these groups for at least 4 days culture (Fig. 1C). The metabolic activity of the Ad-MSCs indicated that the cells cultured on the DOPA-BC scaffolds showed higher metabolic levels than those on BC scaffolds or on TCP during the first 6 h of incubation; however, upon



prolonging the incubation period, the metabolic levels of Ad-MSCs on DOPA-BC scaffolds or BC scaffolds were decreased and were close to that cultured on TCP after 96 h of culture (Fig. 1D). 3.2. Paracrine factors expression in Ad-MSCs in Ad-MSCs The mRNA expression and cytokines production of paracrine factors relevant to inflammation and angiogenesis in Ad-MSCs seeded on three different substrates (named as: TCP-CM, BC-CM, and DOPA-BC-CM) were characterized with RT-PCR and ELISA (Fig. 2). In general, the trends found in the analytical results were consistent, with higher levels of almost all cytokines detected in DOPA-BC-CM compared with those in TCP-CM or BC-CM. To test the immunomodulatory properties of Ad-MSCs, we evaluated the production of immunomodulatory factors, such as COX2, PEG-2, TSG-6, MCP-1, TGF-β, and IL-1 receptor antagonist (IL-1ra). Among these factors, upregulation in COX-2, PEG-2, and TSG-6 mRNA levels were the most pronounced at ~11.7-, ~60.2-, and ~10.1-fold higher in the DOPA-BC group in comparison with those in the TCP group, respectively (P < 0.001) (Fig. 2A). Additionally, protein levels for the above three factors were ~10.2-, ~31.1-, and ~12.2-fold higher in the DOPA-BC group relative to those in the TCP group, respectively (P < 0.001) (Fig. 2C). Moreover, the levels of IL-1ra, TGF-β, and MCP-1 in Ad-MSCs increased gradually, resulting in ~3.1-, ~1.8-, and ~2.6-fold higher levels of mRNA (Fig. 2A) and ~3.6-, ~2.1-, ~3.3-fold higher levels of protein in the DOPA-BC group relative to those in the TCP group (Fig. 2C), respectively (P < 0.001). Interestingly, the expression of these factors was also upregulated in the BC group relative to the TCP group, specifically COX-2, PEG-2, and TSG-6 levels, which showed statistical differences. For the angiogenic factors, mRNA or protein levels of VEGF, bFGF, HGF, and Ang-1 were statistically higher in the DOPA-BC group, with ~2.9-, ~3.7-, ~9-, and ~9.1-fold higher mRNA levels (Fig. 2B) and ~4.1-, ~2.5-, ~5.8-, and ~4.5-fold higher


Page 14 of 43

Page 15 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


protein levels relative to those observed in the TCP group (Fig. 2D), respectively (P < 0.001). These results indicated that scaffolds with a mussel-inspired nanostructured surface strongly modulated the secretion of cytokines relevant to inflammation and angiogenesis in MSCs. 3.3. The paracrine functions of Ad-MSC in vitro To investigate the anti-inflammatory and pro-angiogenic functions of the secreted factors from AdMSCs, CM from Ad-MSCs seeded on various matrices were harvested for cultures of macrophages and EPCs. Immunofluorescence staining demonstrated that the expression of CD206 (an M2 marker) was most prominent in the DOPA-BC-CM group, followed by levels observed in the BC-CM and TCP-CM groups, and was lowest in positive controls. By contrast, levels of inducible nitric oxide synthase (iNOs; an M1 marker) showed the reverse trend in all four groups (Fig. 3A). The quantification of immunofluorescence intensity confirmed this observation, with ~0.09-fold (iNOs) and ~13.9-fold (CD206) increases in signal intensity in the DOPA-BC-CM group as compared with that in the positive control (Fig. 3B). In addition, the expression of mRNA associated with the antiinflammatory factors (Arg-1, IL-10, and IL-1ra) was dramatically upregulated in the DOPA-BCCM group in comparison with the other three groups (Fig. 3D), whereas mRNA levels of proinflammatory factors (TNF-α, IL-1β, and IL-6) showed a reverse trend (Fig. 3C). To determine whether the paracrine factors secreted by the Ad-MSCs affected EPCs function, we conducted Transwell and tube-formation assays. Transwell assays indicated that the number of EPCs migrating to the lower chambers in the DOPA-BC-CM, BC-CM, and TCP-CM groups was ~5.2-, ~2.9-, and ~1.8-fold higher than that in the control group (Fig. 4A and C). Moreover, tube-formation assays showed the formation of various degrees of vessels by EPCs loaded onto Matrigel and cultured with different types of CM. The branch points of the tubes in the DOPA-BC-CM group were statistically



higher than those in the BC-CM group, which also showed a higher number of branch points relative to those in the TCP-CM group and the blank control (Fig. 4B and D). Similarly, the average length of the newly developed vessels in the DOPA-BC-CM group was much longer than that of the other groups (Fig. 4B and E). These results demonstrated that the trophic effects of the CM derived from Ad-MSCs in DOPA-BC group resulted in improved vascularization and immunomodulatory capabilities. 3.4. Involvement of FAK-signaling pathway As a vital part of mechano-transducing factors, FAK takes part in a lot of core signal pathways that modulate cellular activities to external mechanical stimulations. Thus, western blot analysis was carried out to examine the activation of FAK. FAK is stimulated via autophosphorylation at Tyr397 upon integrin activation. The results showed that both FAK and its phosphorylation at Tyr397 were statistically enhanced in Ad-MSCs from DOPA-BC group (Fig. 5A). Quantitative analysis demonstrated that the quantification of FAK and phospho-FAK (Tyr397) in Ad-MSCs cultured on DOPA-BC were 1.7- and 1.5-fold higher and 3.3- and 2.1-fold higher, respectively, than in those in the BC and TCP groups (P < 0.01) (Fig. 5A). FAK phosphorylation at Tyr397 improves the binding of Src-family protein-tyrosine kinases and formation of an activated FAK-Src complex, which allows further phosphorylation of FAK at Tyr925. As anticipated, the levels of phospho-FAK (Tyr925) were up-regulated in Ad-MSCs cultured on DOPA-BC (Fig. 5A). The phosphorylation of FAK at Tyr925 provides a binding site for the adapter protein growth factor receptor-bound protein 2, which exists in complex with the Son of Sevenless protein (SOS) and potentially connects FAK to the Ras/MAPK cascade. Therefore, we examined levels of the MAPK family member ERK1/2, findings that DOPA-BC promoted the activation of ERK1/2 and its phosphorylation at


Page 16 of 43

Page 17 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Thr202/Tyr204 in Ad-MSCs (Fig. 5A). Quantitative analysis demonstrated that the expression of ERK1/2, phospho-ERK1 (Thr202/Tyr204), and phospho-ERK2 (Thr-202/Tyr204) in Ad-MSCs cultured on DOPA-BC was 1.5-, 1.7-, and 1.3-fold higher and 2.4-, 5.0-, and 1.3-fold higher, respectively, than that observed in the BC and TCP groups (P < 0.01) (Fig. 5A). These findings suggested that mussel-inspired structures stimulated FAK/ERK1/2 signaling in the Ad-MSCs cultured on DOPA-BC. To further investigate the influence of the FAK-signaling pathway on the improved immunomodulatory features of the Ad-MSCs cultured on DOPA-BC, we studied the mRNA expression of several major immunomodulatory factors in Ad-MSCs from different groups after suppression of FAK and ERK1/2. After confirmation that phospho-FAK (Tyr397) and phospho-ERK1/2 (Thr202/Tyr204) were effectively suppressed by inhibitors PF573228 and PD98059, respectively (Fig. 5B and C), we observed that the gene expression of PEG-2, COX-2, and TSG-6 was significantly reduced after either FAK or ERK1/2 was inhibited (Fig. 5D). Additionally, suppression of either FAK or ERK1/2 dramatically decreased the mRNA levels of the angiogenic factors VEGF, bFGF, HGF, and Ang-1 (Fig. 5E). These results indicated that FAK signaling might take part in modulating the regulation of mussel-inspired nanostructures, which altered the immunomodulatory properties of Ad-MSCs. 3.5. Effect of Ad-MSC paracrine products on diabetic wound healing in vivo In order to assess the in vivo effect of the paracrine factors from Ad-MSCs stimulated by the musselinspired nanostructured surface, CM from each group were collected and applied to treat a skindefect wound in diabetic rats. In all four groups, the skin wounds appeared to heal, with the highest wound-healing rate observed in rats treated with DOPA-BC-CM. Quantitatively, the percentage of the remaining wound area was 7.1% ± 3.4% at days 14 in the DOPA-BC-CM group, whereas these



regions constituted ~15.2 ± 6.6%, ~21.2 ± 11.3%, and ~31.8 ± 7.2% in the BC-CM, TCP-CM, and Blank groups, respectively (Fig. 6A and B). To assess in vivo tests concerning diabetic skin-wound closure processes, representative images of the angiogenic state of the wound bed at 14 days demonstrated that the newly formed capillary network around the excisional regions was most intense in the DOPA-BC-CM group as compared with that in the BC-CM, TCP-CM, and Blank groups (Fig. 6A, C). Additionally, H&E staining showed that at day 14, full epithelialization was obtained in the wounded area in the DOPA-BC-CM and BC-CM groups, whereas partial wound defects remained in the TCP-CM group (Fig. 7A). As for the Blank group, the length of the wound defect was much longer relative to that observed in the other three groups. The results of Masson's trichrome staining were consistent with H&E-staining results (Fig.7A and B). Moreover, the area of the dermal layer in the DOPA-BC-CM group contained a higher amount of collagen deposition that was arranged in a fine reticular pattern and resembling normal dermal tissue (Fig. 7B). Furthermore, appendage-like structures were visible and abundant in the DOPA-BC-CM group, whereas fewer of these structures were observed in the BC-CM group. By contrast, the Blank (MEM-α) and TCP-CM groups displayed distinct decreases in the length and thickness of newly formed epithelium at 14 days along with less collagen deposition and no appendage-like structures (Fig. 7A and B). H&E staining revealed more vascular-like structures in the DOPA-BC-CM group relative to those observed in the BC-CM group, which harbored considerably more vessels as compared with the TCP-CM and Blank groups (Fig. 7A and D). As expected, significantly higher levels of CD31 were expressed in the DOPA-BC-CM group relative to the other groups (Fig. 7C and E). In diabetic wound healing, macrophages play a significant part in intercellular communications to regulate inflammatory and regenerative processes. We performed double-


Page 18 of 43

Page 19 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


labeling immunofluorescence staining (CD68, a pan-macrophage marker; CD206, an M2 marker) in order to assess the polarization of macrophages within the defect area. As shown in Figure 8, all four groups showed various degrees of positive staining for M1 macrophages and M2 macrophages. In particularly, the expression of CD68 was statistically higher in the Blank group compared with that observed in the other three CM groups, indicating infiltration of a higher number of macrophages into the wound defect. Furthermore, the CD206 levels in the BC-CM and DOPA-BCCM groups, and especially in the DOPA-BC-CM group, were considerably higher than those in MEM-α or TCP-CM groups (Fig. 8A). Quantitative analyses of the total macrophages (CD68+) in

the Blank, TCP-CM, BC-CM, and DOPA-BC-CM groups revealed values of 1338 ± 175/mm2 and 867 ± 113/mm2 for the Blank and TCP-CM groups, respectively (Fig. 8B), with further decreases in the total number of macrophages observed in the BC-CM and DOPA-BC-CM groups (430 ± 105/mm2 and 457 ± 102/mm2, respectively). Moreover, the ratio of M2/M1 in the DOPA-BC-CM group increased to 44.6 ± 5.6%, which was significantly higher than that in the Blank (17.0 ± 2.6%), TCP-CM (21.6 ± 3.5%), and BC-CM (30.6 ± 5.8%) groups (Fig. 8C).

4. Discussion MSCs have been studied for decades in tissue-engineering applications due to their regenerative potential.18 Recently, it has been proved that the trophic factor secretion, namely the paracrine effects, rather than directly differentiating into new tissues is the major effective therapeutic function of MSCs in cell therapy, where the MSCs answer to specific regional microenvironment of damaged host tissue.1, 34 Among those paracrine actions, the regulation of macrophage-phenotype polarizing to M2 and angiogenesis play extremely crucial roles in tissue engineering and have been



attracting growing attention.35-36 As significant modulators of the foreign object rejection against tissue-engineered implants, macrophages are model cells to evaluate the immune response. In answer to different local microenvironments, macrophages from surrounding host tissues can be phenotypically and functionally switched into two varied subtypes [proinflammatory form M1 or anti-inflammatory form M2] from primary macrophages (M0).37 Characterized by high expression and secretion of proinflammatory cytokines, M1 macrophages, play an significant role in clearance of intracellular pathogens and initiate inflammation.38 By contrast, M2 macrophages, crucial immune cells to the relief of inflammation and the acceleration of tissue remodeling, are related to relative high levels of anti-inflammatory cytokines.39 Phenotype of macrophages could be switched under specific circumstances, and a study showed that a punctual and accurate phenotype shift from the macrophage subtype M1 to M2 induced by surrounding microenvironment was a key aspect of tissue remodeling.40 In tissue engineering, increasing evidence implicated that the topographical cues of scaffolds influence the immunomodulatory properties of MSCs in a great extension. Similarly, a previous study showed that a PDA coating benefits the transition of macrophages cultured on materials from M1 to M2, with this transition connected with the downregulation of inflammatory factors and the upregulation of anti-inflammatory factors.30 In the present study, we found that CM from Ad-MSCs cultured on DOPA-BC significantly promoted the expression of M2polarized factors (CD206, IL-10, IL-1ra, and Ang-1) and suppressed the expression of M1-polarized factors (TNF-α, IL-1β and IL-6). Immunofluorescence staining confirmed the switch in macrophage from phenotype M1 to M2 induced by CM from the DOPA-BC group. This transition might be closely associated with the enhanced secretion of major factors, such as COX-2, PEG-2, and TSG6, participating in the immunomodulatory function of MSCs. PEG-2 is a key factor involved in


Page 20 of 43

Page 21 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


upregulating the secretion of IL-10 while inhibiting the inflammation process by downregulation of inflammatory cytokines, including TNF-α and IL-12.41-42 Our previous study found that bonemarrow-derived stem cells alleviated inflammation triggered by high-dose laponite via the enhanced expression of PEG-2, which was realized following M2 macrophage polarization and reduced inflammation.43 In the current studies, we observed significantly elevated PEG-2 expression in AdMSCs cultured on DOPA-BC relative to levels in the BC or TCP group. COX-2 is generated from arachidonic acid and represents an essential enzyme involved in PGE2 synthesis.44 We found that COX-2 levels were upregulated in Ad-MSCs cultured on DOPA-BC. Additionally, TSG-6, another factor involved in attenuating inflammation by decreasing Toll-like receptor-2/NF-kB signaling pathway in resident macrophages,45 showing a similar elevated trend in the DOPA-BC group. Our confirmation of increased levels of these factors in Ad-MSCs cultured on DOPA-BC suggested that mussel-inspired nanostructures could significantly benefit the immunomodulatory efficacy of AdMSCs. Angiogenesis is a key step in tissue regeneration and required to supply adequate nutrients, oxygen, and circulating progenitor cells to injured tissues.46 Angiogenesis represents a primary consideration when assessing the trophic effect of MSCs. During this study, we applied EPCs as a representative angiogenic progenitor cell predominantly due to their being precursors of vascular endothelial cells and capability to develop and differentiate into peripheral blood cells and blood vessels.47 Previous studies reported that in diseased microenvironments, such as those involving diabetes, osteoporosis, or systemic sclerosis, EPCs proliferation, recruitment, and angiogenesis are greatly impaired, possibly due to a decreased expression of angiogenic growth factors, for instance, VEGF, Ang-1, and their receptors.17,

48

Additionally, factors secreted by MSCs tend to



synergistically conduce to tissue repair and regeneration via the modulation of endogenous progenitor cells functions. Our observations indicated that DOPA-BC-CM stimulated greater secretion of VEGF, Ang-1, HGF, and bFGF from Ad-MCSs. Among these factors, VEGF and Ang1 levels were more prominent than the other angiogenic factors. Increased levels of VEGF might activate MMP-9, which cleaves and excites Kit ligand (SCF) and in turn induces EPCs proliferation and migration.49 Ang-1, as one of the most effective growth factors involved in EPCs recruitment, was reported to enhance the neovascularization and to accelerate re-epithelialization of excisional wounds in diabetic models.50 In the present study, the increased secretion of angiogenic factors correlated with the observed in vitro functions of EPCs (cell migration and tube formation), as well as their in vivo activities assessed by gross visualization of wound healing and histological examination. These results indicated that DOPA-BC-CM stimulated increased EPCs proliferation, metabolic activity, migration, and angiogenesis, which are closely related to the wide-ranging paracrine effects of Ad-MSCs. Many signal pathways have been implied in modulating the paracrine function of MSCs. For example, hypoxic preconditioning has been demonstrated to enhance the paracrine effects of MSCs through HIF-1α-GRP78-Akt axis.51 Toll-like receptors and chemokine receptor 4 (CXCR4) have also been reported to be upregulated when MSCs in three-dimensional cultures with enhanced paracrine effects.52 Besides, assembly of MSCs into spheres triggered caspase-3 dependent IL1 signaling and the secretion of modulating factors of inflammation and immunity.53 To explore the potential underlying mechanisms related to the effects of mussel-inspired nanostructures on the immunomodulation of Ad-MSCs, we first examined the FAK-signaling pathway. FAK signaling reportedly mediates multiple cellular responses according to the physical cues from different


Page 22 of 43

Page 23 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biomaterials.45,

54-55

Under certain mechanical stress, FAK has been directly associated with

regulation of COX-2 transcription in human periodontal ligament cells,56 and another study found that PDA coating activates FAK via autophosphorylation to consequently influence the spreading, proliferation, and differentiation of human MSCs.57 Therefore, it is rational to speculate on the possible function of FAK signaling in mediating the immunomodulation of Ad-MSCs via PDAcoated biomaterials. In accordance with previous studies, it was shown that FAK and its phosphorylation at Tyr397 and Tyr925 in Ad-MSCs were remarkably upregulated when cultured on DOPA-BC. Through administration of the FAK inhibitor PF573228, FAK signaling pathway was further proved to be involved in the regulation of immunomodulatory and angiogenic properties of Ad-MSC, where inhibition of FAK conduced to dramatically reduced production of immunomodulatory factors (PEG2, TSG-6 and COX-2) and angiogenic factors (VEGF, Ang-1, HGF, and TGF-β). Additionally, we found that ERK1/2, one of the crucial downstream molecules of FAK pathway, was also upregulated in Ad-MSCs culture with DOAP-BC, implicating activation of the FAK/ERK1/2-signaling pathway. Moreover, the character of ERK1/2 in DOAP-BC-induced paracrine function in Ad-MSCs was revealed in following investigation that blocking ERK1/2 prohibited the DOAP-BC-induced paracrine effects of Ad-MSCs by administrating the ERK1/2 inhibitor PD98059. We established a diabetic wound-healing model to estimate the influence of mussel-inspired nanostructures on the paracrine functions of Ad-MSCs. This model is advantageous, because diabetic wounds are characterized by prolonged chronic inflammation, vascular clogging and delay, or the inability to regenerate tissue. This model represents a classic diseased-recipient microenvironment and has been widely applied as an animal model for evaluating the paracrine



effects of MSCs, especially for their anti-inflammatory and pro-angiogenic functions.18,

Page 24 of 43

58-59

Additionally, previous studies involving diabetic wound-healing associated with tissue engineering mainly focused on the direct effects of biomaterials combined with MSCs.60-62 The model used in the present study allowed us to test the outcomes of Ad-MSC-induced paracrine functions without the discrimination of scaffolds, as well as to compare our observations and results with previous reports. According to the results, the speed and area of wound healing was much faster in the DOPABC-CM group relative to that observed in other groups. Moreover, histological analysis using H&E and Masson's trichrome staining reveled the formation of a mature epithelial structure and newly generated dermal appendages in DOPA-BC-CM group, whereas these were not found in the other groups. Regarding neovascularization, visual observation showed a greater number of vessels formed on the bottom of the skin wound in the DOPA-BC-CM group as compared with that observed in other groups, with histological analysis also revealing to formation of a higher number of tube-like structures in the DOPA-BC-CM group relative to the other groups. Immunohistochemical analysis showed that CD31, a marker of vascular endothelial cells, was upregulated in the DOPA-BC-CM group relative to levels observed in the other three groups. These observations demonstrated the pro-angiogenic effects of DOPA-BC-CM and confirmed our in vitro results. Furthermore, immunofluorescence results showed a more prominent signal in the area populated by the M2-polarization marker CD206 in the DOPA-BC-CM group relative to that observed in the other groups. These findings confirmed that the DOPA-BC-induced paracrine secretion of Ad-MSCs promoted vascularization, modulated the immune microenvironment, and promoted the tissue regeneration. There were limitations to the present study. First of all, deep investigation concerning the


Page 25 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


response of other immune cells, such as lymphocytes, should be performed. As exogenous implants, the sustained existence of scaffolds and their biological effect in vivo require the modulation of the immunological response. Second, the specific biological mechanisms and the information of molecular regarding the phenomena described in this study need to be elucidated. Moreover, the extent of the relationship between endothelial cells and macrophages and/or their cross-talk keeps unknown and might be a crucial step in the course of inflammation, angiogenesis, and wound repair.

5. Conclusions MSCs are enabled to initiate a reparative process via instructing functions desired in progenitorcell populations owing to their paracrine mechanisms. That possibility of substantially improving the capacity of MSCs to promote this function by manipulating biomaterial characteristics, such as topography, represents an encouraging approach to improving the efficacy of MSC-based treatments. The secretome of Ad-MSCs cultured on mussel-inspired nanostructures showed upregulated production of immunomodulatory and proangiogenic factors which exhibited in vitro functions, as well as treatment efficacy in a diabetic model of skin-wound-healing. Those findings above provide us novel insights into the role of mussel-inspired nanostructured surfaces of biomaterial in improving cell–material interactions and promoting the paracrine functions of MSCs. Moreover, our results suggest that the topographical properties of biomaterials can be further manipulated and optimized in order to employ the paracrine effects of MSCs to promote tissue regeneration.

Supporting Information



The protocols of histological analysis and immunofluorescence staining. The FTIR, XRD spectra of BC and DOPA-BC scaffolds. The morphology of Ad-MSCs under inverted microscope. Oil red O staining after adipogenic induction for 3 weeks. The surface markers of Ad-MSCs at passage 3 determined using flow cytometry. These materials are available free of charge via the Internet at http://pubs.acs.org/.

Author Contributions: The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. Funding: The study was supported by National Key R&D Program of China (No. 2018YFB1105600) and National Nature Science Foundation of China (Grant No.81572156, 81772326, 81702124), China Postdoctoral Science Foundation (2018M630451, 2018M640406), and Shanghai Clinical Medical Center (Grant Number 2017ZZ01023), Shanghai Municipal Key Clinical Specialty. Conflicts of interest The authors have declared that no competing interests exist. Acknowledgments We thank the staff at Shanghai Key Laboratory of Orthopaedic Implants, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine. We greatly appreciate Wentao Dang for instructing us to fabricate scaffolds. We sincerely appreciate Zhonglong Liu for his generous in providing us the antibodies for flow cytometry. References (1) Gnecchi, M.; Zhang, Z.; Ni, A.; Dzau, V. J. Paracrine Mechanisms in Adult Stem Cell Signaling and


Page 26 of 43

Page 27 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Therapy. Circ Res. 2008, 103, 1204-1219. (2) Pittenger, M. F.; Mackay, A. M.; Beck, S. C.; Jaiswal, R. K.; Douglas, R.; Mosca, J. D.; Moorman, M. A.; Simonetti, D. W.; Craig, S.; Marshak, D. R. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 1999, 284, 143-147. (3) von Bahr, L.; Batsis, I.; Moll, G.; Hagg, M.; Szakos, A.; Sundberg, B.; Uzunel, M.; Ringden, O.; Le Blanc, K. Analysis of Tissues Following Mesenchymal Stromal Cell Therapy in Humans Indicates Limited Long-Term Engraftment and No Ectopic Tissue Formation. Stem Cells 2012, 30, 1575-1578. (4) Bai, L.; Lennon, D. P.; Caplan, A. I.; DeChant, A.; Hecker, J.; Kranso, J.; Zaremba, A.; Miller, R. H. Hepatocyte Growth Factor Mediates Mesenchymal Stem Cell-Induced Recovery in Multiple Sclerosis Models. Nat. Neurosci. 2012, 15, 862-870. (5) Lee, R. H.; Pulin, A. A.; Seo, M. J.; Kota, D. J.; Ylostalo, J.; Larson, B. L.; Semprun-Prieto, L.; Delafontaine, P.; Prockop, D. J. Intravenous hMSCs Improve Myocardial Infarction in Mice Because Cells Embolized in Lung Are Activated to Secrete the Anti-Inflammatory Protein TSG-6. Cell Stem Cell 2009, 5, 54-63. (6) Sakaida, I.; Terai, S.; Yamamoto, N.; Aoyama, K.; Ishikawa, T.; Nishina, H.; Okita, K. Transplantation of Bone Marrow Cells Reduces CCl4-Induced Liver Fibrosis in Mice. Hepatology 2004, 40, 1304-1311. (7) Togel, F.; Hu, Z.; Weiss, K.; Isaac, J.; Lange, C.; Westenfelder, C. Administered Mesenchymal sStem Cells Protect Against Ischemic Acute Renal Failure through Differentiation-independent Mechanisms. Am J Physiol Renal Physiol. 2005, 289, F31-42. (8) Wang, Y.; Chen, X.; Cao, W.; Shi, Y. Plasticity of Mesenchymal Stem Cells in Immunomodulation: Pathological and Therapeutic Implications. Nat Immunol. 2014, 15, 1009-1016.



(9) Ma, S.; Xie, N.; Li, W.; Yuan, B.; Shi, Y.; Wang, Y. Immunobiology of Mesenchymal Stem Cells. Cell Death Differ. 2014, 21, 216-225. (10) Aurora, A. B.; Olson, E. N. Immune Modulation of Stem Cells and Regeneration. Cell Stem Cell 2014, 15, 14-25. (11) Ylostalo, J. H.; Bartosh, T. J.; Coble, K.; Prockop, D. J. Human Mesenchymal Stem/Stromal Cells Cultured as Spheroids Are Self-activated to Produce Prostaglandin E2 that Directs Stimulated Macrophages into An Anti-Inflammatory Phenotype. Stem Cells 2012, 30, 2283-2296. (12) Eggenhofer, E.; Hoogduijn, M. J. Mesenchymal Stem Cell-educated Macrophages. Transplant Res. 2012, 1, 12. (13) Ortiz, L. A.; Dutreil, M.; Fattman, C.; Pandey, A. C.; Torres, G.; Go, K.; Phinney, D. G. Interleukin 1 Receptor Antagonist Mediates the Antiinflammatory and Antifibrotic Effect of Mesenchymal Stem Cells During Lung Injury. Proc Natl Acad Sci U S A. 2007, 104, 11002-11007. (14) Roddy, G. W.; Oh, J. Y.; Lee, R. H.; Bartosh, T. J.; Ylostalo, J.; Coble, K.; Rosa, R. H., Jr.; Prockop, D. J. Action at A Distance: Systemically Administered Adult Stem/Progenitor Cells (MSCs) Reduce Inflammatory Damage to the Cornea Without Engraftment and Primarily by Secretion of TNF-alpha Stimulated Gene/Protein 6. Stem Cells 2011, 29, 1572-1579. (15) Bardos, T.; Kamath, R. V.; Mikecz, K.; Glant, T. T. Anti-Inflammatory and Chondroprotective Effect of TSG-6 (tumor necrosis factor-alpha-stimulated gene-6) in Murine Models of Experimental Arthritis. Am J Pathol. 2001, 159, 1711-1721. (16) Choi, H.; Lee, R. H.; Bazhanov, N.; Oh, J. Y.; Prockop, D. J. Anti-inflammatory Protein TSG-6 Secreted by Activated MSCs Attenuates Zymosan-Induced Mouse Peritonitis by Decreasing TLR2/NFkappaB Signaling in Resident Macrophages. Blood 2011, 118, 330-338.


Page 28 of 43

Page 29 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(17) Frank, S.; Hubner, G.; Breier, G.; Longaker, M. T.; Greenhalgh, D. G.; Werner, S. Regulation of Vascular Endothelial Growth Factor Expression in Cultured Keratinocytes. Implications for Normal and Impaired Wound Healing. J Biol Chem. 1995, 270, 12607-12613. (18) Su, N.; Gao, P. L.; Wang, K.; Wang, J. Y.; Zhong, Y.; Luo, Y. Fibrous Scaffolds Potentiate the Paracrine Function of Mesenchymal Stem Cells: A New Dimension in Cell-Material Interaction. Biomaterials 2017, 141, 74-85. (19) Qazi, T. H.; Mooney, D. J.; Duda, G. N.; Geissler, S. Biomaterials that Promote Cell-Cell Interactions Enhance the Paracrine Function of MSCs. Biomaterials 2017, 140, 103-114. (20) Valles, G.; Bensiamar, F.; Crespo, L.; Arruebo, M.; Vilaboa, N.; Saldana, L. Topographical Cues Regulate the Crosstalk Between MSCs and Macrophages. Biomaterials 2015, 37, 124-133. (21) Wan, S.; Fu, X.; Ji, Y.; Li, M.; Shi, X.; Wang, Y. FAK- and YAP/TAZ Dependent Mechanotransduction Pathways Are Required for Enhanced Immunomodulatory Properties of AdiposeDerived Mesenchymal Stem Cells Induced by Aligned Fibrous Scaffolds. Biomaterials 2018, 171, 107117. (22) Lee, H.; Dellatore, S. M.; Miller, W. M.; Messersmith, P. B. Mussel-Inspired Surface Chemistry for Multifunctional Coatings. Science 2007, 318, 426-430. (23) Liu, X.; Cao, J.; Li, H.; Li, J.; Jin, Q.; Ren, K.; Ji, J. Mussel-Inspired Polydopamine: a Biocompatible and Ultrastable Coating for Nanoparticles in vVivo. ACS Nano 2013, 7, 9384-9395. (24) Bettinger, C. J.; Bruggeman, J. P.; Misra, A.; Borenstein, J. T.; Langer, R. Biocompatibility of Biodegradable Semiconducting Melanin Films for Nerve Tissue Engineering. Biomaterials 2009, 30, 3050-3057. (25) Zhou, Y.; Wu, C.; Xiao, Y. The Stimulation of Proliferation and Differentiation of Periodontal



Ligament Cells by the Ionic Products from Ca7Si2P2O16 Bioceramics. Acta Biomater. 2012, 8, 23072316. (26) Mitragotri, S.; Lahann, J. Physical Approaches to Biomaterial Design. Nat Mater. 2009, 8, 15-23. (27) Lin, C. C.; Fu, S. J. Osteogenesis of Human Adipose-Derived Stem Cells on Poly(dopamine)-Coated Electrospun Poly(lactic acid) Fiber Mats. Mater Sci Eng C Mater Biol Appl. 2016, 58, 254-263. (28) Li, W.; Liu, Y.; Zhang, P.; Tang, Y.; Zhou, M.; Jiang, W.; Zhang, X.; Wu, G.; Zhou, Y. TissueEngineered Bone Immobilized with Human Adipose Stem Cells-Derived Exosomes Promotes Bone Regeneration. ACS Appl Mater Interfaces. 2018, 10, 5240-5254. (29) Hong, S.; Kim, K. Y.; Wook, H. J.; Park, S. Y.; Lee, K. D.; Lee, D. Y.; Lee, H. Attenuation of the in Vivo Toxicity of Biomaterials by Polydopamine Surface Modification. Nanomedicine (Lond) 2011, 6, 793-801. (30) Zhang, H.; Wu, X.; Wang, G.; Liu, P.; Qin, S.; Xu, K.; Tong, D.; Ding, H.; Tang, H.; Ji, F. Macrophage Polarization, Inflammatory Signaling, and NF-kappaB Activation in Response to Chemically Modified Titanium Surfaces. Colloids Surf B Biointerfaces. 2018, 166, 269-276. (31) Ma, H.; Luo, J.; Sun, Z.; Xia, L.; Shi, M.; Liu, M.; Chang, J.; Wu, C. 3D Printing of Biomaterials With Mussel-Inspired Nanostructures for Tumor Therapy and Tissue Regeneration. Biomaterials 2016, 111, 138-148. (32) Wen, Y.; Yang, H.; Liu, Y.; Liu, Q.; Wang, A.; Ding, Y.; Jin, Z. Evaluation of BMMSCs-EPCs Sheets for Repairing Alveolar Bone Defects in Ovariectomized Rats. Sci Rep. 2017, 7, 16568. (33) Zhang, Y.; Jiang, X.; Ren, L. Optimization of the Adipose-Derived Mesenchymal Stem Cell Delivery Time for Radiation-Induced Lung Fibrosis Treatment in Rats. Sci Rep. 2019, 9, 5589. (34) Singer, N. G.; Caplan, A. I. Mesenchymal Stem Cells: Mechanisms of Inflammation. Annu Rev


Page 30 of 43

Page 31 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Pathol. 2011, 6, 457-478. (35) Le Blanc, K.; Ringden, O. Immunomodulation by Mesenchymal Stem Cells and Clinical Experience. J Intern Med. 2007, 262, 509-525. (36) English, K.; Mahon, B. P.; Wood, K. J. Mesenchymal Stromal Cells; Role in Tissue Repair, Drug Discovery and Immune Modulation. Curr Drug Deliv. 2014, 11, 561-571. (37) Ding, J.; Chen, B.; Lv, T.; Liu, X.; Fu, X.; Wang, Q.; Yan, L.; Kang, N.; Cao, Y.; Xiao, R. Bone Marrow Mesenchymal Stem Cell-Based Engineered Cartilage Ameliorates Polyglycolic Acid/Polylactic Acid Scaffold-Induced Inflammation Through M2 Polarization of Macrophages in a Pig Model. Stem Cells Transl Med. 2016, 5, 1079-1089. (38) Hill, A. A.; Reid Bolus, W.; Hasty, A. H. A Decade of Progress in Adipose Tissue Macrophage Biology. Immunol Rev. 2014, 262, 134-152. (39) Shapouri-Moghaddam, A.; Mohammadian, S.; Vazini, H.; Taghadosi, M.; Esmaeili, S. A.; Mardani, F.; Seifi, B.; Mohammadi, A.; Afshari, J. T.; Sahebkar, A. Macrophage Plasticity, Polarization, and Function in Health and Disease. J Cell Physiol. 2018, 233, 6425-6440. (40) Brown, B. N.; Sicari, B. M.; Badylak, S. F. Rethinking Regenerative Medicine: a MacrophageCentered Approach. Front Immunol. 2014, 5, 510. (41) Nemeth, K.; Leelahavanichkul, A.; Yuen, P. S.; Mayer, B.; Parmelee, A.; Doi, K.; Robey, P. G.; Leelahavanichkul, K.; Koller, B. H.; Brown, J. M.; Hu, X.; Jelinek, I.; Star, R. A.; Mezey, E. Bone Marrow Stromal Cells Attenuate Sepsis via Prostaglandin E(2)-Dependent Reprogramming of Host Macrophages to Increase Their Interleukin-10 Production. Nat Med. 2009, 15, 42-49. (42) Tasso, R.; Ulivi, V.; Reverberi, D.; Lo Sicco, C.; Descalzi, F.; Cancedda, R. In Vivo Implanted Bone Marrow-Derived Mesenchymal Stem Cells Trigger a Cascade of Cellular Events Leading to the



Formation of an Ectopic Bone Regenerative Niche. Stem Cells Dev. 2013, 22, 3178-3191. (43) Li, T.; Liu, Z. L.; Xiao, M.; Yang, Z. Z.; Peng, M. Z.; Li, C. D.; Zhou, X. J.; Wang, J. W. Impact of Bone Marrow Mesenchymal Stem Cell Immunomodulation on the Osteogenic Effects of Laponite. Stem Cell Res Ther. 2018, 9, 100. (44) Harris, S. G.; Padilla, J.; Koumas, L.; Ray, D.; Phipps, R. P. Prostaglandins as Modulators of Immunity. Trends Immunol. 2002, 23, 144-150. (45) Saleem, S.; Li, J.; Yee, S. P.; Fellows, G. F.; Goodyer, C. G.; Wang, R. Beta1 Integrin/FAK/ERK Signalling Pathway Is Essential for Human Fetal Islet Cell Differentiation and Survival. J Pathol. 2009, 219, 182-192. (46) Grazul-Bilska, A. T.; Johnson, M. L.; Bilski, J. J.; Redmer, D. A.; Reynolds, L. P.; Abdullah, A.; Abdullah, K. M. Wound Healing: the Role of Growth Factors. Drugs Today (Barc). 2003, 39, 787-800. (47) Keswani, S. G.; Katz, A. B.; Lim, F. Y.; Zoltick, P.; Radu, A.; Alaee, D.; Herlyn, M.; Crombleholme, T. M. Adenoviral Mediated Gene Transfer of PDGF-B Enhances Wound Healing in type I and type II Diabetic Wounds. Wound Repair Regen. 2004, 12, 497-504. (48) Kampfer, H.; Pfeilschifter, J.; Frank, S. Expressional Regulation of Angiopoietin-1 and -2 and the tie-1 and -2 Receptor Tyrosine Kinases During Cutaneous Wound Healing: a Comparative Study of Normal and Impaired Repair. Lab Invest. 2001, 81, 361-373. (49) Semenza, G. L. Regulation of Hypoxia-Induced Angiogenesis: a Chaperone Sscorts VEGF to the Dance. J Clin Invest. 2001, 108, 39-40. (50) Balaji, S.; Han, N.; Moles, C.; Shaaban, A. F.; Bollyky, P. L.; Crombleholme, T. M.; Keswani, S. G. Angiopoietin-1 Improves Endothelial Progenitor Cell-Dependent Neovascularization in Diabetic Wounds. Surgery 2015, 158, 846-856.


Page 32 of 43

Page 33 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(51) Lee, J. H.; Yoon, Y. M.; Lee, S. H. Hypoxic Preconditioning Promotes the Bioactivities of Mesenchymal Stem Cells via the HIF-1alpha-GRP78-Akt Axis. Int J Mol Sci. 2017, 18, 1320. (52) Bartosh, T. J.; Ylostalo, J. H.; Mohammadipoor, A.; Bazhanov, N.; Coble, K.; Claypool, K.; Lee, R. H.; Choi, H.; Prockop, D. J. Aggregation of Human Mesenchymal Stromal Cells (MSCs) into 3D Spheroids Enhances their Antiinflammatory Properties. Proc Natl Acad Sci U S A. 2010, 107, 13724137249. (53) Bartosh, T. J.; Ylostalo, J. H.; Bazhanov, N.; Kuhlman, J.; Prockop, D. J. Dynamic Compaction of Human Mesenchymal Stem/Precursor Cells into Spheres Self-Activates Caspase-Dependent IL1 Signaling to Enhance Secretion of Modulators of Inflammation and Immunity (PGE2, TSG6, and STC1). Stem Cells 2013, 31, 2443-2456. (54) Keselowsky, B. G.; Collard, D. M.; Garcia, A. J. Surface Chemistry Modulates Focal Adhesion Composition and Signaling through Changes in Integrin Binding. Biomaterials 2004, 25, 5947-5954. (55) Biggs, M. J.; Richards, R. G.; Dalby, M. J. Nanotopographical Modification: a Regulator of Cellular Function through Focal Adhesions. Nanomedicine 2010, 6, 619-633. (56) Kang, Y. G.; Nam, J. H.; Kim, K. H.; Lee, K. S. FAK Pathway Regulates PGE(2) Production in Compressed Periodontal Ligament Cells. J Dent Res. 2010, 89, 1444-1449. (57) Shie, M. Y.; Ding, S. J. Integrin Binding and MAPK Signal Pathways in Primary Cell Responses to Surface Chemistry of Calcium Silicate Cements. Biomaterials 2013, 34, 6589-6606. (58) Sui, B. D.; Hu, C. H.; Liu, A. Q.; Zheng, C. X.; Xuan, K.; Jin, Y. Stem Cell-Based 34 Bone Regeneration in Diseased Microenvironments: Challenges and Solutions. Biomaterials 2019, 196, 18-30. (59) Shi, M.; Xia, L.; Chen, Z.; Lv, F.; Zhu, H.; Wei, F.; Han, S.; Chang, J.; Xiao, Y.; Wu, C. Europium-



Doped Mesoporous Silica Nanosphere As an Immune-Modulating Osteogenesis/Angiogenesis Agent. Biomaterials 2017, 144, 176-187. (60) Assi, R.; Foster, T. R.; He, H.; Stamati, K.; Bai, H.; Huang, Y.; Hyder, F.; Rothman, D.; Shu, C.; Homer-Vanniasinkam, S.; Cheema, U.; Dardik, A. Delivery of Mesenchymal Stem Cells in Biomimetic Engineered Scaffolds Promotes Healing of Diabetic Ulcers. Regen Med. 2016, 11, 245-260. (61) Falanga, V.; Iwamoto, S.; Chartier, M.; Yufit, T.; Butmarc, J.; Kouttab, N.; Shrayer, D.; Carson, P. Autologous Bone Marrow-Derived Cultured Mesenchymal Stem Cells Delivered in a Fibrin Spray Accelerate Healing in Murine and Human Cutaneous Wounds. Tissue Eng. 2007, 13, 1299-1312. (62) Chu, J.; Shi, P.; Yan, W.; Fu, J.; Yang, Z.; He, C.; Deng, X.; Liu, H. PEGylated Graphene OxideMediated Quercetin-Modified Collagen Hybrid Scaffold for Enhancement of MSCs Differentiation Potential and Diabetic Wound Healing. Nanoscale 2018, 10, 9547-9560.


Page 34 of 43

Page 35 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Graphic abstract:



Figures and legends:

Fig. 1. (A) SEM images of the BC and DOPA-BC scaffolds (a2–4 and b2–4 represent the enlarged panel shown in a1 and b1, respectively). (B) Morphological evaluation of MSCs cultured on TCP, BC, and DOPA-BC microenvironments. MSCs were stained with DAPI (nuclei, blue) and Phalloidin (F-Actin, green). (C) Cell-proliferation rates of Ad-MSCs on TCP, BC, and DOPA-BC. (D) The metabolic activities of Ad-MSC monocellular cultured on TCP, BC, and DOPA-BC determined by MTS assay.


Page 36 of 43

Page 37 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 2. mRNA expression of the selected (A) immunomodulatory and (B) pro-angiogenic factors in AdMSCs. The paracrine products of (C) immunomodulatory and (D) pro-angiogenic factors secreted by Ad-MSCs as detected by ELISA. *P < 0.05; **P < 0.01; ***P < 0.001.



Fig. 3. (A) Immunofluorescence photographs and (B) quantitative analysis of iNOs (red, an M1 macrophage marker) and CD206 (green, an M2 macrophage marker) in RAW264.7 cells. (C) Quantitative analysis of proinflammatory factors and (D) anti-inflammatory factors in RAW264.7 cells in the positive control, TCP-CM, BC-CM, and DOPA-BC-CM groups.*P < 0.05; **P < 0.01; ***P < 0.001.


Page 38 of 43

Page 39 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 4. (A) Transwell migration assay of EPCs treated with different CM. (B) Representative images of tube formation by endothelial cells treated with different CM. (C) The quantification of migrated EPCs. (D) Average number of branch points and (E) tube lengths. *P < 0.05; **P < 0.01; ***P < 0.001.



Fig. 5. Stimulation of the FAK-signaling pathway in Ad-MSCs cultured on different matrices. (A) Western blot analysis of FAK and phospho-FAK (Tyr397/Tyr925) and ERK1/2 and phospho-ERK1/2 (Thr202/Tyr204) in Ad-MSCs. Protein input and quantification were normalized using GAPDH. (B) Western blot analysis of phosphor-FAK (Tyr397) and (C) phospho-ERK1/2 (Thr202/Tyr204) in AdMSCs after stimulation by the FAK inhibitor PF573228 (PF) or ERK inhibitor PD98059 (PD). RT-PCR analysis of the expression of (D) immunomodulatory factors and (E) angiogenic factors in Ad-MSCs cultured on DOPA-BC with or without treatment with PD or PF. *P < 0.05; **P < 0.01; ***P < 0.001. In D and E, the statistical significance (*P < 0.05; **P < 0.01; ***P < 0.001) means the comparison within DOPA+PF group vs DOPA group or DOPA+PD group vs DOPA group.


Page 40 of 43

Page 41 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 6. The in vivo pro-healing functions of CM derived from Ad-MSCs cultured on various matrices. (A) Representative images of skin excisional wounds treated with MEM-α, TCP-CM, BC-CM and DOPA-BC-CM at days 0, 7, and 14. (B) Measurements of wound area within 14 days in different groups. (C) Quantification of vessel lengths in the wound bed of all four groups at 14 days (n = 4/group). *P < 0.05; **P < 0.01; ***P < 0.001.



Fig. 7. Histological evaluation of skin defect treated with MEM-α or different CM. (A) H&E staining of full-thickness wounds and (D) quantification of average vessels at days 14. (Rectangles denote magnified areas). (B) Masson’s trichrome staining of collagen in wounds. (C) Immunohistochemical staining and (E) quantification of CD31 detected in wounds to evaluate angiogenesis. *P < 0.05; **P < 0.01; ***P < 0.001.


Page 42 of 43

Page 43 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 8. (A) Fluorescence confocal microscopy analysis of wound sections stained with DAPI (nuclei; blue), the M2 phenotype marker CD206 (green), and macrophage pan-marker CD68 (red). (B) The percentage of CD68+ macrophages over the total cell number. (C) The percentage of CD206+CD68+ cells over the total CD68+ macrophages in the wound bed following treatment with MEM-α, TCP-CM, BC-CM, or DOPA-BC-CM at day 14. *P < 0.05; **P < 0.01; ***P < 0.001.



Tables Table 1. Primer sequence of genes of rat for RT-PCR. Gene

Forward Sequence

Reverse Sequence

COX-2

AAGGGAGTCTGGAACATTGTGAAC

CAAATGTGATCTGGACGTCAACA

PEG2

GTGCTGCATCGCTGCTTAC

ACGTCCCTCTCGGACTTGG

TSG-6

GGGATTCAAGAACGGGATCTTT

TCAAATTCACATACGGCCTTGG

TGF-β

CCTGGAAAGGGCTCAACAC

CAGTTCTTCTCTGTGGAGCTGA

IL-1ra

AAGATGTGCCTGTCCTGTGTCAA

GTTCTCGCTCAGGTCAGTGATGTTA

MCP-1

AGCAGCAAGTGTCCCAAAGA

GGTGGTCCATGGAATCCTGA

VEGF

GAGGAAAGGGAAAGGGTCAAAA

CACAGTGAACGCTCCAGGATT

b-FGF

GTCAAACTACAGCTCCAAGCAGAA

AGGTACCGGTTCGCACACA

HGF

CAATCCAGAGGTACGCTACGAA

TTTCACCGTTGCAGGTCATG

Ang-1

CACATAGGGTGCAGCAACCA

CGTCGTGTTCTGGAAGAATGA

β-actin

AGAGGGAAATCGTGCGTGAC

CAATAGTGATGACCTGGCCGT

Table 2. Primer sequence of genes of mouse for RT-PCR. Gene

Forward Sequence

Reverse Sequence

TNF-α

CCTCTCTCTAATCAGCCCTCTG

GAGGACCTGGGAGTAGATGAG

IL-1β

ATGATGGCTTATTACAGTGGCAA

GTCGGAGATTCGTAGCTGGA

IL-6

ATAGTCCTTCCTACCCCAATTTCC

GATGAATTGGATGGTCTTGGTCC

IL-1ra

CTCCAGCTGGAGGAAGTTAAC

CTGACTCAAAGCTGGTGGTG

IL-10

GAGAAGCATGGCCCAGAAATC

GAGAAATCGATGACAGCGCC

Arg-1

CATATCTGCCAAGGACATCG

GGTCTCTTCCATCACTTTGC

GAPDH

GTATGACTCTACCCACGGCAAGT

TTCCCGTTGATGACCAGCTT


Page 44 of 43

Mussel-Inspired Nanostructures Potentiate the Immunomodulatory

Recommend Documents