Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General

Subscriber access provided by GAZI UNIV

Article

Mutually Exclusive Formation of G-quadruplex and i-Motif is a General Phenomenon Governed by Steric Hindrance in Duplex DNA Yunxi Cui, Deming Kong, Chiran Ghimire, Cuixia Xu, and Hanbin Mao Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00016 • Publication Date (Web): 30 Mar 2016 Downloaded from http://pubs.acs.org on April 4, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Mutually Exclusive Formation of G-quadruplex and i-Motif is a General Phenomenon Governed by Steric Hindrance in Duplex DNA Yunxi Cuia, Deming Kongb,*, Chiran Ghimirea, Cuixia Xua,c and Hanbin Maoa,* a

Department of Chemistry and Biochemistry and School of Biomedical Sciences, Kent State University, Kent, Ohio 44242, United States

b

Key Laboratory of Functional Polymer Materials, Ministry of Education, Nankai University, Tianjin, 300071, China c

MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275, China

KEYWORDS: G-quadruplex, i-motif, mutual exclusivity, optical tweezers

ACS Paragon Plus Environment

1

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

Abstract: G-quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and imotif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex and i-motif hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the Gquadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.


2

Page 3 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Introduction DNA G-quadruplex, which consists of a stack of four guanine residues interconnected by Hoogsteen base pairs and a monovalent cation(1, 2) (Figure 1), is observed in many native Grich DNA sequences such as telomeres and promoters of various genes including insulin (hINS), telomerase reverse transcriptase (hTERT), and oncogene BCL-2.(3-6) Consistent with the enrichment of these G-quadruplex hosting sequences in promoter regions,(7, 8) it has been found that G-quadruplexes play important regulatory roles for gene expression.(9) In the C-rich strand complementary to the G-rich DNA sequence, another tetraplex structure — i-motif,(10, 11) which contains a stack of hemiprotonated cytosine-cytosine (C:CH+) pairs(11) (Figure 1), can form. Recently, it has been demonstrated that DNA i-motif also plays regulatory roles in gene expression.(12) While G-quadruplexes act as an inhibitor for gene expression in many cases, i-motifs have demonstrated transcription activating capabilities.(12-14) The opposite activities of these two species in the same dsDNA region pose a question for a cell to coordinate these functions. It has been found that in the insulin linked polymorphic region (ILPR) upstream of human insulin promoter, the formation of G-quadruplex and i-motif is mutually exclusive.(15)

Such an

arrangement offers an opportunity for a cell to avoid conflicting activities of tetraplexes by adopting a reciprocal mechanism similar to the catabolism and anabolism of glucose.(16) So far it is not at all clear whether the mutually exclusive formation of DNA tetraplexes is a general phenomenon in genome, which is of critical importance to fully understand the new transcription mechanism mediated by these structures as proposed in literature(12-14). In addition, it is desirable to elucidate the cause of this mutual exclusive phenomenon, which offers opportunity to interfere this process for pharmaceutical exploitations.


3

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 30

Due to complex population profiles, which include DNA duplex, singe-stranded DNA, and fully and partially folded G-quadruplexes (17, 18) and i-motifs,(19, 20) it is rather challenging for ensemble-average techniques to investigate the mutual exclusivity phenomenon. It is also of great difficulty for fluorescence based single-molecule methods to probe such a complex mixture, as multiple fluorophores are required to avoid ambiguity of signals contributed from different species. Previously, force-based single-molecule approaches have been used to probe the formation of tetraplexes in the duplex ILPR DNA.(15) From the free energy change of unfolding tetraplex structures (∆Gunfold), it has been concluded that the G-quadruplex and i-motif species in the ILPR are mutually exclusive. However, in many long G/C-rich duplex DNA regions, more than one possible G-quadruplex or i-motif species may form.(5, 21, 22)

It

becomes an insurmountable task to deconvolute different species to retrieve free energy change of unfolding under these conditions. In this work, we have innovated a population analysis method to investigate the formation of G-quadruplexes and i-motifs in double-stranded DNA.

Instead of retrieving

∆Gunfold, this method calculates the probability of unfolding G-quadruplex or i-motif from unfolding force histograms in a buffer that promotes the formation of either i-motif (pH 5.5, 100 mM Li+),(23) or G-quadruplex (pH 7.4, 100 mM K+).(24) Since mechanical force up to 60 pN can completely unfold either G-quadruplex or i-motif formed in the duplex DNA, the probability of unfolding is equivalent to that of formation.(15) The predicted formation probability of both G-quadruplex and i-motif is then calculated based on these unfolding probabilities. After comparing the predicted probability with that of experimental observation in a buffer (pH 5.5 and 100 mM K+) that facilitates the formation of both G-quadruplex and i-motif, we have found that mutual exclusivity exists between the two tetraplex structures in a range of double-stranded


4

Page 5 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

DNA templates, which include human telomere and promoters of hTERT and hINS genes. To probe the mechanism of the mutual exclusivity, we have placed the G-quadruplex and i-motif hosting sequences in the two complementary human telomeric DNA strands with an offset fashion. With the same population analysis, we have revealed that simultaneous formation of the two tetraplexes increases with the offset distance, which suggests that steric hindrance is responsible for the mutual exclusivity.

Further support for this conclusion came from the

observation of the simultaneous formation of both tetraplexes in a BCL-2 promoter sequence. The fact that multiple possibilities of tetraplexes can form in the BCL-2 template, but not in other sequences tested here, indicates that simultaneous formation of tetraplexes could be due to an offset arrangement between G-quadruplex and i-motif in opposite DNA strands, which avoids the steric hindrance between the two tetraplexes. Experimental Section Materials Unless particularly noted, all DNA oligonucleotides used in this study were purchased from Integrated DNA Technologies (IDT, Coralville, IA). All chemicals with > 99% purity were purchased from VWR (West Chester, PA). Enzymes used for molecular biology experiments were purchased from New England Biolabs (NEB, Ipswich, MA) and surface functionalized beads for the laser tweezers experiments were obtained from Spherotech (Lake Forest, IL). Preparation of DNA Constructs DNA sequences used for single-molecule mechanical unfolding and refolding experiments are shown in Table 1. In optical tweezers experiments, each double-stranded DNA fragment was tethered between two double-stranded DNA handles according to the procedure described previously.(19) Briefly, the 2690-bp dsDNA handle was prepared from the pEGFP


5

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 30

vector (Clontech, Mountain View, CA). This pEGFP vector was first digested by two restriction enzymes, SacI and EagI, followed by purification using agarose gel. The SacI end was labelled with digoxigenin through terminal deoxynucleotidyl transferase. The other dsDNA handle with 2028-bp in length was amplified from the PBR322 plasmid (NEB) by PCR, followed by digestion with XbaI enzyme. One end of this handle was labelled through a biotinylated PCR primer. Two complementary single-stranded DNA oligos containing the target sequences (Table 1) were first annealed (95-25 °C in 5.5 hrs) to form a double-stranded DNA oligo, which was sandwiched between the 2690-bp and 2028-bp DNA handles through a one-pot ligation reaction by T4 DNA ligase (NEB). Single-Molecule Force-Ramp Assay The DNA construct prepared above was immobilized on the surface of the digoxigenin antibody coated polystyrene beads. We mixed 0.1 ng (3.5 × 10−17 mol) of DNA with 1 µL of beads (1.87 µm in diameter, 0.5% w/v) in 5-10 µL of three different buffers: a 10 mM Tris buffer supplemented with 100 mM KCl at pH 7.4, a 50 mM MES buffer supplemented with 100 mM KCl at pH 5.5, and a 50 mM MES buffer supplemented with 100 mM LiCl at pH 5.5. After 30 min incubation for the affinity connection between the DNA construct and the bead through the digoxigenin-antibody and digoxigenin complex, the mixture was diluted to 800 µL with the same buffer. The diluted mixture was then injected into a home-made chamber and made ready for laser tweezers experiments. Home-made dual-trap 1064-nm laser tweezers were used to carry out the force-ramp assay at 23 °C.(25, 26) A mobile laser focus grabbed the digoxigenin-antibody coated bead attached with the DNA construct, while a static laser focus trapped a streptavidin-coated bead (2.10 µm diameter, Spherotech). The mobile trap was controlled by a motorized mirror, which


6

Page 7 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

brought the two optically trapped beads together to tether the DNA construct in between through affinity interactions. In the subsequent force ramp assays, the loading rate of 5.5 pN/s was maintained by controlling the speed of the mobile trap via the same motorized mirror. Singlemolecular nature of the tether was confirmed by the characteristic force plateau at 65 pN or by single breakage events for each tether.(26) Between the two force ramp assays for the same molecule, an incubation time of 60 s was used to ensure the folding of either G-quadruplex or imotif species.(27) Predicted Population for Simultaneous Formation of G-quadruplex and i-Motif Structures Folding probabilities of tetraplex species were evaluated by the force ramp assays up to 60 pN, which showed complete unfolding of all tetraplexes formed in the dsDNA (see reference (15), the same observations were confirmed in the histograms of Figures 2B, 4B, and 7B here). To obtain the expected simultaneous formation probability of G-quadruplex and i-motif in the same duplex DNA region, we collected a rupture force histogram for structures formed in a particular sequence in a pH 7.4 buffer with 100 mM KCl. Since this buffer only allowed the formation of G-quadruplex,(26) the probability of G-quadruplex formation was retrieved (Figures 2B, 4B, 7B, and S2A, red histograms). Similarly, we estimated the probability of imotif formation in a buffer that contains 100 mM LiCl at pH 5.5 in which only i-motif can form(19) (Figures 2B, 4B, 7B, and S2A, green histograms). Due to the parallel arrangement of the G-quadruplex and i-motif hosting strands in duplex DNA (Figure S1), the force to simultaneously unfold G-quadruplex and i-motif (F(T)) is the sum of the force to unfold Gquadruplex (FGQ) and that to unfold i-motif (FIM) separately (F(T) = FGQ + FIM, Figure S1. Note all the FGQ and FIM combinations within the bin width of each specific histogram should be


7

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 30

included). Based on this relationship, the probability of unfolding both structures at F(T) (PF(T)) was calculated as, () = × ……………………………..eqn (1) Where PGQ and PIM represent the probabilities of unfolding only G-quadruplex and imotif structures at the force FGQ and FIM, respectively (see, for example, Figure 2B, red and green histograms, respectively). These probabilities were calculated by dividing the number of unfolding features with the total number of force-extension curves. Based on the definitions of PF(T) and F(T), a predicted probability histogram for simultaneous unfolding of the two tetraplexes was then constructed (black histograms in Figures 2C, 4C, 7C, and S2B). After adding all the probabilities of simultaneous unfolding in the range of expected unfolding forces F(T) = 10-100 pN, we obtained the total probability of simultaneous formation of G-quadruplex and i-motif (PF(T),sum) as:

(), =

(), ………………………..eqn (2)

Where i represents a particular bin in the predicted rupture force histogram (Figures 2C, 4C, 7C, and S2B, black histograms). Results and Discussion Population Analyses Reveal Mutually Exclusive Formation of G-quadruplex and i-Motif in Duplex DNA Based on our previous finding that mechanical force up to 60 pN can completely unfold G-quadruplex or i-motif in duplex DNA,(15) we performed force ramp assays up to 60 pN (see Materials and Methods) to evaluate the folding probability of tetraplex species. As shown in Figure 1, the double-stranded G-quadruplex/i-motif hosting sequence was tethered between the two optically trapped polystyrene beads (see Materials and Methods). By moving one of the


8

Page 9 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

beads away from another, we increased mechanical tension in the DNA construct, which unfolds structures with a rupture force accompanied with a characteristic change-in-contour-length (∆L). The observation of two rupture events often suggests the formation of both G-quadruplex and imotif. Ambiguity arose when only one rupture event was observed, suggesting unfolding of either one structure or simultaneous unfolding of two structures.

Although simultaneous

formation of the two tetraplex species can be evaluated by the change in the free energy of unfolding (∆Gunfold) obtained from Jarzynski equality,(28) due to the large set of data required, this method is not feasible in a complex system that contains multiple G-quadruplex or i-motif structures.(5, 29) To address this limitation, here, we innovated a population analysis method, based on the histograms of rupture forces that can completely unfold G-quadruplex or i-motif, to evaluate the formation probability of the two tetraplexes in duplex DNA. As a proof-of-concept, we first collected rupture force histograms of a double-stranded human telomeric fragment, 5’-TTA(GGGTTA)4, in a 10 mM Tris buffer with 100 mM KCl at pH 7.4, which allows the formation of G-quadruplex only.(26)

From this histogram, we

estimated 27.0% probability of G-quadruplex formation in duplex DNA (PGQ,total) (Figure 2). Similarly, we estimated the probability of i-motif formation as PIM,total = 17.6% in a 50 mM MES buffer that contains 100 mM LiCl at pH 5.5, whereby only i-motif forms(23) (Figure 2). Next, we performed experiments in a 50 mM MES buffer with 100 mM KCl at pH 5.5 in which formation of either G-quadruplex or i-motif, or both, can occur (Figure 2). If the formation of one tetraplex (G-quadruplex or i-motif) does not interfere with the other, the overall tetraplex population is expected to be the sum of the G-quadruplex population in the pH 7.4 buffer (27.0%) and i-motif population in the Li buffer (17.6%). If, however, the formation of one tetraplex facilitates the folding of the other, the expected population will be even higher than the


9

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 30

sum (27.0% + 17.6% = 44.6%). In our experiments, we observed 17.8% formation of tetraplexes in the KCl buffer (pH 5.5), which was much smaller than the sum of individual populations (44.6%). This result strongly suggests there is a negative interaction (or mutual exclusivity) between the formation of G-quadruplex and i-motif species. The lack of unfolding of two tetraplexes in each force-extension (F-X) curve provides another support for the mutual exclusivity observation. Unfolding of the two tetraplexes in the duplex DNA follows two scenarios.

In the first case, when both structures are unfolded

simultaneously, we expect to observe only single unfolding events in which unfolding force is the sum of those for unfolding G-quadruplex and i-motif separately due to the parallel arrangement of the two DNA strands in the duplex DNA (Figure S1). From observed unfolding force histogram (Figure 2C, cyan), the expected population (centered at ~50 pN) for simultaneous unfolding of G-quadruplex and i-motif is absent (see black histogram in Figure 2C, see Materials and Methods for detailed calculation). In fact, only one feature was observed in the force range >45 pN, in which 17 features were expected for the simultaneous formation of both tetraplexes (517 × 3.4% = 17, note 3.4% was estimated from the non-overlapped region of the black histogram in Figure 2C).

The overlapping region between the observed (cyan) and

predicted (black) histograms indicated simultaneous formation of the two tetraplexes has an upper limit chance of 22% with respect to that of the prediction. In the second case, we expected to observe two unfolding events when the two tetraplexes were unfolded sequentially. Data analysis revealed these types of curves represent only 0.3% of all F-X curves, which is substantially smaller than the expected value (27.0% × 17.6% = 4.8%) given that the two tetraplexes exist independently. Taken together, these observations strongly supported mutually exclusive formation of G-quadruplex and i-motif in the telomeric duplex DNA.


10

Page 11 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

To further verify the mutual exclusivity principle for telomeric G-quadruplex and i-motif structures, we calculated the change in free energy of unfolding telomeric tetraplexes in a 50 mM MES buffer with 100 mM KCl (pH 5.5). We obtained ∆Gunfold,tetraplexes = 10.3±1.2 kcal/mol using the Jarzynski equality(28) (Eqn S1). Compared to the G-quadruplex formed at pH 7.4 in a 10 mM Tris buffer with 100 mM K+ (∆Gunfold, GQ = 10.0±0.8 kcal/mol) and i-motif folded at pH 5.5 in a 50 mM MES buffer with 100 mM Li+ (∆Gunfold,

IM

= 10.8±0.4 kcal/mol) (Figure 3),

∆Gunfold,tetraplexes does not show significant difference. If G-quadruplex and i-motif are formed simultaneously in complementary strands of the telomeric sequence, the ∆Gunfold,tetraplexes should be the sum of the ∆Gunfold,

GQ

and ∆Gunfold,

IM.

These free energy calculations, therefore,

confirmed the mutual exclusivity of the G-quadruplex and i-motif formation in the telomeric sequence. Additional validation for this population-based method came from the data analysis on the population of the ILPR tetraplexes, which are known to be mutually exclusive.(15) In a 50 mM MES buffer with 100 mM Li+ at pH 5.5, the double-stranded ILPR sequence (5′(ACAGGGGTGTGGGG)2ACA) showed 34.2% i-motif population. In a 10 mM Tris buffer with 100 mM K+ at pH 7.4, 19.2% of G-quadruplex formed. In a buffer that facilitated the formation of either G-quadruplex or i-motif (50 mM MES with 100 mM K+ at pH 5.5), 38.3% dsDNA converted to tetraplex structures (Figure S2A). This value is significantly less than the sum of the G-quadruplex and i-motif formation (34.2% + 19.2% = 53.4%), suggesting the mutual exclusivity of the two tetraplexes. Consistent with this result, sequential unfolding (double features, 1 out of 1561 observed) or simultaneous unfolding (unfolding features with high rupture forces, 0 out of 1561 observed) of the two tetraplexes were rarely detected (Figure S2B). Since the mutual exclusivity between the ILPR G-quadruplex and the i-motif has been already


11

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 30

confirmed by footprinting analyses and free energy calculations,(15) these ILPR data treatments validated the population-based analyses on tetraplex formation. Compared to the use of the change in free energy of unfolding (∆Gunfold) to determine the formation status of G-quadruplexes and i-motifs in duplex DNA,(15) the advantage of current method lies in its simplicity. To accurately obtain ∆Gunfold by the Jarzynski equality (eqn S1), a large set of experimental data must be collected.(30) In the DNA region that contains more than four G/C tracts, multiple sets of G-quadruplex or i-motif may form due to the permutation of four G/C rich tracts that are required to form one tetraplex. In such a case, the size of data sets required for ∆Gunfold calculation arises to a level beyond experimental reach.(30, 31) In addition, deconvoluting different species becomes impossible as G-quadruplex and i-motif structures share similar size in ∆L.

In the population analysis described here, the deconvolution becomes

unnecessary as populations of folded species are estimated in a buffer in which either Gquadruplex (pH 7.4, K+) or i-motif (pH 5.5, Li+) is formed. This information then leads to expected population in a buffer (pH 5.5, K+) that promotes both G-quadruplex and i-motif formation. To allow the calculation of expected tetraplex population, it is assumed that the populations of G-quadruplex behave similarly between pH 7.4 and pH 5.5 in K+ buffers. By the same token, the population of i-motif should not change between a Li+ buffer and a K+ buffer at pH 5.5. These two situations have been verified experimentally using single-stranded telomeric G-quadruplex and i-motif constructs (Figures S3 & S4). In the final step, the mutual exclusivity of the tetraplexes can be evaluated by comparing the expected population with that of experimental observation in the 100 mM K+ buffer at pH 5.5. This method, in principle, can be extended to long G-rich sequence in which more than one tetraplex can be formed. General Feature of the Mutual Exclusivity for Tetraplex Structures in the Duplex DNA


12

Page 13 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

After establishing this statistical method, we proceeded to evaluate whether mutual exclusivity exists in other duplex DNA regions, such as the promoter of hTERT, another wellknown sequence capable of forming G-quadruplex and i-Motif structures in respective complementary strands.(5, 21) After mechanical unfolding and refolding of the hTERT 5-12 sequence (see Table 1 for the sequence), we estimated the probabilities of G-quadruplex and/or imotif formation in the buffers of 10 mM Tris with 100 mM KCl (pH 7.4), 50 mM MES with 100 mM LiCl (pH 5.5), and 50 mM MES with 100 mM KCl (pH 5.5), respectively. As depicted in Figure 4, the hTERT 5-12 sequence revealed unfolding patterns similar to those of telomere and ILPR sequences (Figures 2 and S2).

The fact that the observed simultaneous unfolding

histogram (pH 5.5, 100 mM KCl) does not match with that of the expected (centered at 55 pN, see Figure 4C) strongly suggests the mutually exclusive formation of tetraplex structures in the hTERT sequence. The overlapping region between the observed (cyan) and predicted (black) histograms indicated simultaneous formation of the two tetraplexes has an upper limit chance of 57% with respect to that of the prediction. Among the three sequences that have shown the mutual exclusivity of tetraplexes, the telomere and hINS sequences contain four G/C tracts and therefore, can form only one possible G-quadruplex or i-motif structure. In the hTERT 5-12 sequence, eight G/C tracts are available to participate in the tetraplex formation. However, recent investigations(5, 21) have indicated that by recruiting the two terminal G-tracts at each end of the sequence into a G-quadruplex, a large G-quadruplex with a long hairpin loop predominates in the hTERT 5-12 fragment. Given this finding, a common feature in all three sequences is that one predominant tetraplex populates in the entire G/C rich fragment. Therefore, it is conceivable that, due to either space constraints or static repulsion of negatively charged tetraplex species in close proximity (the steric hindrance),


13

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 30

the formation of the other tetraplex in the opposite DNA strand is precluded. If this is true, then mutually exclusive formation of tetraplexes could be a general phenomenon in the duplex DNA, which consists of two complementary strands intertwined with each other in close proximity. Mutually Exclusive Formation of G-quadruplex and i-Motif Is Caused by Steric Hindrance To verify that steric hindrance resulting from the close proximity of the two potential tetraplex structures is the cause for the mutual exclusivity, we designed telomeric DNA sequences in which G-quadruplex and i-motif forming sequences in opposite strands are offset with a certain distance (Figure 5). We prepared three double-stranded telomere sequences in which the offsets between the G-quadruplex forming and the i-motif forming regions in opposite stands contain 12 nucleotides (nts) (equivalent to the length of 2 G-tracts, or “12nt-in”, Table S1), 18 nts (equivalent to the length of 3 G-tracts, or “6nt-in”, Table S1), or 27 nts (equivalent to the length of 4 G-tracts, which has a complete offset between G-quadruplex and i-motif bearing regions, or “3nt-out”, Table S1). In addition, we mutated the residues in the strand opposing to the G-quadruplex or i-motif hosting region to avoid the formation of corresponding structures in opposite strands. If it is the steric hindrance that is responsible for the mutually exclusive formation of tetraplexes, we expect simultaneous formation of G-quadruplex and i-motif should increase with offset distance. After sandwiching the modified telomere sequences between the two dsDNA handles as described above (Figure 1), we mechanically unfolded structures in these sequences.

As

expected, we observed more force-extension curves that contained two unfolding features in the 3nt-out and 6nt-in constructs (Figure 6A). The combined sizes of the two sequential features (change-in-contour-length, ∆L= 12.8 nm and 10.9 nm) respectively matched with the total nucleotides contained between the two tetraplex forming regions (42 nts in the 3nt-out construct


14

Page 15 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

with expected ∆L of 13.3 nm; 36 nts in the 6nt-in construct with expected ∆L of 11.2 nm; see Supporting Information for the ∆L calculation). This observation strongly suggests that the two unfolding features correspond to the unfolding of two tetraplex structures in a specific construct, which indicates simultaneous formation of the two tetraplex species in the DNA. Evaluation of the percentage of the double unfolding features revealed that they increased with the offset distance between the two tetraplex-hosting regions (Figure 6B and Table S2). While the total overlapping (the wild type) and the 12nt-in DNA constructs had negligible double unfolding features, the 6nt-in construct had 1.6% such a population and the 3nt-out DNA (no overlapping between G-quadruplex and i-motif hosting sequences) increased to 3.7%. Interestingly, the population of simultaneous formation of G-quadruplex and i-motif in the 3nt-out construct (3.7%) was consistent with the predicted level calculated from the two independently formed tetraplexes (27.0% × 17.6% =4.8%). This indicates that the two tetraplex structures are no longer mutually exclusive when the G-quadruplex and i-motif hosting sequences are completely offset. Such an observation supports that steric hindrance is the cause for the mutually exclusive formation of G-quadruplex and i-motif in the duplex DNA. Similar to the wild type telomere discussed above, we analyzed the population of the 3ntout sequence in different buffers. We observed 21.0% G-quadruplex in a 10 mM Tris buffer with 100 mM KCl at pH 7.4 (only G-quadruplex forms) and 16.0% i-motif in a 50 mM MES buffer that contains 100 mM LiCl at pH 5.5 (only i-motif forms). These formation probabilities are similar to those observed in the wild type DNA (see Figure 2B). In a 50 mM MES buffer (pH 5.5) supplemented with 100 mM KCl, in which either G-quadruplex or i-motif can form, the percentage of singly folded structures increased to 23.9%. Together with the 3.7% of the dual unfolding features (Figure 6B), the total percentage of all folded species was found to be 31.3%


15

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 30

(23.9% + 3.7% × 2 = 31.3%), which was much higher than that observed in the wild type construct (17.8%, see Figure 2B). In fact, this value was close to the sum of the populations for G-quadruplex and i-motif formed alone (21.0% + 16.0% = 37.0%). Since the 3nt-out and the wild-type constructs represent no overlapping and entirely overlapping regions between the Gquadruplex and i-motif forming sequences, respectively, the striking population difference between the two constructs observed here provides another strong support that steric hindrance is the reason for the mutual exclusivity between the G-quadruplex and i-motif. To further support that the steric hindrance governs the mutual exclusivity of DNA tetraplexes, we investigated a long DNA sequence, BCL-2 (see Table 1 for the sequence), that can form different possibilities of G-quadruplex and i-motif species in respective DNA strands. Since this DNA contains six G/C-rich tracts, only one G-quadruplex or i-motif (minimal requirement: 4 G/C-rich tracts) can fold in this oligo. However, due to the permutation of four G-rich or C-rich tracts to form a tetraplex, different G-quadruplex and i-motif species are expected. Mechanical unfolding on single-stranded G-rich and C-rich BCL-2 DNA confirmed that different populations of singly folded G-quadruplex and i-motif were indeed formed in respective strands (see Figures S5 & S6 and Table S3 for details). As different G-quadruplex/imotif formation is possible in opposite strands, we rationalized that simultaneous folding of the two tetraplexes can occur by reducing steric hindrance in this duplex DNA.

Using the

population analysis method established in Figure 2, we evaluated the formation of G-quadruplex and i-motif in the duplex BCL-2 DNA in different buffers.

We found that the observed

simultaneous unfolding histogram for tetraplexes (pH 5.5, 100 mM KCl, Figure 7C cyan) overlapped significantly (98%) with that of the predicted (Figure 7C black histogram, which was obtained from pH 7.4/100 mM KCl and pH 5.5/100 mM LiCl buffers, see Figure 7B and


16

Page 17 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Materials and Methods for calculation). This result indicates simultaneous formation of Gquadruplex and i-motif in the BCL-2 sequence, lending a strong support for the steric hindrance effect on the mutual exclusivity of DNA tetraplexes. Conclusion By estimating tetraplex populations in three buffers that allow the formations of Gquadruplex, i-motif, and both structures, respectively, we have provided a simple population analysis method to evaluate the formation of G-quadruplex and i-motif in the same location of duplex DNA. Our results have shown that mutually exclusive formation of G-quadruplex and imotif in dsDNA is caused by a general mechanism, steric hindrance, which is a consequence of the close proximity of the two tetraplexes. The fact that the mutual exclusivity is governed by steric hindrance is anticipated to inspire new approaches to selectively populate either Gquadruplex or i-motif that controls specific biological activities inside cells.


17

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 30

Figure 1. Experimental setup to investigate mutually exclusive formation of G-quadruplex and imotif using laser-tweezers based mechanical unfolding methods. Insets indicate the structures of a G-quartet and a hemiprotonated cytosine-cytosine base pair, which form the G-quadruplex and the i-motif, respectively. Spheres in the background of G-quadruplex and i-motif depict a schematic of steric hindrance.


18

Page 19 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. Analyses of human telomere tetraplexes. (A) Typical Force-eXtension curves (F-X) of the double-stranded telomere DNA in different buffers. Top, 10 mM Tris with 100 mM KCl at pH 7.4 (or 7.4 K+, only G-quadruplex (Gq) forms); middle, 50 mM MES with 100 mM LiCl at pH 5.5 (or 5.5 Li+, only i-Motif (iM) forms); bottom, 50 mM MES with 100 mM KCl at pH 5.5 (or 5.5 K+, either Gq or iM can form). Red and black traces represent extending and returning FX curves respectively. (B) Rupture force histograms of the structures formed in the buffers that correspond to (A). N and n represent the number of molecules and total number of unfolding features, respectively. Each molecule may generate multiple F-X curves. (C) Predicted probabilities (peak at ~50 pN) of simultaneous unfolding of both G-quadruplex and i-motif in a 50 mM MES buffer supplemented with 100 mM KCl at pH 5.5. For comparison, the experimentally observed histogram in this buffer is shown in cyan. Solid curves represent Gaussian fittings.


19

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 30

Figure 3. Analyses of the change in free energy of unfolding (∆Gunfold) for the species formed in the double-stranded telomere sequence in a 10 mM Tris buffer at pH 7.4 with 100 mM K+ (only G-quadruplex (Gq) forms), in a 50 mM MES buffer at pH 5.5 with 100 mM Li+ (only i-Motif (iM) forms), or in a 50 mM MES buffer at pH 5.5 with 100 mM K+ (either Gq or iM can form).


20

Page 21 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4. Analyses of hTERT tetraplexes. (A) Typical Force-eXtension curves (F-X) of the double-stranded telomere DNA in different buffers. Top, 10 mM Tris with 100 mM KCl at pH 7.4 (or 7.4 K+, only G-quadruplex (Gq) forms); middle, 50 mM MES with 100 mM LiCl at pH 5.5 (or 5.5 Li+, only i-Motif (iM) forms); bottom, 50 mM MES with 100 mM KCl at pH 5.5 (or 5.5 K+, either Gq or iM can form). Red and black traces represent extending and returning F-X curves respectively. (B) Rupture force histograms of the structures formed in the buffers that correspond to (A). Solid curves represent Gaussian fittings. Two rupture force populations in Gq may represent two folded conformations.(27) N and n represent the number of molecules and number of unfolding features, respectively. (C) Predicted probabilities (peak at ~52 pN) of simultaneous unfolding of both G-quadruplex and i-motif in a 50 mM MES buffer supplemented with 100 mM KCl at pH 5.5. For comparison, the experimentally observed histogram in this buffer is shown in cyan.


21

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 30

Figure 5. Design of telomeric constructs with offset arrangements of G-quadruplex and i-motif hosting sequences in complementary strands. See Table S1 for detailed sequences.


22

Page 23 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 6. Simultaneous unfolding of human telomeric tetraplexes. (A) Typical F-X curves observed in the telomere constructs “3nt-out” (top) and “6nt-in” (bottom) (see Table S1 for detailed sequences). Red and black traces represent extending and returning F-X curves respectively. (B) Percentage of simultaneous formation of the two tetraplex structures in the telomere DNA constructs.


23

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 30

Figure 7. Analyses of BCL-2 tetraplexes. (A) Typical Force-eXtension curves (F-X) of the double-stranded BCL-2 DNA in different buffers. Top, 10 mM Tris with 100 mM KCl at pH 7.4 (or 7.4 K+, only G-quadruplex (Gq) forms); middle, 50 mM MES with 100 mM LiCl at pH 5.5 (or 5.5 Li+, only i-Motif (iM) forms); bottom, 50 mM MES with 100 mM KCl at pH 5.5 (or 5.5 K+, either Gq or iM can form). Red and black traces represent extending and returning curves respectively. (B) Rupture force histograms of the structures formed in the buffers that correspond to (A). Solid curves represent Gaussian fittings. Two rupture force populations in Gq may represent two folded conformations.(27) N and n represent the number of molecules and number of unfolding features, respectively. (C) Predicted probabilities (peak at 38 pN) of simultaneous unfolding of both G-quadruplex and i-motif in a 50 mM MES buffer supplemented with 100 mM KCl at pH 5.5 (black). For comparison, the experimentally observed histogram in this buffer is shown in cyan. Dotted trace indicates a 5× magnification of the predicted probability. Note the predicted probability has a maximal population (38 pN) close to that (33 pN) of the observed probability.


24

Page 25 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table1: Wild type DNA sequences (underlined) of ILPR and telomere used in the singlemolecule mechanical unfolding experiments.

Telomere ILPR

hTERT

BCL-2

Gq strand--5’-CTAGATTAGGGTTAGGGTTAGGGTTAGGGTTAC iM strand--5’-GGCCGTAACCCTAACCCTAACCCTAACCCTAAT Gq strand--5’-CACAGGGGTGTGGGGACAGGGGTGTGGGGT iM strand--5’-CTAGACCCCACACCCCTGTCCCCACACCCCTGTGGTAC Gq strand--5’-CTAGATTTGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGATTTC iM strand--5’-GGCCGAAATCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCAAAT Gq strand--5’-CTAGAGGGGCGGGCGCGGGAGGAAGGGGGCGGGAGCGGGGCTGC iM strand--5’-GGCCGCAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCCCT

Supporting Information Figures S1-S6, and Tables S1-S4 are available free of charge via the Internet at http://pubs.acs.org Corresponding Author * To whom correspondence should be addressed. Hanbin Mao: Tel: +1 330 672 9380, Fax: +1 330 672 3816, Email: [email protected]. Deming Kong: Tel: +86-22-23500938, Email: [email protected]. Funding Information NSF CHE-1026532 and CHE-1415883 for financial support (H.M.). D.K. supported from National Natural Science Foundation of China (No. 21322507).


25

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 30

References 1. 2. 3.

4.

5.

6.

7. 8. 9.

10.

11. 12.

13. 14.

15.

16.

Gellert, M., Lipsett, M. N., and Davies, D. R. (1962) Helix formation by guanylic acid, Proc. Natl. Acad. Sci. USA 48, 2013–2018. Williamson, J. R., Raghuraman, M. K., and Cech, T. R. (1989) Monovalent cationinduced structure of telomeric DNA: The G-quartet model, Cell 59, 871-880. Connor, A. C., Frederick, K. A., Morgan, E. J., and McGown, L. B. (2006) Insulin capture by an insulin-linked polymorphic region G-quadruplex DNA oligonucleotide, J. Am. Chem. Soc. 128, 4986-4991. Gomez, D., Lemarteleur, T., Lacroix, L., Mailliet, P., Mergny, J. L., and Riou, J. F. (2004) Telomerase downregulation induced by the G-quadruplex ligand 12459 in A549 cells is mediated by hTERT RNA alternative splicing, Nucleic Acids Research 32, 371379. Palumbo, S. L., Ebbinghaus, S. W., and Hurley, L. H. (2009) Formation of a Unique Endto-End Stacked Pair of G-Quadruplexes in the hTERT Core Promoter with Implications for Inhibition of Telomerase by G-Quadruplex-Interactive Ligands, J. Am. Chem. Soc. 131, 10878-10891. Onyshchenko, M. I., Gaynutdinov, T. I., Englund, E. A., Appella, D. H., Neumann, R. D., and Panyutin, I. G. (2009) Stabilization of G-quadruplex in the BCL2 promoter region in double-stranded DNA by invading short PNAs, Nucleic Acids Res 37, 7570–7580. Huppert, J. L., and Balasubramanian, S. (2005) Prevalence of quadruplexes in the human genome, Nucleic Acids Res. 33, 2908-2916. Huppert, J. L., and Balasubramanian, S. (2007) G-quadruplexes in promoters throughout the human genome, Nucleic Acids Res. 35, 406-413. Siddiqui-Jain, A., Grand, C. L., Bearss, D. J., and Hurley, L. H. (2002) Direct Evidence for a G-quadruplex in a Promoter Region and Its Targeting with a Small Molecule to Repress c-MYC Transcription, Proc. Natl. Acad. Sci. USA 99, 11593-11598. Leroy, J. L., Gueron, M., Mergny, J. L., and Helene, C. (1994) Intramolecular folding of a fragment of the cytosine-rich strand of telomeric DNA into an i-motif, Nucleic Acids Res. 22, 1600-1606. Diederichsen, U. (1998) Oligomers with Intercalating Cytosine-Cytosine+ Base Pairs and Peptide Backbone: DNA i-Motif Analogues, Angew. Chem. Int. Ed. 37, 2273-2276. Kendrick, S., Kang, H.-J., Alam, M. P., Madathil, M. M., Agrawal, P., Gokhale, V., Yang, D., Hecht, S. M., and Hurley, L. H. (2014) The Dynamic Character of the BCL2 Promoter i-Motif Provides a Mechanism for Modulation of Gene Expression by Compounds That Bind Selectively to the Alternative DNA Hairpin Structure, J. Am. Chem. Soc. 136, 4161-4171. Kendrick, S., and Hurley, L. H. (2010) The role of G-quadruplex/i-motif secondary structures as cis-acting regulatory elements, Pure Appl. Chem. 82, 1609–1621. Kang, H.-J., Kendrick, S., Hecht, S. M., and Hurley, L. H. (2014) The Transcriptional Complex Between the BCL2 i-Motif and hnRNP LL Is a Molecular Switch to Control Gene Expression, J. Am. Chem. Soc. 136, 4172–4185. Dhakal, S., Yu, Z., Konik, R., Cui, Y., Koirala, D., and Mao, H. (2012) G-Quadruplex and i-Motif Are Mutually Exclusive in ILPR Double-Stranded DNA, Biophys. J. 102, 2575–2584. Zhang, C.-S., Jiang, B., Li, M., Zhu, M., Peng, Y., Zhang, Y.-L., Wu, Y.-Q., Yang Li, T., Liang, Y., Lu, Z., Lian, G., Liu, Q., Guo, H., Yin, Z., Ye, Z., Han, J., Wu, J.-W., Yin, H.,


26

Page 27 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

17.

18.

19.

20. 21.

22.

23.

24.

25. 26.

27.

28. 29.

30.

Lin, S.-Y., and Lin, S.-C. (2014) The Lysosomal v-ATPase-Ragulator Complex Is a Common Activator for AMPK and mTORC1, Acting as a Switch between Catabolism and Anabolism, Cell Metabolism 20, 526-540. Koirala, D., Mashimo, T., Sannohe, Y., Yu, Z., Mao, H., and Sugiyama, H. (2012) Intramolecular folding in three tandem guanine repeats of human telomeric DNA, Chem. Commun. 48, 2006-2008. Koirala, D., Ghimire, C., Bohrer, C., Sannohe, Y., Sugiyama, H., and Mao, H. (2013) Long-Loop G-Quadruplexes Are Misfolded Population Minorities with Fast Transition Kinetics in Human Telomeric Sequences, J. Am. Chem. Soc. 135, 2235-2241. Dhakal, S., Schonhoft, J. D., Koirala, D., Yu, Z., Basu, S., and Mao, H. (2010) Coexistence of an ILPR i-Motif and a Partially Folded Structure with Comparable Mechanical Stability Revealed at the Single-Molecule Level, J. Am. Chem. Soc. 132, 8991–8997. Dhakal, S., Lafontaine, J. L., Yu, Z., Koirala, D., and Mao, H. (2012) Intramolecular Folding in Human ILPR Fragment with Three C-Rich Repeats, PLoS ONE 7, e39271. Yu, Z., Gaerig, V., Cui, Y., Kang, H., Gokhale, V., Zhao, Y., Hurley, L. H., and Mao, H. (2012) Tertiary DNA Structure in the Single-Stranded hTERT Promoter Fragment Unfolds and Refolds by Parallel Pathways via Cooperative or Sequential Events, J. Am. Chem. Soc. 134, 5157-5164. Lim, K. W., Lacroix, L., Yue, D. J., Lim, J. K., Lim, J. M., and Phan, A. T. (2010) Coexistence of two distinct G-quadruplex conformations in the hTERT promoter, J. Am. Chem. Soc. 132, 12331-12342. Ying, L., Green, J. J., Li, H., Klenerman, D., and Balasubramanian, S. (2003) Studies on the structure and dynamics of the human telomeric G quadruplex by single-molecule fluorescence resonance energy transfer, Proc. Natl. Acad. Sci. USA 100, 14629-14634. Kendrick, S., Akiyama, Y., Hecht, S. M., and Hurley, L. H. (2009) The i-Motif in the bcl2 P1 Promoter Forms an Unexpectedly Stable Structure with a Unique 8:5:7 Loop Folding Pattern, J. Am. Chem. Soc. 131, 17667-17676. Mao, H., and Luchette, P. (2008) An integrated laser-tweezers instrument for microanalysis of individual protein aggregates, Sens. Actuators B 129, 764-771. Yu, Z., Schonhoft, J. D., Dhakal, S., Bajracharya, R., Hegde, R., Basu, S., and Mao, H. (2009) ILPR G-Quadruplexes Formed in Seconds Demonstrate High Mechanical Stabilities, J. Am. Chem. Soc. 131, 1876-1882. Koirala, D., Dhakal, S., Ashbridge, B., Sannohe, Y., Rodriguez, R., Sugiyama, H., Balasubramanian, S., and Mao, H. (2011) A Single-Molecule Platform for Investigation of Interactions between G-quadruplexes and Small-Molecule Ligands, Nat. Chem. 3, 782787. Jarzynski, C. (1997) Nonequilibrium Equality for Free Energy Differences, Phys. Rev. Lett. 78, 2690 - 2693. Cui, Y., Koirala, D., Kang, H., Dhakal, S., Yangyuoru, P., Hurley, L. H., and Mao, H. (2014) Molecular Population Dynamics of DNA Structures in a Bcl-2 Promoter Sequence is Regulated by Small-molecules and the Transcription Factor hnRNP LL", Nucleic Acids Res., 5755-5764. Gore, J., Ritort, F., and Bustamante, C. (2003) Bias and error in estimates of equilibrium free-energy differences from nonequilibrium measurements, Proc Natl Acad Sci U S A 100, 12564-12569.


27

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

31.

Page 28 of 30

Yu, Z., and Mao, H. (2013) Non-B DNA structures show diverse conformations and complex transition kinetics comparable to RNA or proteins ― a perspective from mechanical unfolding and refolding experiments, Chem. Rec. 13, 102-116.


28

Page 29 of 30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For Table of Contents Use Only

Mutually Exclusive Formation of G-quadruplex and i-Motif is a General Phenomenon Governed by Steric Hindrance in Duplex DNA Yunxi Cuia, Deming Kongb,*, Chiran Ghimirea, Cuixia Xua,c and Hanbin Maoa,*


29

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC of the manuscript 34x38mm (300 x 300 DPI)


Page 30 of 30

Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General

Recommend Documents