[N-(Aminoalkyl)carbamoyloxy]-carbocyclic - American Chemical Society

sis by both snake venom phosphodiesterase and nuclease. S1 (an endonuclease) than unmodified ODNs, and were very stable in a medium containing 10% ...
0 downloads 0 Views 101KB Size
Download PDF
Bioconjugate Chem. 2000, 11, 933−940

933

Nucleosides and Nucleotides. 204. Synthesis of Oligodeoxynucleotides Containing 6′r-[N-(Aminoalkyl)carbamoyloxy]-carbocyclic-thymidines and the Thermal Stability of the Duplexes and Their Nuclease-Resistance Properties† Yoshihito Ueno, Naoko Karino, and Akira Matsuda* Graduate School of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Kita-ku, Sapporo 060-0812, Japan. Received June 13, 2000; Revised Manuscript Received August 28, 2000

To construct the nuclease-resistant oligodeoxynucleotides (ODNs) with natural phosphodiester linkages, we synthesized ODNs that contain 6′R-[N-(aminoalkyl)carbamoyloxy]-carbocyclic-thymidines (4, 5, and 6). The stability of these ODNs to nuclease hydrolysis was examined by using snake venom phosphodiesterase (3′-exonuclease) and nuclease S1 (endonuclease). It was found that the ODNs containing 4, 5, or 6 were more resistant to both the enzymes than the unmodified ODN. These nuclease-resistant properties are noteworthy, since they have natural phosphodiester linkages. Next, the thermal stabilities of duplexes consisting of these ODNs and either the complementary DNA or RNA were studied by thermal denaturation. The ODNs that contain 4 were found to enhance the thermal stability of the duplexes with the complementary DNA, while those containing 5 or 6 decreased the thermal stability of the ODN-DNA duplexes. On the other hand, all ODNs that contained 4, 5, or 6 decreased the thermal stability of the ODN-RNA duplexes.

INTRODUCTION

Oligodeoxynucleotides (ODNs)1 that are capable of inhibiting cellular processes at the translational level by base pairing with mRNA are known as antisense ODNs (1-4). Since unmodified ODNs with natural phosphodiester linkages are rapidly hydrolyzed by nucleases found in cell culture media and inside cells, many types of backbone-modified ODNs have been synthesized and used for antisense studies (5). Phosphorothioate ODNs, in which one nonbridging phosphate oxygen is replaced by sulfur, are some of the most widely used backbonemodified antisense ODNs. Phosphorothioate ODNs are markedly more resistant to hydrolysis by nucleases than unmodified ODNs and activate RNase H that selectively cleaves the RNA-strand of a DNA-RNA duplex (2). However, it is known that their binding affinity for RNA is lower than that of an unmodified ODN (6). Furthermore, phosphorothioate ODNs sometimes exhibit nonsequence-specific activity (7-9). On the basis of this background information, we have developed new antisense ODNs which have natural phosphodiester linkages and which are also resistant to nucleases. We hypothesized that the natural phosphodi† For Part 203 in this series, see M. Sukeda, S. Shuto, I. Sugimoto, S. Ichikawa, and A. Matsuda, submitted for publication. * To whom correspondence should be addressed. Phone: +8111-706-3228. Fax: +81-11-706-4980. E-mail: matuda@ pharm.hokudai.ac.jp. 1 Abbreviations: ODN, oligodeoxynucleotide; CPG, controlled pore glass; HPLC, high-performance liquid chromatography; Tm, melting temperature; Bn, benzyl; DMAP, 4-(dimethylamino)pyridine; DMTr, 4,4′-dimethoxytrityl; TBAF, tetrabutylammonium fluoride; TEAA, triethylammonium acetate; TIPS, triisopropylsilyl.

ester ODNs carrying basic amino alkyl chains near their phosphodiester moieties might be resistant to nucleases. Since nucleases hydrolyze phosphodiester linkages by a general acid-base catalysis mechanism, including acidic and/or basic amino acid residues at their active sites, the presence of a basic amino group near the phosphodiester moiety of ODNs may prevent nucleolytic hydrolysis by forming an ionic bond with the acidic phosphodiester moiety of ODNs. It is also possible that the amino group attached to ODNs interrupts the catalytic system of nucleases by bonding with an acidic amino residue or by repulsing a basic amino acid residue at the enzyme active sites. Indeed, we found that ODNs containing a 2′-deoxyuridine analogue 1 which carries an aminoalkyl-linker at the 1′-position (Figure 1) were more resistant to nucleolytic hydrolysis by both snake venom phosphodiesterase (a 3′-exonuclease) and nuclease P1 (an endonuclease) than unmodified ODNs (10). We also synthesized ODNs containing a 2′-deoxyuridine analogue 2 which carries an aminohexyl-linker at the 5-position of uracil (11-13). These ODNs were more resistant to nucleolytic hydrolysis by both snake venom phosphodiesterase and nuclease S1 (an endonuclease) than unmodified ODNs, and were very stable in a medium containing 10% fetal calf serum (12, 13). Furthermore, we found that the ODNs containing a thymidine analogue 3 which carries an aminoethyllinker at the 4′-position were significantly resistant to nucleolytic hydrolysis by both snake venom phosphodiesterase and DNase I (an endonuclease) and were very stable in PBS containing 50% human serum (14). These results indicate that ODNs that have been suitably modified by aminoalkyl-linkers are resistant not only to exonucleases but also to endonucleases, even when they have natural phosphodiester linkages.

10.1021/bc0000684 CCC: $19.00 © 2000 American Chemical Society Published on Web 10/28/2000

934 Bioconjugate Chem., Vol. 11, No. 6, 2000

Ueno et al.

ODNs that enhance the thermal stability of ODN-RNA duplexes and that are also resistant to both exo- and endonucleases by the effect of the aminoalkyl-linker. In this paper, we report the synthesis of ODNs that contain 6′R-[N-(aminoalkyl)carbamoyloxy]-carbocyclicthymidines (4, 5, and 6). Stability of these ODNs to nucleolytic hydrolysis by snake venom phosphodiesterase and nuclease S1, and the thermal stability of duplexes of these ODNs with either the complementary DNA or RNA, were studied. RESULTS AND DISCUSSION

Figure 1. Structures of the modified nucleoside analogues and an atom-numbering system for 6′R-substituted-carbocyclicthymidines.

On the other hand, it has been reported that ODNs containing a carbocyclic-thymidine, where the furanose ring oxygen is replaced by a CH2 group, increase thermal stabilities of ODN-RNA duplexes, but nuclease stability against snake venom phosphodiesterase is inadequate for biological applications (15, 16). More recently, Altmann et al. reported that ODNs containing 6′R-aminobutoxycarbocyclic-thymidine are stable enough in 10% heatinactivated fetal calf serum although stability against endonuclease was not examined; however, they decrease thermal stabilities of ODN-RNA duplexes (17). It is well-known that naturally occurring polyamines, such as spermidine and spermine, bind strongly to DNAs (18-20) and stabilize duplex (21, 22) and triplex formation (23-25). The enhanced thermal stability of duplexes and triplexes is explained by the reduction of the anionic electrostatic repulsion between the phosphate moieties and the cationic amino groups. From these findings, we envisioned introducing an aminoalkyl-linker with a suitable length at the 6′R-position of a carbocyclic-nucleoside. If successful, we would then be able to synthesize the

Synthesis. The synthesis of ODNs containing 4, 5, or 6 was accomplished in a DNA synthesizer by using a suitably protected 6′R-[N-(2-aminoethyl)carbamoyloxy]carbocyclic-thymidine (14a), 6′R-[N-(4-aminobutyl)carbamoyloxy]-carbocyclic-thymidine (14b), or 6′R-[N-(6aminohexyl)carbamoyloxy]-carbocyclic-thymidine phosphoramidite (14c). The synthesis of the 3′-phosphoramidite derivatives 14a, 14b, and 14c is shown in Scheme 1. The hydroxyl group of the epoxide 7, which was prepared according to the literature procedure (26), was silylated using TIPSCl to give the triisopropylsilanyloxy derivative 8 in 90% yield. Treatment of 8 with thymine and NaH in DMF at 145 °C afforded the desired epoxideopened product 9 in 45% yield with a recovery of 8 in 27% yield. Hydrogenolysis of the benzyl group of 9 gave the diol derivative 10 in 82% yield. Then, the primary hydroxyl group of 10 was protected with a DMTr group to yield 11 in 90% yield. Compound 11 was converted into the carbonylimidazolide, which was reacted with 1,2diaminoethane, 1,4-diaminobutane, or 1,6-diaminohexane. Without purifying the products, the amino groups were protected with a trifluoroacetyl group to give 12a, 12b, and 12c in 84, 93, and 73% yields, respectively. After desilylation of 12a, 12b, and 12c by TBAF, 13a, 13b, and 13c were then phosphitylated by a standard procedure (27) to give the corresponding nucleoside 3′-phosphoramidites 14a, 14b, and 14c. An unmodified DNA octadecamer (control) and octadecamers containing 4, 5, or 6 were synthesized in a DNA synthesizer. The average coupling yields of 14a, 14b, and 14c were 98, 96, and 98%, respectively, using a 0.12 M

Scheme 1a

a (a) TIPSCl, imidazole, DMF, room temperature; (b) thymine, NaH, DMF, 145 °C; (c) H , 10% Pd-C, EtOH, room temperature; 2 (d) DMTrCl, pyridine, room temperature; (e) (1) N,N′-carbonyldiimidazole, DMAP, pyridine, room temperature; (2) H2N(CH2)nNH2 (n ) 2, 4, or 6), pyridine, room temperature; (3) EtOCOCF3, Et3N, pyridine, room temperature; (f) TBAF, THF, room temperature; (g) 2-cyanoethyl N,N-diisopropylchlorophosphoramidite, N,N-diisopropylethylamine, CH2Cl2, room temperature.

6′R-[N-(aminoalkyl)carbamoyloxy]-carbocyclic-thymidines

Bioconjugate Chem., Vol. 11, No. 6, 2000 935

Figure 2. Polyacrylamide gel electrophoresis of 5′-32P-labeled ODNs hydrolyzed by snake venom phosphodiesterase (a) 15; (b) 21E; (c) 21-B; (d) 21-H. ODNs were incubated with snake venom phosphodiesterase for 0 min (lane 1), 10 min (lane 2), 20 min (lane 3), 30 min (lane 4), 60 min (lane 5), and 120 min (lane 6). Experimental conditions are described in the Experimental Section. Table 1. Sequences of ODNsa ODNs 15 16-E, B, or H 17-E, B, or H 18-E, B, or H 19-E, B, or H 20-E, B, or H 21-E, B, or H 22 23

5′-d(MT)9-3′(control) 5′-d[(MT(MT)8]-3′ 5′-d[MT)7MTMT]-3′ 5′-d[(MT)4MT(MT)4]-3′ 5′-d[(MT)2MT(MT)3MT(MT)2]-3′ 5′-d[MT(MT)3MT(MT)2MTMT]-3′ 5′-d[MTMTMT(MT)2MTMTMTMT]-3′ 5′-d[TGGAGAGAGAGAGAGAGAGAGGGT]-3′ 5′-r[AGAGAGAGAGAGAGAGAGA]-3′

a E ) (T ) 4); B ) (T ) 5); H ) (T ) 6); M ) 5-methyl-2′deoxycytidine.

solution of the amidite derivatives in CH3CN and 600 s for the coupling time. The fully protected ODNs (each 1 µmol scale) linked to the solid supports were treated with concentrated NH4OH at 55 °C for 12 h. This was followed by C-18 column chromatography. Detritylation gave ODNs 15-21 (Table 1). Each ODN in this preparation showed a single peak by reversed-phase HPLC analysis. ODNs 18-E, 18-B, 18-H, 21-E, 21-B, and 21-H were analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS), and the observed molecular weights supported their structures. Partial Digestion of ODNs with Snake Venom Phosphodiesterase and Nuclease S1. Since resistance to nucleolytic hydrolysis by nucleases is an important factor in antisense studies, the stability of ODNs containing 4, 5, or 6 to nucleolytic digestion was examined. Two kinds of nucleases, snake venom phosphodiesterase (a 3′-exonuclease) and nuclease S1 (an endonuclease), were used in this study. ODNs 21-E, 21-B, and 21-H containing four molecules of 4, 5, or 6 were labeled at their 5′end with 32P and incubated with an appropriate nuclease, and the reactions were then analyzed by polyacrylamide gel electrophoresis under denaturing conditions (28). When snake venom phosphodiesterase was used in the reactions, the control ODN 15 was hydrolyzed randomly by the enzyme after 120 min of the incubation (Figure 2a). In contrast, the phosphodiester linkages at the 5′sides of 4, 5, and 6 were highly resistant to the enzyme (Figure 2, panels b, c, and d). Altmann et al. also reported that ODNs containing 6′R-aminobutoxy-carbocyclic-thymidine are stable in 10% heat-inactivated fetal calf (17). Several studies have demonstrated that 3′-exonuclease activities are the major cause of the degradation of

unmodified ODNs in serum (1). Thus, our data is consistent with the result reported by Altmann et al. Next, the ODNs were treated with nuclease S1. The phosphodiester linkages around 4, 5, and 6 were more resistant to enzymatic hydrolysis than those beside thymidine (Figure 3). The half-lives of ODN 15, 21-E, 21-B, and 21-H were 13, 37, 32, and 30 min, respectively. In our previous paper, we reported that the heptadecanucleotide containing four molecules of 2 was four times more stable to hydrolysis by nuclease S1 than an unmodified ODN. Also, the ODN containing 3 was about 90 times more stable to hydrolysis by DNase I. Therefore, it was found that the ODNs containing 4, 5, or 6 are as resistant to nuclease S1 (an endonuclease) as the ODN containing 2. UV Melting Studies of Duplexes. The stability of the duplexes composed of the octadecamers 15-21 and a complementary DNA, 5′-d[TGG AGA GAG AGA GAG AGA GAG GT]-3′ (22), was next studied by thermal denaturation in a buffer of 0.01 M sodium cacodylate (pH 7.0) containing 0.01 M NaCl. One transition was observed in the melting profile of each duplex. Melting temperatures (Tms) and the ∆T1m values [Tm(each ODN) Tm(the control ODN 15)] are listed in Table 2. The Tm values for the duplexes containing the nucleoside analogue 4 were greater than those of the control duplex (Tm ) 51.6 °C), except for the duplex comprised of ODN 16-E (∆T1m ) -0.3), but all of the Tm values for the duplexes containing analogue 5 or 6 were smaller than those of the control duplex. The stability of the duplexes was dependent on the number of the nucleoside analogues. The duplexes became more stable as the number of 4 increased, while the duplexes became less stable as the number of 5 or 6 increased. The duplexes consisting of ODNs 18-E containing one molecule of 4 at the center (∆T1m ) +2.0) were more stable than those composed of ODNs 16-E or 17-E containing 4 near either the 5′- or 3′-end (∆T1ms ) -0.3 and +1.2, respectively). A 4.5 °C increase in Tm was observed for ODNs 21-E containing four molecules of 4. The enhanced thermal stability of the duplexes containing 4 was thought to be due to a reduction of the electrostatic repulsion between phosphate moieties by the ammonium ion at the end of the N-(2-aminoethyl)carbamoyloxy linker. To confirm the effects of the N(aminoalkyl)carbamoyloxy linkers on the thermal stabilities of the duplexes, thermal denaturation was also performed under higher ionic strength (0.1 M NaCl). The

936 Bioconjugate Chem., Vol. 11, No. 6, 2000

Ueno et al.

Figure 3. Polyacrylamide gel electrophoresis of 5′-32P-labeled ODNs hydrolyzed by nuclease S1: (a) 15; (b) 21-E; (c) 21-B; (d) 21-H. ODNs were incubated with nuclease S1 for 0 min (lane 1), 10 min (lane 2), 20 min (lane 3), 30 min (lane 4), 60 min (lane 5), and 120 min (lane 6). Experimental conditions are described in the Experimental Section. Table 2. Hybridization Dataa ODN/DNb

d

ODN

0.01 M NaCl Tm (°C)

15 16-E 17-E 18-E 19-E 20-E 21-E 16-B 17-B 18-B 19-B 20-B 21-B 16-H 17-H 18-H 19-H 20-H 21-H

51.6 51.3 52.8 53.6 54.5 54.2 56.1 51.3 49.8 50.3 48.8 48.3 47.8 51.4 50.7 50.7 49.4 48.6 48.1

∆T1m d

ODN/RNc

(°C)

0.1 M NaCl Tm (°C)

∆T2m e

-0.3 +1.2 +2.0 +2.9 +2.6 +4.5 -0.3 -1.8 -1.3 -2.8 -3.3 -3.8 -0.2 -0.9 -0.9 -2.2 -3.0 -3.5

66.1 64.7 65.5 65.9 66.6 67.0 67.4 64.9 63.3 63.9 62.1 61.4 60.2 65.9 64.6 64.0 61.8 61.5 60.5

+14.5 +13.4 +12.7 +12.3 +12.1 +12.8 +11.3 +13.6 +13.5 +13.6 +13.3 +13.1 +12.4 +14.5 +13.9 +13.3 +12.4 +12.9 +12.4

(°C)

0.1 M NaCl Tm (°C) 64.0

∆T1m d (°C)

61.2 59.1 58.7 56.6

-2.8 -4.9 -5.3 -7.4

60.3 58.4 57.9 55.3

-3.7 -5.6 -6.1 -8.7

61.2 58.0 57.9 55.5

-2.8 -6.0 -6.1 -8.5

a Experimental conditions are described in the Experimental Section. b The complementary DNA, 22. c The complementary RNA, 23. ∆T1m ) [Tm(each ODN) - Tm(the control ODN 15)]. e ∆T2m ) [Tm(0.1 M NaCl) - Tm(0.01 M NaCl)].

∆T2m values obtained [Tm(0.1 M NaCl) - Tm(0.01 M NaCl)] were compared, as shown in Table 2. The ∆T2m values for the duplexes containing 4 were smaller than those for the control duplex (∆T2m ) +14.5). Furthermore, the ∆T2m values for the duplexes containing 4 seemed to decrease as the number of 4 increased. These results suggest that the terminal ammonium ions in 4 effectively neutralize the phosphate negative charges. On the other hand, the ∆T2m values for the duplexes containing 5 and 6 were also smaller than those for the control duplex, although the values were greater than those for the duplexes containing 4. This result implies that the terminal ammonium ions in 5 and 6 also contribute to neutralize the phosphate negative charges.

When the ODN analogues containing 4, 5, or 6 form duplexes with the complementary DNAs, the N-(2aminoethyl)carbamoyloxy, the N-(2-aminobutyl)carbamoyloxy, and the N-(2-aminohexyl)carbamoyloxy groups of 4, 5, or 6 should be accommodated in the minor grooves, since an O4′ position of a nucleoside is in the minor groove. The minor groove of a DNA-DNA duplex is known to be narrow and deep (29). Thus, the N-(2aminobutyl)carbamoyloxy and the N-(2-aminohexyl)carbamoyloxy groups of 5 and 6 may not be well accommodated in the minor groove of ODN-DNA duplex. This steric hindrance may offset the favorable electrostatic interactions of the aminoalkyl linkers of 5 and 6. On the other hand, in the central portion of the minor groove in

6′R-[N-(aminoalkyl)carbamoyloxy]-carbocyclic-thymidines

the native B-DNA dodecamer duplex, a spine of hydration was found to link with the nitrogen and oxygen atoms of some base moieties (30-32). Thus, another interpretation is that the bulky N-(aminoalkyl)carbamoyloxy groups of 5 and 6 may disorder the spine of hydration in the minor groove, while the small N-(aminoethyl)carbamoyloxy group of 4 may be well accommodated in the minor groove without disordering the spine of hydration. Duplex formation of the octadecamers with the complementary RNA, 5′-r[AGA GAG AGA GAG AGA GAG A]-3′ (23) was next studied by thermal denaturation in a buffer containing 0.1 M NaCl. As shown in Table 2, all of the Tm values for the duplexes that contain the nucleoside analogues 4, 5, or 6 were smaller than those of the control duplex (Tm ) 64.0 °C). The stability of the duplexes was dependent on the number of nucleoside analogues. The duplexes became less stable as the numbers of 4, 5, and 6 increased. The 6′R-substituents of the carbocyclic-thymidines could be readily accommodated within a standard A-type DNA-RNA because the minor groove of A-type duplexes is shallow and flat (29). Thus, the results seem to be at least not based on simple steric reasons for the aminoalkyl-linkers. It has been reported that ODNs containing stretches of contiguous 6′R-methyl-carbocyclic-thymidine slightly decrease the thermal stability of the duplexes with complementary RNAs, while those containing stretches of contiguous 6′R-hydroxy-carbocyclic-thymidine increase the thermal stability of ODN-RNA duplexes (32, 33). Thus, the duplex destabilization by the aminoalkyl-linkers might also be related to the release of water molecules from the minor grooves. CONCLUSION

In this paper, we have reported the synthesis of ODNs containing 6′R-[N-(aminoalkyl)carbamoyloxy]-carbocyclicthymidines (4, 5, and 6). Resistance of these ODNs to nuclease hydrolysis was examined by using snake venom phosphodiesterase (3′-exonuclease) and nuclease S1 (endonuclease). The ODNs that contain 4, 5, or 6 were more resistant to nucleolytic hydrolysis by both the enzymes than the unmodified ODNs. These nuclease-resistant properties are noteworthy, since they have natural phosphodiester linkages. The thermal stability of duplexes consisting of these ODNs and either the complementary DNA or RNA were studied by thermal denaturation. The ODNs that contain 4 were found to enhance the thermal stability of the duplexes with the complementary DNA, while those containing 5 or 6 decreased the thermal stability of the ODN-DNA duplexes. On the other hand, contrary to our expectation, it was found that all ODNs that contain 4, 5, or 6 decrease the thermal stability of the ODN-RNA duplexes. However, we believe that these results will serve as fundamental data for developing new antisense molecules. EXPERIMENTAL PROCEDURES

General Remarks. NMR spectra were recorded at 270 MHz (1H) and at 202 MHz (31P) and are reported in parts per million downfield from TMS or 85% H3PO4. J values are given in hertz. Mass spectra were obtained by fast-atom bombardment (FAB) method. Thin-layer chromatography was done on Merck coated plates 60F254. The silica gel or the neutralized silica gel used for column chromatography was Merck silica gel 5715 or ICN silica 60A, respectively. (1S,2S,3S,5R)-2-(Benzyloxymethyl)-3-(triisopropylsilanyloxy)-6-oxabicyclo[3,1,0]hexane (8). A mix-

Bioconjugate Chem., Vol. 11, No. 6, 2000 937

ture of (1S,2S,3S,5R)-2-(benzyloxymethyl)-6-oxabicyclo[3,1,0]hexan-3-ol (26) (1.28 g, 5.80 mmol), TIPSCl (3.72 mL, 17.4 mmol), and imidazole (2.37 g, 34.8 mmol) in DMF (60 mL) was stirred at room temperature. After 16 and 25 h, further amounts of TIPSCl (1.24 mL, 5.80 mmol) and imidazole (0.79 g, 11.6 mmol) were added to the mixture. After 63 h, EtOH (2 mL) was added to the mixture, and the whole was stirred for 10 min. The mixture was concentrated in vacuo and was taken in EtOAc, which was washed with aqueous NaHCO3 (saturated) and brine, dried (Na2SO4), and concentrated. The residue was purified by column chromatography (SiO2, 50% EtOAc in hexane) to give 8 (1.87 g, 85% as an oil): FAB-MS m/z 377 (MH+); 1H NMR (270 MHz, CDCl3) δ 7.35-7.28 (m, 5H), 4.50 (dd, J ) 16.7, 12.1, 2H), 4.26 (d, J ) 7.4, 1H), 3.52-3.40 (m, 4H), 2.39 (t, J ) 5.5, 1H), 2.12 (ddd, J ) 14.8, 7.4, 1.7, 1H), 1.96 (dd, J ) 14.8, 1.6, 1H), 1.05 (s, 3H), 1.02 (s, 18H). HRMS (FAB) calcd for C22H37O3Si: 377.2510. Found: 377.2495. (1S,2S,3S,4S)-1-[3-(Benzyloxymethyl)-2-(hydroxy)4-(triisopropylsilanyloxy)cyclopentyl]thymine (9). Thymine (4.04 g, 32.0 mmol) was added to a suspension of sodium hydride (60% oil dispersion, 213 mg, 5.33 mmol) in DMF (40 mL), and the mixture was stirred at room temperature. After 2 h, a solution of 8 (4.31 g, 10.7 mmol) in DMF (4 mL) was added to the mixture, and the whole was heated at 145 °C for 51 h. After the mixture was cooled, the mixture was partitioned between EtOAc and H2O. The organic layer was washed with brine, dried (Na2SO4), and evaporated under reduced pressure. The residue was purified by column chromatography (SiO2, 60% EtOAc in hexane) to give 9 (2.42 g, 45% as a pale yellow foam) with a recovery of 8 (1.09 g, 27%): FAB-MS m/z 503 (MH+); 1H NMR (270 MHz, CDCl3) δ 8.42 (br s, 1H), 7.35-7.29 (m, 5H), 7.00 (s, 1H), 4.64 (dd, J ) 17.7, 9.2, 1H), 4.53 (m, 2H), 4.31-4.19 (m, 2H), 3.79 (dd, J ) 9.0, 4.3, 1H), 3.62 (dd, J ) 9.0, 6.9, 1H), 2.95 (d, J ) 2.5, 1H), 2.30-2.00 (m, 3H), 1.87 (s, 3H), 1.03 (s, 21H). Anal. calcd for C27H42N2O5Si: C, 64.51; H, 8.42; N, 5.57. Found: C, 64.37; H, 8.35; N, 5.45. (1S,2S,3S,4S)-1-[2-(Hydroxy)-3-(hydroxymethyl)4-(triisopropylsilanyloxy)cyclopentyl]thymine (10). A mixture of 9 (1.53 g, 3.04 mmol) and Pd-C (10%, 2.02 g) in EtOH (180 mL) was stirred under atmospheric pressure of H2 at room temperature. After 10 h, the catalyst was filtered off with a Celite pad, and the filtrate was evaporated under reduced pressure. The residue was purified by column chromatography (SiO, 5% EtOH in EtOAc) to give 10 (1.03 g, 82% as a white powder): FABMS m/z 413 (MH+); 1H NMR (270 MHz, CDCl3) δ 10.63 (br s, 1H), 7.05 (s, 1H), 4.68 (m, 1H), 4.56 (m, 1H), 4.41 (m, 1H), 4.13 (m, 1H), 3.98 (d, J ) 11.2, 1H), 3.80 (m, 1H), 3.54 (br s, 1H), 2.60 (m, 1H), 1.98-1.94 (m, 2H), 1.82 (s, 3H), 1.06 (m, 21H). Anal. calcd for C20H36N2O5Si: C, 58.22; H, 8.79; N, 6.79. Found: C, 58.21; H, 8.67; N, 6.72. (1S,2S,3S,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)2-(hydroxy)-4-(triisopropylsilanyloxy)cyclopentyl]thymine (11). A mixture of 10 (400 mg, 0.969 mmol) and DMTrCl (394 mg, 1.16 mmol) in pyridine (10 mL) was stirred at room temperature. After 18 h, DMTrCl (98 mg, 0.291 mmol) was added further, and the mixture was stirred at room temperature for 1 h. EtOH (2 mL) was added to the mixture, and the whole was stirred for 10 min. The mixture was concentrated in vacuo and was taken in EtOAc, which was washed with aqueous NaHCO3 (saturated) and brine, dried (Na2SO4), and concentrated. The residue was purified by column chromatography (SiO2, 50% EtOAc in hexane) to give 11 (622 mg, 90% as a white foam): FAB-MS m/z 714 (M+); 1H NMR

938 Bioconjugate Chem., Vol. 11, No. 6, 2000

(270 MHz, CDCl3) δ 8.01 (s, 1H), 7.39-7.24 (m, 9H), 6.99 (d, 1H), 6.84 (s, 2H), 6.81 (s, 2H), 4.56 (dd, J ) 17.7, 9.0, 1H), 4.20 (td, J ) 9.0, 2.7, 1H), 4.11 (dd, J ) 11.1, 6.7, 1H), 3.79 (s, 6H), 3.60 (dd, J ) 9.0, 4.3, 1H), 3.19 (m, 1H), 3.13 (d, J ) 2.7, 1H), 2.30-2.04 (m, 3H), 1.91 (s, 3H), 0.95-0.94 (m, 21H). HRMS (FAB) calcd for C41H54N2O7Si: 714.3696. Found: 714.3677. Anal. calcd for C41H54N2O7Si: C, 68.88; H, 7.61; N, 3.92. Found: C, 68.79; H, 7.69; N, 3.87. (1S,2S,3S,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)2-[N-[2-(trifluoroacetamido)ethyl]carbamoyloxy]-4(triisopropylsilanyloxy)cyclopentyl]thymine (12a). N,N′-Carbonyldiimidazole (272 mg, 1.68 mmol) and DMAP (68 mg, 0.559 mmol) were added to a solution of 11 (600 mg, 0.839 mmol) in pyridine (15 mL), and the mixture was stirred at room temperature. After 3 h, 1,2diaminoethane (280 µL, 4.20 mmol) was added to the mixture, which was stirred at room temperature. After 14 h, ethyl trifluoroacetate (3.01 mL, 25.2 mmol) and Et3N (3.51 mL, 25.2 mmol) were added to the mixture, and the whole was stirred at room temperature. After 24 h, the mixture was concentrated in vacuo and was taken in EtOAc, which was washed with H2O and brine, dried (Na2SO4), and concentrated. The residue was purified by column chromatography (SiO2, 50% EtOAc in hexane) to give 12a (629 mg, 84% as a white foam): FABMS m/z 896 (M+); 1H NMR (270 MHz, CDCl3) δ 8.92 (br s, 1H), 7.90 (br s, 1H), 7.42-7.19, 6.84, 6.81 (m, 13H), 7.02 (s, 1H), 5.32 (m, 1H), 5.12 (m, 2H), 4.23 (br s, 1H), 3.79 (s, 3H), 3.78 (s, 3H), 3.51-3.20 (m, 6H), 2.21-2.01 (m, 3H), 1.82 (s, 3H), 0.98 (m, 21H). HRMS (FAB) calcd for C46H59F3N4O9Si: 896.4003. Found: 896.3978. Anal. calcd for C46H59F3N4O9Si: C, 61.59; H, 6.63; N, 6.25. Found: C, 61.34; H, 6.63; N, 6.15. (1S,2S,3S,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)2-[N-[4-(trifluoroacetamido)butyl]carbamoyloxy]-4(triisopropylsilanyloxy)cyclopentyl]thymine (12b). Compound 11 (425 mg, 0.594 mmol) was aminobutylcarbamoylated by using 1,4-diaminobutane (298 µL, 2.97 mmol) as described in the preparation of 12a to give 12b (512 mg, 93% as a white foam): FAB-MS m/z 924 (M+); 1H NMR (270 MHz, CDCl ) δ 8.44 (br s, 1H), 7.42-7.21, 3 6.84, 6.80 (m, 13 H), 7.04 (s, 1H), 5.27-5.21 (m, 2H), 4.77 (m, 1H), 4.25 (m, 1H), 3.79 (s, 3H), 3.78 (s, 3H), 3.34 (m, 4H), 3.25 (m, 1H), 3.06 (m, 1H), 2.20 (m, 1H), 2.14-2.08 (m, 2H), 1.84 (s, 3H), 1.57 (m, 4H), 0.97 (m, 21H). HRMS (FAB) calcd for C48H63F3N4O9Si: 924.4312. Found: 924.4331. Anal. calcd for C48H63F3N4O9Si: C, 62.32; H, 6.86; N, 6.06. Found: C, 62.20; H, 6.98; N, 5.88. (1S,2S,3S,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)2-[N-[6-(trifluoroacetamido)hexyl]carbamoyloxy]4-(triisopropylsilanyloxy)cyclopentyl]thymine (12c). Compound 11 (600 mg, 0.839 mmol) was aminohexylcarbamoylated by using 1,6-diaminohexane (488 mg, 4.20 mmol) as described in the preparation of 12a to give 12c (584 mg, 73% as a white foam): FAB-MS m/z 952 (M+); 1H NMR (270 MHz, CDCl ) δ 8.18 (m, 1H), 7.43-7.21, 3 6.84, 6.80 (m, 13H), 7.07 (s, 1H), 5.32 (m, 1H), 5.22 (m, 1H), 4.74 (m, 1H), 4.20 (m, 1H), 3.79 (s, 6H), 3.40-3.26 (m, 4H), 3.21 (m, 1H), 3.02 (m, 1H), 2.18 (m, 1H), 2.142.00 (m, 2H), 1.87 (s, 3H), 1.54-1.23 (m, 8H), 0.97-0.95 (m, 21H). HRMS (FAB) calcd for C50H67F3N4O9Si: 952.4625. Found: 952.4617. Anal. calcd for C50H67F3N4O9Si: C, 63.00; H, 7.08; N, 5.88. Found: C, 63.03; H, 7.05; N, 5.72. (1S,2S,3R,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)4-(hydroxy)-2-[N-[2-(trifluoroacetamido)ethyl]carbamoyloxy]cyclopentyl]thymine (13). A mixture of 12a (617 mg, 0.688 mmol) and TBAF (1 M in THF, 2.06

Ueno et al.

mL, 2.06 mmol) in THF (6 mL) was stirred at room temperature for 4 h. The mixture was partitioned between EtOAc and H2O. The organic layer was washed with brine, dried (Na2SO4), and evaporated under reduced pressure. The residue was purified by column chromatography (SiO2, 90% AcOEt in hexane) to give 13a (476 mg, 93% as a white foam): FAB-MS m/z 741 (MH+); 1 H NMR (270 MHz, CDCl3) δ 9.28 (br s, 1H), 7.89 (br s, 1H), 7.40-7.20, 6.85, 6.82 (m, 13H), 6.97 (s, 1H), 5.34 (br s, 1H), 5.26 (dd, J ) 17.5, 8.9, 1H), 4.90 (t, J ) 7.6, 1H), 4.29 (br s, 1H), 3.79 (s, 6H), 3.52-3.16 (m, 6H), 2.84 (br s, 1H), 2.29 (m, 1H), 2.23-2.17 (m, 2H), 1.79 (s, 3H). HRMS (FAB) calcd for C37H40F3N4O9: 741.2745. Found: 741.2752. (1S,2S,3R,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)4-(hydroxy)-2-[N-[4-(trifluoroacetamido)butyl]carbamoyloxy]cyclopentyl]thymine (13b). Compound 12b (512 mg, 0.553 mmol) was desilylated as described in the preparation of 13a to give 13b (411 mg, 97% as a white foam): FAB-MS m/z 769 (MH+); 1H NMR (270 MHz, CDCl3) δ 8.80 (s, 1H), 7.41-7.20, 6.85, 6.82 (m, 13H), 6.97 (s, 1H), 5.18 (dd, J ) 17.5, 9.1, 1H), 4.97 (m, 1H), 4.90 (m, 1H), 4.29 (m, 1H), 3.79 (s, 6H), 3.46 (dd, J ) 9.4, 4.0, 1H), 3.32-3.20 (m, 4H), 3.02 (m, 1H), 2.63 (br s, 1H), 2.28 (m, 1H), 2.19 (m, 2H), 1.81 (s, 3H), 1.571.40 (m, 4H). HRMS (FAB) calcd for C39H44F3N4O9: 769.3057. Found: 769.3078. Anal. calcd for C39H43F3N4O9: C, 60.93; H, 5.64; N, 7.29. Found: C, 60.92; H, 5.53; N, 7.13. (1S,2S,3R,4S)-1-[3-(4,4′-Dimethoxytrityloxymethyl)4-(hydroxy)-2-[N-[6-(trifluoroacetamido)hexyl]carbamoyloxy]cyclopentyl]thymine (13c). Compound 12c (590 mg, 0.619 mmol) was desilylated as described in the preparation of 13a to give 13c (468 mg, 95% as a white foam): FAB-MS m/z 797 (MH+); 1H NMR (270 MHz, CDCl3) δ 8.70 (br s, 1H), 7.41-7.19, 6.85, 6.82 (m, 13H), 6.98 (s, 1H), 5.12-5.02 (m, 2H), 4.85 (t, J ) 5.9, 1H), 4.26 (m, 1H), 3.79 (s, 6H), 3.45 (dd, J ) 9.2, 4.0, 1H), 3.33-2.94 (m, 5H), 2.57 (br s, 1H), 2.24 (m, 1H), 2.16 (m, 2H), 1.84 (s, 3H), 1.51 (m, 2H), 1.41 (m, 2H), 1.27 (m, 4H). HRMS (FAB) calcd for C41H48F3N4O9: 797.3370. Found: 797.3378. Anal. calcd for C41H47F3N4O9: C, 61.80; H, 5.94; N, 7.03. Found: C, 61.93; H, 5.94; N, 6.94. (1S,2S,3S,4S)-1-[4-(2-Cyanoethoxy-N,N-diisopropylaminophosphinyl)-3-(4,4′-dimethoxytrityloxymethyl)-2-[N-[2-(trifluoroacetamido)ethyl]carbamoyloxy]cyclopentyl]thymine (14a). Compound 13a (291 mg, 0.393 mmol) was dissolved in CH2Cl2 (4 mL) containing N,N-diisopropylethylamine (137 µL, 0.786 mmol). Chloro(2-cyanoethoxy)(N,N-diisopropylamino)phosphine (132 µL, 0.590 mmol) was added to the solution, and the reaction mixture was stirred at room temperature for 1 h. Aqueous NaHCO3 (saturated) and CHCl3 were added to the mixture, and the separated organic layer was washed with aqueous NaHCO3 (saturated) and brine, dried (Na2SO4), and concentrated. The residue was purified by column chromatography (a neutralized SiO2, 60% AcOEt in hexane) to give 14a (300 mg, 81% as a white foam): FAB-MS m/z 941 (MH+); 31P NMR δ 148.47, 148.06. HRMS (FAB) calcd for C46H57F3N6O10P: 941.3822. Found: 941.3819. (1S,2S,3S,4S)-1-[4-(2-Cyanoethoxy-N,N-diisopropylaminophosphinyl)-3-(4,4′-dimethoxytrityloxymethyl)-2-[N-[4-(trifluoroacetamido)butyl]carbamoyloxy]cyclopentyl]thymine (14b). Compound 13b (410 mg, 0.533 mmol) was phosphitylated as described in the preparation of 14a to give 14b (463 mg, 90% as a white foam): FAB-MS m/z 969 (MH+); 31P NMR δ 148.65,

6′R-[N-(aminoalkyl)carbamoyloxy]-carbocyclic-thymidines

148.42. HRMS (FAB) calcd for C48H61F3N6O10P: 969.4135. Found: 969.4123. (1S,2S,3S,4S)-1-[4-(2-Cyanoethoxy-N,N-diisopropylaminophosphinyl)-3-(4,4′-dimethoxytrityloxymethyl)-2-[N-[6-(trifluoroacetamido)hexyl]carbamoyloxy]cyclopentyl]thymine (14c). Compound 13c (437 mg, 0.548 mmol) was phosphitylated as described in the preparation of 14a to give 14c (443 mg, 81% as a white foam): FAB-MS m/z 997 (MH+); 31P NMR δ 148.74, 148.66. HRMS (FAB) calcd for C50H65F3N6O10P: 997.4448. Found: 997.4431. Synthesis of ODNs. ODNs were synthesized on a DNA synthesizer (Applied Biosystem model 381A) by the phosphoramidite method. The fully protected ODNs were then deblocked and purified by the same procedure as for the purification of normal ODNs. That is, each ODN linked to the resin was treated with concentrated NH4OH at 55 °C for 12 h, and the released ODN protected by a DMTr group at the 5′-end was chromatographed on a C-18 silica gel column (1 × 10 cm, Waters) with a linear gradient of MeCN from 0 to 30% in 0.1 M TEAA buffer (pH 7.0). The fractions were concentrated, and the residue was treated with aqueous 80% AcOH at room temperature for 20 min, then the solution was concentrated, and the residue was coevaporated with H2O. The residue was dissolved in H2O and the solution was washed with Et2O, then the H2O layer was concentrated to give a deprotected ODN 16-E (49), 17-E (55), 18-E (51), 19-E (46), 20-E (49), 21-E (38), 16-B (54), 17-B (53), 18-B (55), 19-B (45), 20-B (42), 21-B (46), 16-H (50), 17-H (49), 18-H (54), 19-H (35), 20-H (52), and 21-H (43). The yields are indicated in parentheses as OD units at 260 nm starting from 1 µmol scale. Matrix-Assisted Laser Desorption/Ionization Timeof-Flight Mass Spectrometry. Spectra were obtained on a Voyager Elite reflection time-of-flight mass spectrometry (PerSeptive Biosystems, Inc., Framingham, MA) equipped with a nitrogen laser (337 nm, 3-ns pulse). 3-Hydroxypicolinic acid (HPA), dissolved in H2O to give a saturated solution at room temperature, was used as the matrix. Time-to-mass conversion was achieved by calibration by using the peak representing the C+ cation of the charged derivative to be analyzed. ODN 18-E: calcd mass, 5505; obsd mass, 5501. ODN 18-B: calcd mass, 5533; obsd mass, 5529. ODN 18-H: calcd mass, 5561; obsd mass, 5557. ODN 21-E: calcd mass, 5805; obsd mass, 5801. ODN 21-B: calcd mass, 5917; obsd mass, 5913. ODN 21-H: calcd mass, 6030; obsd mass, 6027. Partial Hydrolysis of ODNs with Snake Venom Phosphodiesterase. Each ODN labeled with 32P at the 5′-end (10 pmol) was incubated with snake venom phosphodiesterase (0.4 µg) in the presence of Torula RNA (0.15 OD260 units) in a buffer containing 37.5 mM TrisHCl (pH 8.0) and 7.5 mM MgCl2 (total 20 µL) at 37 °C. At appropriate periods, aliquots of the reaction mixture were separated and added to a solution of EDTA (5 mM, 10 µL), then the mixture was heated at 100 °C for 5 min. The solutions were analyzed by electrophoresis on 20% polyacrylamide gel containing 7 M urea (28). Densities of radioactivity of the gel were visualized by a Bioimaging Analyzer (Bas 2000, Fuji, Co. Ltd.). Partial Hydrolysis of ODNs with Nuclease S1. Each ODN labeled with 32P at the 5′-end (10 pmol) was incubated with nuclease S1 (0.2 units) in the presence of Torula RNA (0.54 OD260 units) in a buffer containing 30 mM sodium acetate (pH 4.6), 1 mM ZnSO4, and 280 mM NaCl (total 20 µL) at 37 °C. At appropriate periods, aliquots of the reaction mixture were separated and

Bioconjugate Chem., Vol. 11, No. 6, 2000 939

added to a solution of EDTA (5 mM, 10 µL), then the solutions were heated for 5 min at 100 °C. The solutions were analyzed by gel electrophoresis as described above. Thermal Denaturation. Each solution contains each ODN (3 µM) and the complementary DNA 22 (3 µM) or RNA 23(3 µM) in an appropriate buffer. The solution containing each ODN was heated at 90 °C for 5 min, then cooled gradually to an appropriate temperature, and used for the thermal denaturation studies. Thermal-induced transitions of each mixture were monitored at 260 nm on a Perkin-Elmer Lambda2S. Sample temperature was increased 0.5 °C/min. ACKNOWLEDGMENT

This work was supported in part by a Grant-in-Aid for Encouragement of Young Scientists from the Ministry of Education, Science, Sports, and Culture of Japan and a Grant from “Research for the Future” Program of the Japan Society for the Promotion of Science (JSPSRFTF97I00301). LITERATURE CITED (1) Uhlmann, E., and Peyman, A. (1990) Antisense oligonucleotides: a new therapeutic principle. Chem. Rev. 90, 544-584. (2) Milligan, J. F., Matteucci, M. D., and Martin, J. C. (1993) Current concepts in antisense drug design. J. Med. Chem. 36, 1923-1937. (3) Branch, A. D. (1998) A good antisense molecule is hard to find. Trends Biochem. Sci. 23, 45-50. (4) Stein, C. A. (1999) Keeping the biotechnology of antisense in context. Nat. Biotechnol. 17, 209. (5) Mesmaeker, A. D., Altmann K.-H., Waldner, A., and Wendeborn, S. (1995) Backbone modifications in oligonucleotides and peptides nucleic acid systems. Curr. Opin. Struct. Biol. 5, 343-355, and references therein. (6) Kibler-Herzog, L., Zon, G., Uznanski, B., Whittier, G., and Wilson, M. D. (1991) Duplex stabilities of phosphorthioate, methylphosphonate, and RNA analogues of two DNA 14mers. Nucleic Acids Res. 19, 2979-2986. (7) Guvakova, M. A., Yakubov, L. A., Vlodavsky, I., Tonkinson, J. L., and Stein C. A. (1995) Phosphorothioate oligodeoxynucleotides bind to basic fibroblast growth factor, inhibit its binding to cell surface receptors, and remove it from low affinity binding sites on extracelluar matrix. J. Biol. Chem. 270, 2620-2627. (8) Rockwell, P., O’Connor, W. J., King, K., Goldstein, N. I., Zhang, L. M., and Stein, C. A. (1997) Cell-surface perturbations of the epidermal growth factor and vascular endothelial growth factor receptors by phosphorothioate oligodeoxynucleotides. Proc. Natl. Acad. Sci. U.S.A. 94, 6523-6528. (9) Agrawal, S., and Zhao, Q. (1998) Antisense therapeutics. Curr. Opin. Chem. Biol. 2, 519-528. (10) Ono, A., Dan, A., and Matsuda, A. (1993) Synthesis of oligonucleotides carrying linker groups at the 1′-position of sugar residues. Bioconjugate Chem. 4, 499-508. (11) Ono, A., Haginoya, N., Kiyokawa, M., Minakawa, N., and Matsuda, A. (1994) A novel and convenient postsynthetic modification method for the synthesis of oligodeoxyribonucleotides carrying amino linkers at the 5-position of 2′-deoxyuridine. Bioorg. Med. Chem. Lett. 4, 361-366. (12) Haginoya, N., Ono, A., Nomura, Y., Ueno, Y., and Matsuda, A. (1997) Synthesis of oligodeoxyribonucleotides containing 5-(N-aminoalkyl)carbamoyl-2′-deoxyuridines by a new postsynthetic modification method and theri thermal stability and nuclease-resistance properties. Bioconjugate Chem. 8, 271280. (13) Ueno, Y., Kumagai, I., Haginoya, N., and Matsuda, A. (1997) Effects of 5-(N-aminohexyl)carbamoyl-2′-deoxyuridine on endonuclease stability and an ability of oligodeoxynucleotide to activate RNase H. Nucleic Acids Res. 25, 3777-3782. (14) Kanazaki, M., Ueno, Y., Shuto, S., and Matsuda, A. (2000) Highly nuclease-resistant phosphodiester-type oligodeoxynucleotides containing 4′R-C-aminoalkylthymidines form ther-

940 Bioconjugate Chem., Vol. 11, No. 6, 2000 mally stable duplexes with DNA and RNA. A candidate for potent antisense molecules. J. Am. Chem. Soc. 122, 24222432. (15) Perbost, M., Lucas, M., Chavis, C., Pompon, A., Baumgartner, H., Rayner, B., Griengl, H., and Imbach, J.-L. (1989) Sugar modified oligonucleotides I. Carbo-oligodeoxynucleotides as potential antisense agents. Biochem. Biophys. Res. Commun. 165, 742-747. (16) Sa´gi, J., Szemzo˜, A., Sze´csi, J., and O ¨ tvo¨s, L. (1990) Biochemical properties of oligo[(+)-carbocyclic-thymidylates] and their complexes. Nucleic Acids Res. 18, 2133-2140. (17) Altmann, K.-H., Be´vierre, M.-O., Mesmaeker, A. D., and Moser, H. E. (1995) The evaluation of 2′- and 6′-substituted carbocyclic nucleosides as building blocks for antisense oligonucleotides. Bioorg. Med. Chem. Lett. 5, 431-436. (18) Tabor, C. W., and Tabor, H. (1976) 1,4-Diaminobutane (putrescine), spermidine, and spermine. Annu. Rev. Biochem. 45, 285-306. (19) Tabor, C. W., and Tabor, H. (1984) Polyamines. Annu. Rev. Biochem. 53, 749-790. (20) Etter, M. C. (1990) Encoding and decoding hydrogen-bond patterns of organic compounds. Acc. Chem. Res. 23, 120-126. (21) Tabor, H. (1962) Protective effect of spermine and other polyamines against heat denaturation of deoxyribonucleic acid. Biochemistry 1, 496-501. (22) Thomas, T. J., and Bloomfield, V. A. (1984) Ionic and structural effects on the thermal helix-coil transition of DNA complexed with natural and synthetic polyamines. Biopolymers 23, 1295-1306. (23) Hampel, K. J., Crosson, P., and Lee, J. S. (1991) Polyamines favor DNA triplex formation at neutral pH. Biochemistry 30, 4455-4459. (24) Thomas, T., and Thomas, T. J. (1993) Selectivity of polyamines in triplex DNA stabilization. Biochemistry 32, 14068-14074.

Ueno et al. (25) Musso, M., and Van Dyke, M. W. (1995) Polyamine effects on purine-purine-pyrimidine triple helix formation by phosphodiester and phosphorothioate oligodeoxyribonucleotides. Nucleic Acids Res. 23, 2320-2327. (26) Biggadike, K., Borthwick, A. D., Evans, D., Exall, A. M., Kirk, B. A., Roberts, S. M., Stephenson, L., and Youds, P. (1988) Use of diethylaminosulphur trifluoride (DAST) in the preparation of synthons of carbocyclic nucleosides. J. Chem. Soc., Perkin Trans. 1, 549-554. (27) Gait, M. J., Ed. (1984) Oligonucleotides synthesis: a practical approach. IRL Press, Oxford, U.K. (28) Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular cloning: a laboratory manual, Cold Spring Harbor University Press, Plainview, NY. (29) Saenger, W. (1984) Principle of nucleic acid structure, Springer-Verlag, New York. (30) Drew, H. R., and Dickerson, R. E. (1981) Structure of a B-DNA dodecamer. III. Geometry of hydration. J. Mol. Biol. 151, 535-556. (31) Kopka, M. L., Fratini, A. V., Drew, H. R., and Dickerson, R. E. (1983) Ordered water structure around a B-DNA dodecamer. A quantitative study. J. Mol. Biol. 163, 129-146. (32) Portmann, S., Altmann, K.-H., Reynes, N., and Egli, M. (1997) Crystal structure of oligodeoxyribonucleotides containing 6′-R-methyl and 6′-R-hydroxy carbocyclic thymidines. J. Am. Chem. Soc. 119, 2396-2403. (33) Altmann, K.-H., Kesselring, R., and Pieles, U. (1996) 6′Carbon-substituted carbocyclic analogues of 2′-deoxyribonucleosides - Synthesis and effect on DNA/RNA duplex stability. Tetrahedron 52, 12699-12722.

BC0000684