N16, a Nacreous Protein, Inhibits Osteoclast Differentiation and

Article pubs.acs.org/jnp

N16, a Nacreous Protein, Inhibits Osteoclast Differentiation and Enhances Osteogenesis Jie-Yi Ma,†,‡ Ka-Lok Wong,§ Zhen-Yan Xu,†,‡ Ka-Yee Au,§ Nga-Lam Lee,§ Chang Su,†,⊥ Wei-Wei Su,† Pei-Bo Li,*,† and Pang-Chui Shaw*,§ †

ShenZhen Research Institute, Sun Yat-Sen University, ShenZhen, 518057, People’s Republic of China Guangzhou Quality R&D Center of Traditional Chinese Medicine, Guangdong Key Laboratory of Plant Resources, School of Life Sciences, Sun Yat-Sen University, Guangzhou, 510275, People’s Republic of China § State Key Laboratory of Phytochemistry and Plant Resources in West China (CUHK), LDS YYC R & D Centre for Chinese Medicine and School of Life Sciences, The Chinese University of Hong Kong, Hong Kong, People’s Republic of China ⊥ State Key Laboratory of Biocontrol (Sun Yat-Sen University) R&D ShenZhen Center, ShenZhen, 518057, People’s Republic of China ‡

ABSTRACT: N16 is a protein from the nacreous layer of Pinctada f ucata, a pearl oyster. It has been found to promote biomineralization, and we hypothesized that it also plays a role in bone metabolism. The cDNA of N16 was cloned and expressed in Escherichia coli to produce N16 protein, which was purified to high homogeneity by ion-exchange and gel filtration columns. The effects of N16 on osteoclast differentiation and osteogenesis were clarified using the murine preosteoclast cell line RAW 264.7 and the preosteoblast cell line MC3T3-E1. Results on preosteoclasts showed that N16 only slightly inhibited cell survival but significantly inhibited differentiation induced by receptor activator of nuclear factor kappa-B ligand (RANKL). Apart from reduced formation of multinucleated osteoclasts, N16-treated cells exhibited lower gene expression and enzymatic activity typical of mature osteoclasts. Actin ring formation and intracellular acidification essential for osteoclastic function were also impaired upon N16 treatment. At concentrations nontoxic to preosteoblasts, N16 strongly up-regulated alkaline phosphatase activity and increased mineralized nodule formation, which are indicative of differentiation into osteoblasts. These effects coincided with an increase in mRNA expression of osteoblast markers osteopotin and osteocalcin. The present study demonstrated that N16 has both anabolic and antiresorptive effects on bone, which makes it potentially useful for treating osteoporosis.

O

limitations have provided an incentive to search for new and safe drugs for osteoporosis treatment. Nacre (mother of pearl) is a composite of calcium carbonate crystals in an aragonite structure. The matrix proteins in nacre are important for biomineralization of pearl oyster by acting as a negative or positive regulator in calcification during shell formation.8−11 Matrix proteins can be separated into two components: water-soluble matrix proteins (WSM) and waterinsoluble matrix proteins (WISM). Recently, increasing attention has been paid to bone repairing activities of WSM including osteoblast differentiation and bone formation. WSM increased alkaline phosphatase (ALP) activity in the osteoblast, prolonged its life via stimulating the production of Bcl-2,12,13 and sped up the differentiation and mineralization of MC3T3E1.14,15 WSM obtained from Pteria martensii was reported to display dual regulatory effects by inducing osteoblast

steoporosis, a bone disease characterized by bone mass loss leading to enhanced bone fragility and higher bone fracture incidence,1 has become a major age-related problem. This bone disorder is caused by increased bone resorption over bone formation during the bone remodeling process.2 There are two major kinds of drug treatment for osteoporosis, namely, antiresorptive drugs (e.g., bisphosphonates, selective estrogen receptor modulators, and calcitonin), which slow down the differentiation and activity of osteoclast cells that break down old bone,3,4 and anabolic drugs, which stimulate osteoblasts to build new bone. To date, parathyroid hormone (PTH) is the only bone anabolic agent approved for clinical stimulation of bone formation in severe osteoporosis.5,6 Strontium ranelate has dual action, including antiresorptive and anabolic effects on bone.7 However, the treatment of osteoporosis remains a great challenge, as current treatment and drugs are expensive and have side effects including the risk of osteonecrosis of the jaw (biophosphonates), venous thromboembolism (selective estrogen receptor modulators), and osteosarcoma (PTH).7 These © XXXX American Chemical Society and American Society of Pharmacognosy

Received: September 25, 2015

A

DOI: 10.1021/acs.jnatprod.5b00854 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

biomineralization as well as inhibiting osteoclast formation.16 PFMG3, a protein purified from Pinctada f ucata, promoted the differentiation and mineralization of MC3T3-E1 cells.17 In vivo studies provided strong evidence of the biocompatibility and osteogenic activity of nacreous proteins.18,19 N16 is a protein first isolated from the nacreous layer of P. f ucata.20 Genome analysis revealed various kinds of N16 genes in P. f ucata, all of them comprising four exons and three introns.21 Recent reports showed that N16 could induce the formation of aragonite crystals when interacting with the nacre substrate and affect the morphology of calcium carbonate crystals in vitro.20,22,23 In view of the findings of WSM in pearl oyster in bone metabolism, we set forth to find if N16 takes part in bone resorption and formation.

significantly suppressed when RAW 264.7 cells were exposed to 5 to 40 μM N16 for 48 h or 2.5 to 40 μM N16 for 72 h, with IC50 values of 20 and 12 μM at 48 and 72 h, respectively (Figure 2). Concentrations of N16 without significant cytotoxic effect on RAW 264.7 cells (0.08 to 1.25 μM) were then selected to further investigate the differentiation-inhibiting effect of N16 in RAW 264.7 cells. N16 Inhibited the RANKL-Induced Osteoclastic Differentiation of RAW264.7 Cells. To explore the antiosteoporotic potential of N16, we sought to examine the effect of N16 on the differentiration of preosteoclast RAW 264.7 cells. Cells were induced for osteoclast differentiation in the presence of 2.58 nM RANKL and treated with N16 (0.08 to 1.25 μM) for 3 days. As expected, RANKL stimulated the expression of tartrate-resistant acid phosphatase (TRAP) (+), multinucleated cells indicating successful differentiation. Cells exposed to control (without RANKL) remained stained negative for TRAP (Figure 3A). The formation of osteoclasts induced by RANKL in RAW 264.7 cells was significantly inhibited by N16 in a dosedependent manner, as shown by the decreased number of TRAP (+) osteoclasts (Figure 3B) and lowered TRAP activity (Figure 3C), with IC50 values of 0.5 and 0.6 μM, respectively. Previously, Duplat and colleagues showed that nacreous proteins could reduce osteoclast bone resorption activity through the inhibition of capthesin K activity.27 The present study demonstrated for the first time that a single nacreous protein, N16, is capable of inhibiting osteoclastogenesis. These findings suggest that a single nacreous protein can suppress osteoclastic differentiation and prompted us to examine other osteoclast-associated activities upon treatment. N16 Inhibited the Expression of Genes Associated with Mature Osteoclasts. Results from quantitative real-time polymerase chain reaction (qPCR) assays measuring the expression levels of several osteoclast-associated genes were in agreement with the observation that N16 inhibited osteoclast differentiation. The tested genes were TRAP, c-Src, cathepsin K, and transcription factor NFATc1. The mRNA levels of these genes were significantly lowered in RANKL-stimulated RAW 264.7 cells by N16 in a dose-dependent manner. As shown in Figure 4, treatment with 1.25 μM N16 decreased the expression levels of TRAP, c-Src, cathepsin K, and NFATc1 genes to 0.41%, 13.99%, 0.61%, and 5.23%, respectively, compared to the “RANKL only” group. Cathepsin K is an osteoclast collagenolytic enzyme that plays a key role in the degradation of organic matrix in bone.28,29 Cathepsin K-deficient mice displayed an osteopetrotic phenotype, and osteoclasts extracted from these mice failed to degrade collagen fibers accumulated in the resorptive sealing zone; as a result, bone resorptive activity in vitro was severely impaired.30,31 Another osteoclastassociated gene, c-Src, is also required for osteoclastic bone resorption.32,33 Taken together, we showed that N16 was inhibitory to osteoclast maturation and lowered the bone resorptive activity of osteoclasts. NFATc1 was one of the transcription factors stimulated by RANKL through the mitogen-activated protein kinase (MAPK) pathway and consequently regulated the expression of genes required for osteoclast differentiation and bone resorption.34,35 We showed that the presence of N16 led to lower mRNA expression of NFATc1 (Figure 4). N16 Suppressed RANKL-Induced Osteoclastic Bone Resorption. Bone resorption is a typical characteristic of mature osteoclasts. The resorption pit assay has been widely used to evaluate osteoclast function.36 In this study, RAW264.7

■

RESULTS AND DISCUSSION Expression and Purification of N16. Nacre pieces are a useful biomaterial for bone repair. Several studies suggested that nacreous proteins could stimulate osteoblast differentiation and strengthen bone formation.12−15,24 N16, a nacreous protein, has an important role in the formation of nacre.20,22,23 Therefore, we are interested in finding its effects on osteoclast differentiation and osteogenesis. cDNA sequence of N16 (324 bp) without the signal peptide was amplified by polymerase chain reaction and cloned into a pET3a expression vector. The cDNA was sequenced to ensure the identity. The deduced amino acid sequence of N16 transcript represented a polypeptide of 108 amino acids (GenBank accession number KJ078646). It was then purified to high homogeneity by a HiTrap DEAE FF column followed by gel filtration on a Superdex 75 column (Figure 1). The identity of the purified protein was confirmed using N-terminal amino acid sequencing. The first five amino acids were AVHYK, which were identical to the cloned N16.

Figure 1. Purified N16 detected by SDS-PAGE. N16 protein was purified using HiTrap DEAE FF chromatography followed by gel filtration on a Superdex 75 column and revealed by 15% SDS-PAGE. Lane 1, protein marker; lane 2, N16-expression E. coli lysate; lane 3, protein purified by DEAE column; lane 4, purified N16.

N16 Is Slightlty Toxic to Preosteoclast RAW 264.7 Cells. Osteoclasts are derived from hematopoietic stem cells25 and involve in bone resorption. RAW 264.7 cells were selected in this study because they can differentiate into mature osteoclasts in response to receptor activator of nuclear factor kappa-B ligand (RANKL).26 An MTT assay was performed to determine the effect of N16 on the viability of RAW 264.7 cells. N16 was found to inhibit the survival of RAW 264.7 cells in time- and dose-dependent manners. The toxic effect on RAW 264.7 cells was observed on day 1 when N16 was administered at a concentration higher than 20 μM. Cell viability was B



Article

Figure 2. Viability of RAW 264.7 cells treated with N16. Survival of RAW 264.7 cells was significantly inhibited in a time- and dose-dependent manner when treated with N16 (>2.5 μM). Data are expressed as the percentage of vehicle control (*p < 0.05, **p < 0.01, ***p < 0.001 compared to vehicle control).

Figure 3. N16 inhibited the RANKL-stimulated differentiation of osteoclasts in RAW 264.7 cells. (A) RAW 264.7 cells were incubated with different concentrations of N16 (0.08 to 1.25 μM) with or without 2.58 nM RANKL for 3 days. TRAP (+) multinucleated osteoclasts were detected by TRAP staining. Scale bar represents 200 μm. Arrows indicate TRAP (+) cells. (B) TRAP (+) multinucleated cells and (C) TRAP activities in RAW 264.7 cells induced by RANKL on day 3 were decreased by N16. Scale bar represents 200 μm. Data are presented as the percentage decrease with reference to the group “RANKL only” (###p < 0.001, compared to group “no RANKL”; *p < 0.05, **p < 0.01, ***p < 0.001, compared to group “RANKL only”).

C



Article

Figure 4. Effect of N16 on the relative mRNA expression of osteoclast-associated marker genes in RAW 264.7 cells. Data represent relative mRNA expression of NFATc1, TRAP, c-Src, and cathepsin K (mean ± SD) to “no RANKL” from three independent experiments. Statistical analysis was performed using Graph Pad Prism 5 with one-way ANOVA followed by Dunnett’s multiple comparison test (###p < 0.001, compared to group “no RANKL”; *p < 0.05, **p < 0.01, ***p < 0.001, compared to group “RANKL only”).

N16 Enhanced the Differentiation and Osteogenesis of Preosteoblast MC3T3-El Cells. With the above results revealing the suppression of preosteoclasts by N16, we then investigated the effect of N16 on osteogenesis using the preosteoblast MC3T3-E1 cell line. MC3T3-E1 cells were chosen since they produce mineralization deposits when induced to differentiate by 0.283 mM ascorbic acid and 10 mM β-glycerophosphate.40 We observed that N16 did not affect the viability of preosteoblasts (Figure 7A) but increased the mRNA expression levels of the osteoblast-specific genes osteopotin (OPN) and osteocalcin (OCN) (Figure 7B). These data suggested that N16 is able to enhance osteoblast differentiation. N16 Promoted ALP Activity and Biomineralization. Active osteoblasts are known to possess high biomineralization and alkaline phosphatase levels. Since ALP is one of the early markers of MC3T3-E1 osteoblast differentiation,40 MC3T3-E1 cells were cultured in differentiation medium and treated with various amounts of N16 to determine its effects on osteoblastassociated activities. Although N16 did not enhance the viability of MC3T3-E1 cells (Figure 7A), an increased ALP activity was observed on day 4 of N16 treatment (Figure 8A). Our results show that N16 exerted a dose-dependent enhancing effect on ALP activity by causing increased activity of 18.5%, 20.5%, and 26.4% at 0.6, 1.25, and 2.5 μM, respectively, compared to the vehicle control (Figure 8A). Mature osteoblasts regulate the local concentration of calcium, phosphate, and the synthesis of extracellular matrix for bone formation.41 In this study, we carried out in vitro

cells subjected to RANKL-induced differentiation were examined by the resorption pit assay to determine the antiresorptive effect of N16. In the presence of N16, RANKL-stimulated RAW264.7 cells showed retarded differentiation and the area of resorbed pit was decreased, confirming that N16 was suppressive to osteoclast maturation and resulted in lower bone resorption (Figure 5A). Our results demonstrated that N16 treatment led to reduced osteoclastic bone resorption by 62% at 0.2 μM (Figure 5B). Intracellular acidification is reported to be necessary for osteoclastic bone resorption.37,38 Observations from acrdine orange staining showed that upon successful differeniation, RANKL-induced cells formed giant cells with multiple green nuclei and red acidic regions on the cell periphery, whereas N16-treated cells displayed decreased acidification and cell fusion was less evident (Figure 6A). By acridine orange staining, we showed that N16 reduced the low pH regions within RANKL-induced cells (Figure 6A), suggesting the potential of N16 as an antiosteoporosis agent. An actin ring is a typical ring-like structure of the filament. In actively resorptive osteoclasts, the integrity and size of actin rings are essential for the sealing zone, where bone resorption takes place.39 As shown in Figure 6B, the presence of N16 resulted in impaired actin ring formation, and the extent of disruption increased with N16 concentration. These findings strongly suggested that N16 did suppress the differentiation of preosteoclasts. At the next stage, we will find out if N16 perturbs the interaction between RANK and RANKL. D



Article

Figure 6. N16 inhibited the RANKL-induced intracellular acidification and actin ring formation essential for osteoclastic bone resorption in RAW 264.7 cells. (A) Acidification region was stained with acridine orange after RAW 264.7 cells were incubated in 0.2 μM N16. Under a confocal microscope, DNA was visualized as green fluorescence and the acidification region as red fluorescence. Occurrence of the acidification region was decreased by N16 treatment compared with RANKL control. Scale bar represents 100 μm. (B) Actin rings formed in osteoclasts were detected by phalloidin-FITC staining and observed under a fluorescence microscope upon treatment with N16 and RANKL. Scale bar represents 200 μm. Arrows indicate actin rings. Number and size of actin rings observed in groups treated with both RANKL and N16 were decreased, and the inhibition increased with N16 concentration.

Figure 5. N16 suppressed the RANKL-induced osteoclastic bone resorption of RAW 264.7 cells. (A) Resorption pit formation was observed under light microscope upon N16 treatment with or without RANKL. (B) The resorbed pit area was estimated and showed that N16 inhibited the bone resorption activity of osteoclasts by over 60%. Scale bar represents 250 μm (*p < 0.05, compared to group “RANKL only”).

mineralization assays and quantified the calcium deposits formed to clarify the role of N16 on biomineralization. Our results suggested that N16 increases calcium deposition and confirmed its involvement in enhancing osteogenesis (Figure 8B and C). N16 increased calcium deposit formation at 1.25, 2.5, and 5 μM (Figure 8B), and the highest effect was detected at 2.5 μM N16 (Figure 8C). The data suggested that N16 promotes osteogenesis of preosteoblasts and might play an anabolic role in bone metabolism. In summary, we showed for the first time that a single nacreous protein, N16, significantly suppressed the RANKLinduced osteoclast differentiation of RAW 264.7 cells and promoted osteogenesis in MC3T3-E1 cells. At present, the isomeric form of the purified N16 is uncharacterized. We shall determine this property to find out the effective concentration of N16. Bone constantly undergoes complex remodeling to replace old bone and maintain the quality of the skeleton. Osteoclasts resorb bone mass, and osteoblasts produce new bone in response to resorption.41 However, excessive bone resorption or inadequate bone formation during bone

remodeling results in bone mass loss and eventually causes osteoporosis. Previous studies showed that the resorption phase in bone remodeling is short and the period required for bone replacement is long.1 Besides antiresorption, stimulation of bone formation is also essential for osteoporosis treatment. However, most available drugs for osteoporosis focus on antiresorption. To date, PTH is the only anabolic drug approved by the FDA, but its use is limited by the increased risk of osteosarcoma.7 Our work indicates that N16 has the potential to balance the bone resorption and bone formation processes during bone remodeling and is worth further evaluation for the treatment of osteoporosis.

■

EXPERIMENTAL SECTION

General Experimental Procedures. N16 protein was purified by fast protein liquid chromatography (GE Healthcare, LC, GBR). E



Article

Figure 7. N16 up-regulated the relative mRNA expression of osteoblast-associated marker genes in MC3T3-E1 cells. (A) N16 is not toxic to preosteoblasts. (B) The relative mRNA expressions of two marker genes specific for osteoblasts, namely, OPN and OCN, were increased in the presence of N16. Data represent relative mRNA levels of OPN and OCN (mean ± SD) to nontreated group from three independent experiments. Statistical analysis was performed using Graph Pad Prism 5 with one-way ANOVA followed by Dunnett’s multiple comparison test (###p < 0.001, compared to group “no RANKL”; *p < 0.05, **p < 0.01, compared to group “RANKL only”).

Figure 8. N16 promoted ALP activity and biomineralization, which are characteristic of osteoblastic MC3T3-E1 cells. (A) Compared to vehicle control, N16 increased ALP activity by 18.5%, 20.5%, and 26.4%, respectively, at doses of 0.6, 1.25, and 2.5 μM after treatment for 96 h. Data are expressed as mean ± SD (*p < 0.05, **p < 0.01, ***p < 0.001). (B) N16-treated cells were stained with AR-S to visual the calcium deposits. (C) AR-S dye released from the cell matrix was quantified using a spectrophotometer at 540 nm. Results were obtained from two independent experiments and expressed as mean ± SD (*p < 0.05, **p < 0.01, ***p < 0.001, compared to vehicle control). Ascorbic acid, Alizarin Red S, and acid phosphatase assay kit were purchased from Sigma-Aldrich (St. Louis, MO, USA). SYBR Green

Premix EX TaqTM mix was purchased from Takara (Kusatsu, Shiga, Japan). Recombinant soluble murine RANKL was obtained from F



Article

Table 1. Primers Used for qPCR gene

forward primer (5′ > 3′)

reverse primer (5′ > 3′)

ref

TRAP NFATc1 c-Src cathepsin K OPN OCN GAPDH

ACACAGTGATGCTGTGTGGCAACTC GGGTCAGTGTGACCGAAGAT CCAGGCTGAGGAGTGGTACT GGCCAACTCAAGAAGAAAAC TCCAAAGCCAGCCTGGAAC CGCTCTGTCTCTCTGACCTC AACTTTGGCATTGTGGAAGG

CCAGAGGCTTCCACATATATGATGG GGAAGTCAGAAGTGGGTGGA CAGCTTGCGGATCTTGTAGT GTGCTTGCTTCCCTTCTGG TGACCTCAGAAGATGAACTC TCACAAGCAGGGTTAAGCTC ACACATTGGGGGTAGGAACA

43 43 43 44 17 45 43

PeproTech EC Ltd. (London, GBR). Penicillin/streptomycin antibiotics, Trizol reagent, Superscript II reverse transcriptase, α-minimal essential medium (α-MEM), Dulbecco’s modified minimum essential medium, acridine orange, and fetal bovine serum (FBS) were purchased from Gibco BRL (Grand Island, NY, USA). The BCA protein assay kit was purchased from ThermoFisher Scientific (Waltham, MA, USA). The TRAP assay kit was purchased from Beyotime (Haimen, Jiangsu, China). All other chemicals were of analytical grade or complied with the standard needed for cell culture experiments. Expression and Purification of N16. Total mRNA was extracted from the mantle of P. f ucata using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Firststrand cDNA was synthesized with 5 μg of total RNA using Superscript II reverse transcriptase (Invitrogen) by reverse transcription-polymerase chain reaction (RT-PCR). N16 DNA excluding the signal peptide (amino acids 1−23) was amplified using primers N16F (5′-GGAATTCCATATGGCTGTCCATTATAAGTGC-3′) and N16R (5′-CGGGATCCTTAATTGTCAAACCGTTC-3′) including NdeI and BamHI cutting sites underlined in the N16F and N16R primer sequences, respectively. The PCR reaction mixture was first denatured at 95 °C for 5 min followed by 25 cycles of 95 °C for 1 min, 50 °C for 20 s, and 72 °C for 1 min. The amplified N16 DNA was then cloned into pET3a expression vector and was transformed into BL21(DE3)pLysS E. coli competent cells. After growing to logarithmic phase, cells were induced with 0.4 mM isopropy-β-Dthiogalactoside for 16 h at 37 °C. Cells were harvested and sonicated in 20 mM Tris-HCl (pH 7.0). The insoluble fraction was collected and washed with washing buffer (2 M urea, 20 mM Tris-HCl, 0.1% Tween 20, pH 7.0). Proteins that were insoluble in washing buffer were subsequently solubilized in solubilizing buffer (8 M urea, 20 mM TrisHCl, 40 mM beta-mercaptoethanol, pH 7.0) with gentle shaking overnight at room temperature. The solution was centrifuged at 18000g for 30 min, and the supernatant was filtered. Ion-exchange chromatography of the supernatant on a DEAE column was then carried out in a gradient elution mode. Fractions were analyzed by 15% SDS-PAGE, and those fractions containing N16 were then further purified with gel filtration on a Superdex 75 column, and the purity was analyzed by 15% SDS-PAGE. Finally, N16 was dialyzed against 20 mM phosphate buffer (pH 7.2). The identity of purified N16 was confirmed with N-terminal amino acid sequencing (Mission BioTech, Taipei, Taiwan). Cells and Cell Culture. Mouse preosteoblast cells MC3T3-E1 were grown in α-MEM supplemented with 10% FBS and 100 U/mL of penicillin and 100 mg/mL streptomycin. Differentiation medium for MC3T3-E1 cells consisted of α-MEM supplemented with 10% FBS, 0.283 mM ascorbic acid, and 10 mM sodium β-glycerophosphate. Mouse preosteoclast cells RAW264.7 were maintained in Dulbecco’s modified minimum essential medium (Gibco) supplemented with 10% FBS and 100 U/mL of penicillin and 100 mg/mL streptomycin. RAW 264.7 cells were differentiated into osteoclasts in α-MEM supplemented with 10% FBS and 2.58 nM RANKL (R&D Systems Inc., Minneapolis, MN, USA). All cells were cultured in a humidified atmosphere with 5% CO2 at 37 °C. Cell Viability Assay. Cells were seeded in 96-well cell culture plates at 1 × 103 cells/well and 5 × 103 cells/well for RAW 264.7 cells and MC3T3-E1 cells, respectively, and allowed to attach for 24 h. Cells were treated with N16 at various concentrations for different

durations. The vehicle control contained 3 mM phosphate buffer (pH 7.2). Cell survival was determined by 3-(4,5-dimethylthiazol-2yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. TRAP Staining and TRAP Activity Assay. RAW 264.7 cells were differentiated into osteoclasts in α-MEM supplemented with 10% FBS and 2.58 nM RANKL (R&D Systems Inc.) in 96-well plates at the density of 1 × 103 cells/well for 3 days. The cells were fixed, and osteoclast formation was measured by quantifying cells positively stained by TRAP using an acid phosphatase kit (Sigma−Aldrich). Osteoclasts were determined as TRAP (+) staining multinuclear (>3 nuclei) cells and counted under light microscopic observation. In order to measure the TRAP activity, the cells were lysed by 0.1% Triton X100 in PBS on day 3 post-treatment, and the enzyme activity was determined using a TRAP assay kit according to the manufacturer’s instruction (Beyotime). To normalize the result, a bicinchoninic acid (BCA) protein assay was carried out according to the manufacturer’s instruction, and TRAP activity was expressed as U/mg protein. Data are presented as the percentage decrease with reference to the group “RANKL only”. Resorption Pit Assay. RAW 264.7 cells were differentiated into osteoclasts in α-MEM supplemented with 10% FBS and 2.58 nM RANKL (R&D Systems Inc.) in a 96-well Osteo Assay Surface plate (Corning Inc., Corning, NY, USA) at a density of 5 × 103 cells/well. Cells without RANKL and N16 were used as the differentiation control. After incubated for 7 days, cells were removed by 10% bleach and the plate was washed with water twice and air-dried. Each well was captured under light microscope with a magnification of 40×, and the resorbed pit area was estimated using Adobe Photoshop CS5. Data are presented as the percentage decrease with reference to the group “RANKL only”. Acridine Orange Staining and Acidification Assay. RAW 264.7 cells were seeded in a 35 mm confocal dish (SPL Life Sciences, Pocheon, Gyeonggi-do, Republic of Korea) at a density of 5 × 104 cells/dish and differentiated into osteoclasts as mentioned above. After incubating for 7 days, cells were stained with 5 μg/mL acridine orange and photographed under a FLUOVIEW FV1000 confocal laser scanning microscope (Olympus, Tokyo, Japan) with a magnification of 400×. DNA was detected by excitation at 488 nm and emission from 500 to 530 nm (green), and that of that acidic region by excitation at 543 nm and emission from 580 to 680 nm (red). Actin Ring Staining Assay. On day 3 of RANKL-induced differentiation, RAW 264.7 cells were fixed with 3.7% formaldehyde in PBS for 10 min. Cells were washed with 0.1% Triton X-100 in PBS for 5 min three times. Actin rings were then stained with phalloidin-FITC (Beyotime) for 1 h in the dark. After washing with 0.1% Triton X-100 in PBS, the image of stained cells was captured under a fluorescent microscope (Olympus IX71, Japan). Quantitative Real-Time Polymerase Chain Reaction Assay. Total RNA in N16-treated cells was isolated using Trizol (Invitrogen). Total RNA (5 μg) and 2.5 μM oligo-dT25 were used to synthesize the first-strand cDNA by MuMLV reverse transcriptase (GeneSys, GBR) at 65 °C for 5 min, followed by 42 °C for 50 min and 72 °C for 15 min. qPCR was performed using SYBR Green Premix EX TaqTM mix (TaKaRa Bio Inc., Kusatsu, Shiga, Japan) with 100 ng of first-strand cDNA in an ABI 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA, USA) using the following cycle parameters: one cycle of 95 °C for 30 s, 40 cycles of 95 °C for 3 s, and 60 °C 30 s. Glyceraldehyde 3-phosphate dehydrogenase G



Article

(GADPH) was included as a reference, and the primers for qPCR are listed in Table 1.The relative mRNA expression was calculated using the 2−△△CT method.42 ALP Activity Assay. To investigate the effect of N16 on the differentiation of osteoblast precursor, ALP activity in MC3T3-E1 cells was determined by p-nitrophenylphosphate as a substrate as described previously.16 Protein concentration was determined using a BCA protein assay reagent (Pierce, Rockford, IL, USA) so as to normalize the result, and ALP activity was expressed as U/mg protein. Data are presented as the percentage increase with reference to the vehicle control. In Vitro Mineralization Assay. MC3T3-E1 cells seeded in a 24well cell culture plate were grown to 100% confluence in α-MEM. Then, cells were treated with various concentrations of N16 in αMEM supplemented with 10% FBS, 0.283 mM ascorbic acid, and 10 mM sodium β-glycerophosphate for 21 days. The group without N16 treatment was considered as the vehicle control. The medium was changed every 3 days. Mineralized matrix in plates was determined by Alizarin Red S (AR-S) staining. Cells were fixed in 70% ethanol for 15 min after washing with PBS twice. Calcium deposits were stained with 40 mM AR-S (pH 4.2) for 10 min at room temperature. Nonspecific staining was minimized by washing cells five times with distilled water and incubating in PBS for 15 min. The stained matrix was photographed. Finally, AR-S was released from the cell matrix by incubating in 10% cetylpyridinium chloride for 15 min and quantified by a microplate reader at 540 nm. Statistical Analysis. Statistical analyses were carried out using Graph Pad Prism 5. One-way ANOVA followed by Dunnett’s multiple comparison test was used for comparing the results among treatments. A p-value less than 0.05 was considered statistically significant. Data are presented as mean ± standard deviation.

■

(5) Black, D. M.; Greenspan, S. L.; Ensrud, K. E.; Palermo, L.; McGowan, J. A.; Lang, T. F.; Garnero, P.; Bouxsein, M. L.; Bilezikian, J. P.; Rosen, C. J. N. Engl. J. Med. 2003, 349, 1207−1215. (6) Hodsman, A. B.; Bauer, D. C.; Dempster, D. W.; Dian, L.; Hanley, D. A.; Harris, S. T.; Kendler, D. L.; McClung, M. R.; Miller, P. D.; Olszynski, W. P.; Orwoll, E.; Yuen, C. K. Endocr. Rev. 2005, 26, 688−703. (7) Brewer, L.; Williams, D.; Moore, A. Eur. J. Clin. Pharmacol. 2011, 67, 321−331. (8) Miyamoto, H.; Miyoshi, F.; Kohno, J. Zool. Sci. 2005, 22, 311− 315. (9) Suzuki, M.; Saruwatari, K.; Kogure, T.; Yamamoto, Y.; Nishimura, T.; Kato, T.; Nagasawa, H. Science 2009, 325, 1388−1390. (10) Kono, M.; Hayashi, N.; Samata, T. Biochem. Biophys. Res. Commun. 2000, 269, 213−218. (11) Suzuki, M.; Murayama, E.; Inoue, H.; Ozaki, N.; Tohse, H.; Kogure, T.; Nagasawa, H. Biochem. J. 2004, 382, 205−213. (12) Moutahir-Belqasmi, F.; Balmain, N.; Lieberrher, M.; Borzeix, S.; Berland, S.; Barthelemy, M.; Peduzzi, J.; Milet, C.; Lopez, E. J. Mater. Sci.: Mater. Med. 2001, 12, 1−6. (13) Mouriès, L. P.; Almeida, M. J.; Milet, C.; Berland, S.; Lopez, E. Comp. Biochem. Physiol., Part B: Biochem. Mol. Biol. 2002, 132, 217− 229. (14) Lao, Y.; Zhang, X.; Zhou, J.; Su, W.; Chen, R.; Wang, Y.; Zhou, W.; Xu, Z. F. Comp. Biochem. Physiol., Part B: Biochem. Mol. Biol. 2007, 148, 201−208. (15) Rousseau, M.; Pereira-Mouriès, L.; Almeida, M. J.; Milet, C.; Lopez, E. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2003, 135, 1− 7. (16) Kim, H.; Lee, K.; Ko, C. Y.; Kim, H. S.; Shin, H. I.; Kim, T.; Lee, S. H.; Jeong, D. Biomaterials 2012, 33, 7489−7496. (17) Wang, X.; Liu, S.; Xie, L.; Zhang, R.; Wang, Z. Comp. Biochem. Physiol., Part B: Biochem. Mol. Biol. 2011, 158, 173−180. (18) Atlan, G.; Balmain, N.; Berland, S.; Vidal, B.; Lopez, E. C. R. Acad. Sci., Ser. III 1997, 320, 253−258. (19) Lamghari, M.; Almeida, M. J.; Berland, S.; Huet, H.; Laurent, A.; Milet, C.; Lopez, E. Bone 1999, 25, 91−94. (20) Samata, T.; Hayashi, N.; Kono, M.; Hasegawa, K.; Horita, C.; Akera, S. FEBS Lett. 1999, 462, 225−229. (21) Nogawa, C.; Baba, H.; Masaoka, T.; Aoki, H.; Samata, T. Gene 2012, 504, 84−91. (22) Kim, I. W.; DiMasi, E.; Evans, J. S. Cryst. Growth Des. 2004, 4, 1113−1118. (23) Metzler, R. A.; Evans, J. S.; Killian, C. E.; Zhou, D.; Churchill, T. H.; Appathurai, N. P.; Coppersmith, S. N.; Gilbert, P. J. Am. Chem. Soc. 2010, 132, 6329−6334. (24) Atlan, G.; Delattre, O.; Berland, S.; LeFaou, A.; Nabias, G.; Cot, D.; Lopez, E. Biomaterials 1999, 20, 1017−1022. (25) Edwards, J. R.; Mundy, G. R. Nat. Rev. Rheumatol. 2011, 7, 235−243. (26) Hsu, H.; Lacey, D. L.; Dunstan, C. R.; Solovyev, I.; Colombero, A.; Timms, E.; Tan, H. L.; Elliott, G.; Kelley, M. J.; Sarosi, I.; Wang, L.; Xia, X. Z.; Elliott, R.; Chiu, L.; Black, T.; Scully, S.; Capparelli, C.; Morony, S.; Shimamoto, G.; Bass, M. B.; Boyle, W. J. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 3540−3545. (27) Duplat, D.; Gallet, M.; Berland, S.; Marie, A.; Dubost, L.; Rousseau, M.; Kamel, S.; Milet, C.; Brazier, M.; Lopez, E.; Bédouet, L. Biomaterials 2007, 28, 4769−4778. (28) Teitelbaum, S. L.; Ross, F. P. Nat. Rev. Genet. 2003, 4, 638−649. (29) Garnero, P.; Borel, O.; Byrjalsen, I.; Ferreras, M.; Drake, F. H.; McQueney, M. S.; Foged, N. T.; Delmas, P. D.; Delaissé, J. M. J. Biol. Chem. 1998, 273, 32347−32352. (30) Saftig, P.; Hunziker, E.; Wehmeyer, O.; Jones, S.; Boyde, A.; Rommerskirch, W.; Moritz, J. D.; Schu, P.; von Figura, K. Proc. Natl. Acad. Sci. U. S. A. 1998, 95, 13453−13458. (31) Nishi, Y.; Atley, L.; Eyre, D. E.; Edelson, J. G.; Superti-Furga, A.; Yasuda, T.; Desnick, R. J.; Gelb, B. D. J. Bone Miner. Res. 1999, 14, 1902−1908.

AUTHOR INFORMATION

Corresponding Authors

*E-mail (P. B. Li): [email protected]. Tel: +86-20-8411-1288. Fax: +86-20-8411-2398. *E-mail (P. C. Shaw): [email protected]. Tel: +852-39431363. Fax: +852-2603-7246. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by Shenzhen-Hong Kong Technology Cooperation Funding Scheme (No. SGLH20120926171131592), Innovation and Technology Commission (No. GHP/005/12SZ), Guangdong Province Ocean and Fishery Technology Promotion Special Scheme (No. A201301C01), and Guangdong Province Science and Technology Major Projects (No. 2013A022100021). We thank Y. Nie (Guangzhou Quality R&D Center of Traditional Chinese Medicine, Guangdong Key Laboratory of Plant Resources, School of Life Sciences, Sun Yat-Sen University) and X. Gao (State Key Laboratory of Phytochemistry and Plant Resources in West China (CUHK), Institute of Chinese Medicine, Chinese University of Hong Kong) for the help in some of the experiments.

■

REFERENCES

(1) Raisz, L. G. J. Clin. Invest. 2005, 115, 3318−3325. (2) Boyle, W. J.; Simonet, W. S.; Lacey, D. L. Nature 2003, 423, 337−342. (3) Dunford, J. E. Curr. Pharm. Des. 2010, 16, 2961−2969. (4) Komarova, S. V.; Shum, J. B.; Paige, L. A.; Sims, S. M.; Dixon, S. J. Calcif. Tissue Int. 2003, 73, 265−273. H



Article

(32) Lowe, C.; Yoneda, T.; Boyce, B. F.; Chen, H.; Mundy, G. R.; Soriano, P. Proc. Natl. Acad. Sci. U. S. A. 1993, 90, 4485−4489. (33) Miyazaki, T.; Sanjay, A.; Neff, L.; Tanaka, S.; Horne, W. C.; Baron, R. J. Biol. Chem. 2004, 279, 17660−17666. (34) Takayanagi, H.; Kim, S.; Koga, T.; Nishina, H.; Isshiki, M.; Yoshida, H.; Saiura, A.; Isobe, M.; Yokochi, T.; Inoue, J.; Wagner, E. F.; Mak, T. W.; Kodama, T.; Taniguchi, T. Dev. Cell 2002, 3, 889−901. (35) Teitelbaum, S. L.; Ross, F. P. Nat. Rev. Genet. 2003, 4, 638−649. (36) Karieb, S.; Fox, S. W. J. Cell. Biochem. 2011, 112, 476−487. (37) Baron, R.; Neff, L.; Louvard, D.; Courtoy, P. J. J. Cell Biol. 1985, 11, 2210−2222. (38) Karsdal, M. A.; Henriksen, K.; Sørensen, M. G.; Gram, J.; Schaller, S.; Dziegiel, M. H.; Heegaard, A. M.; Christophersen, P.; Martin, T. J.; Christiansen, C.; Bollerslev, J. Am. J. Pathol. 2005, 2, 467−476. (39) Stenbeck, G.; Horton, M. A. J. Cell Sci. 2000, 113, 1577−1587. (40) Quarles, L. D.; Yohay, D. A.; Lever, L. W.; Caton, R.; Wenstrup, R. J. J. Bone Miner. Res. 1992, 7, 683−692. (41) Manolagas, S. C. Endocr. Rev. 2000, 21, 115−137. (42) Livak, K. J.; Schmittgen, T. D. Methods 2001, 25, 402−408. (43) Kim, M. H.; Ryu, S. Y.; Bae, M. A.; Choi, J. S.; Min, Y. K.; Kim, S. H. Food Chem. Toxicol. 2008, 46, 3375−3382. (44) Kim, M. H.; Shim, K. S.; Kim, S. H. Arch. Pharmacal Res. 2010, 33, 457−462. (45) Alford, A. I.; Terkhorn, S. P.; Reddy, A. B.; Hankenson, K. D. Bone 2010, 46, 464−471.

I


N16, a Nacreous Protein, Inhibits Osteoclast Differentiation and

Recommend Documents