Natural Product Bis-Intercalator Depsipeptides as a New Class of

Article Cite This: Bioconjugate Chem. XXXX, XXX, XXX−XXX

pubs.acs.org/bc

Natural Product Bis-Intercalator Depsipeptides as a New Class of Payloads for Antibody−Drug Conjugates Anokha S. Ratnayake,† Li-ping Chang,†,§ L. Nathan Tumey,†,∥ Frank Loganzo,‡ Joseph A. Chemler,†,⊥ Melissa Wagenaar,† Sylvia Musto,‡ Fengping Li,† Jeffrey E. Janso,† T. Eric Ballard,†,# Brian Rago,† Greg L. Steele,†,∇ WeiDong Ding,†,§ Xidong Feng,† Christine Hosselet,‡ Vlad Buklan,‡ Judy Lucas,‡,§ Frank E. Koehn,†,§ Christopher J. O’Donnell,†,○ and Edmund I. Graziani*,† Downloaded via UNIV OF OTAGO on December 13, 2018 at 22:20:50 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

Medicine Design, Pfizer Worldwide Research and Development, 445 Eastern Point Road, Groton, Connecticut 06340, United States ‡ Oncology Research, Pfizer Worldwide Research and Development, 401 North Middletown Road, Pearl River, New York 10965, United States S Supporting Information *

ABSTRACT: A potent class of DNA-damaging agents, natural product bis-intercalator depsipeptides (NPBIDs), was evaluated as ultrapotent payloads for use in antibody− drug conjugates (ADCs). Detailed investigation of potency (both in cells and via biophysical characterization of DNA binding), chemical tractability, and in vitro and in vivo stability of the compounds in this class eliminated a number of potential candidates, greatly reducing the complexity and resources required for conjugate preparation and evaluation. This effort yielded a potent, stable, and efficacious ADC, PF06888667, consisting of the bis-intercalator, SW-163D, conjugated via an N-acetyl-lysine-valine-citrulline-p-aminobenzyl alcohol-N,N-dimethylethylenediamine (AcLysValCitPABC-DMAE) linker to an engineered variant of the anti-Her2 mAb, trastuzumab, catalyzed by transglutaminase.

■

prompted many in the field to evaluate alternate mechanisms of action in a search for new payloads and payload classes. In almost all cases, natural products have served as the inspiration for these efforts. Maytansinoids (of which the TDM1 payload, emtansine, is a representative) were originally isolated from the plant Maytenus serrara.11 Likewise, the auristatins12,13 were designed around the potent marine natural product, dolastatin 10.14 Another member of the MTIs that has attracted attention as an ADC payload is the tubulysins, isolated from the myxobacteria Archangium gephyra and Angiococcus disciformis.15 A tubulysin-bearing ADC is currently in Phase 1 clinical trials,16 and tubulysin ADCs have served as an interesting case study in understanding ADC metabolism.17 The MTI peptide, cryptophycin, has also been evaluated as an ADC payload.18 Other mechanisms being evaluated as ADC payloads include the DNA topoisomerase inhibitor camptothecin and derivatives,19 the RNA polymerase II inhibitor αamanitin,20,21 the RNA spliceosome inhibitor thailanstatin,22 and anthracyclines.23 Of special interest, however, are new payload classes that target DNA. For example, the overall response rate of T-DM1

INTRODUCTION Antibody−drug conjugates (ADCs) consist of a monoclonal antibody (mAb) conjugated via a linker to a cytotoxic payload and have been designed to deliver potent chemotherapeutic agents to tumors in a targeted fashion. Conceptually conceived in the 1960s,1 the promise of this approach has been the subject of a number of recent reviews2−4 due to a number of clinical successes. The first ADC approved, gemtuzumab ozogamicin (GO, Mylotarg), is currently used to treat acute myeloid leukemia (AML).5,6 GO consists of a humanized antiCD33 mAb linked to the potent double-strand DNA cleavage natural product, calicheamicin.7 Another calicheamicin-bearing ADC that targets CD22, inotuzumab ozogamicin (IO, Besponsa), has also been recently approved for the treatment of acute lymphoblastic leukemia.8 The return of GO and the approval of IO represent a contrast with the majority of ADCs currently in clinical trials, in that their payloads target DNA rather than the cytoskeletal protein, tubulin. The other two currently approved ADCs, trastuzumab emtansine9 (T-DM1, Kadcyla) and brentuximab vedotin10 (BV, Adcetris), deliver the microtubule inhibitors (MTI) maytansine and auristatin, respectively, as payloads. The overreliance on microtubule-disrupting agents as payloads for ADCs and the renewed interest in calicheamicin have © XXXX American Chemical Society

Received: November 21, 2018

A

DOI: 10.1021/acs.bioconjchem.8b00843 Bioconjugate Chem. XXXX, XXX, XXX−XXX

Article

Bioconjugate Chemistry

Figure 1. Structures of natural product depsipeptide bis-intercalators evaluated for activity and stability.

hydrogen bonding associations with the base pairs of DNA directed by the polypeptide core of the compound into the minor groove.42,43 Additional targets may also exist for this class of compounds.34 NPBIDs have been accessed via total synthesis,44,45 used as probes in chemical biology,46 and have been the objects of biosynthetic investigations47−50 including production of analogs via synthetic biology51 as well as the targets of search algorithms for genome mining of biosynthetic gene clusters.52 We therefore set out to design potent ADCs bearing bisintercalator depsipeptide payloads and evaluated compounds on the basis of (i) potent cytotoxicity (IC50 < 10 nM) in tumor cell lines correlated with tight binding to DNA; (ii) chemical suitability for covalent attachment of a linker; (iii) plasma stability of the payload; (iv) activity, selectivity, and plasma stability of the resultant ADC; and (v) in vivo efficacy in a mouse xenograft model. This effort yielded a potent, stable, and efficacious ADC, PF-06888667, consisting of the bisintercalator, SW-163D, conjugated via an N-acetyl-lysinevaline-citrulline-p-aminobenzyl alcohol-N,N-dimethylethylenediamine (AcLysValCit-PABC-DMAE) linker to an engineered variant of the anti-Her2 mAb, trastuzumab, catalyzed by transglutaminase.53

in the EMILIA and TH3RESA clinical trials in advanced breast cancers was 44% and 31%, respectively,24,25 suggesting that there is room for improvement with new anti-Her2 ADC therapies delivering novel linker-payloads. With this aim in mind, a number of ultrapotent DNA alkylators are also under evaluation as ADC payloads, including duocarmycins26 and the pyrrolobenzodiazepines.27,28 We therefore turned our attention to a class of potent DNA bis-intercalators,29 exemplified by the natural product echinomycin,30 to test the hypothesis that DNA intercalation represents an orthogonal and complementary strategy to DNA double strand breakage (calicheamicin) and DNA alkylation (duocarmycin) that may prove equally as potent. Moreover, these compounds may possess a so-called bystander effect, in that unlike the other two mechanisms, DNA intercalators can in principle bind reversibly to DNA and therefore target and kill multiple cells within a tumor mass. Isolated primarily from bacteria of the genus, Streptomyces, natural product bis-intercalator depsipeptides (NPBIDs) are broadly defined as head-to-tail dimeric, C2 symmetrical polypeptides that bear a bicyclic heteroaromatic chromophore (i.e., quinoxaline) on each monomer. The first compounds of this class isolated, the aforementioned echinomycins,30 possess potent antitumor activity in vivo,31 and have undergone clinical trials,32,33 though their toxicological profile has limited their usefulness as systemically delivered small molecules.34 Other members of this class of natural products (over 18 additional members) include quinaldopeptin,35 sandramycin,36 SW163C-E,37,38 luzopeptin,39 triostins,40 and the quinoxapeptins41 (Figure 1). The primary mechanism of action of this class of compounds involves, as the name suggests, intercalation via

■

RESULTS Natural Product Bis-Intercalators Are Ultrapotent Across Multiple Cell Lines and Intercalate DNA with Nanomolar Affinity. A set of natural product bis-intercalators was prepared via fermentation and subsequent purification comprising echinomycin A (1), echinomycin B (2), echinomycin C (3), SW-163D (4), sandramycin (5), B


Article


ployed to monoacylate the phenolic positions of the heteroaryl chromophores of SW-163D, sandramycin and luzopeptin A (see the Experimental Section). Initial results (data not shown) indicated that NPBID payloads are prone to aggregation, and so to alleviate this, polyethylene glycol (PEG) functionality as well as a diaspartate element was added to the standard maleimidecaproyl-valine-citrulline-p-aminobenzylcarboxy (mcValCitPABC) framework. ADCs with the desired drug antibody ratios (DAR) were prepared using previously reported conjugation methods17,55 (Figure 2) and evaluated for cytotoxicity against tumor cell lines with high, medium, or negative expression of Her2 antigen (N87, MDA-MB-361DYT2, HT29, respectively). In contrast to the activity of unconjugated payloads (Table 1) the ADCs showed potent cytotoxicity only against Her2 expressing cell lines, with selectivity against the nonantigen expressing cell line as expected (Table 2). With the exception of ADC 12, that showed 30% DAR loss at 72 h, ADCs tested were stable up to 72 h in mouse plasma. Anti-Her2 ADCs Prepared via Transglutaminase Conjugation Using SW-163D Were Well Tolerated in Vivo and Showed Robust Efficacy in an N87 Mouse Xenograft Model. Compounds 10−14 were prepared at larger scale and were checked for endotoxin prior to testing for ̈ mice at a 1 mg/kg dose and subsequent tolerability in naive testing in an N87 mouse xenograft model of tumor growth inhibition. At this dose, only compound 13 exhibited significant tumor regression in a q4dx4 dosing regimen, although compounds 11 and 14 did show some degree of tumoristatic effects (Figure 3A). A negative control ADC (16) was prepared employing the identical linker-payload conjugated at the exact same sites to a non-Her2 targeting antibody (Table 2). A dose response experiment was performed in the same N87 mouse model using compounds 13 and the control ADC, 16 (Figure 3B). In this model, again using a q4dx4 dosing regimen, the 1.0 mg/kg dose of 13 (PF06888667) showed significant and durable regression, while the lower dose of 0.3 mg/kg was tumoristatic, in contrast to the negative control, 16, that showed no regression at equivalent doses.

quinaldopeptin (6), luzopeptin A (7), luzopeptin C (8), and triostin C (9) (Figure 1). The compounds were evaluated for cytotoxicity in tumor cell lines from multiple cancer indications, including N87 (gastric), MDA-MB-361-DYT2 (breast), and HT29 (colon), and the results are summarized in Table 1. IC50 values ranged from 0.1 nM to 20 nM and were in line with previously reported values.29 Table 1. Cytotoxicity Across Multiple Tumor Cell Lines and DNA Binding Affinities of Natural Product Depsipeptide Bis-Interclatorsa compd no.

sample name

N87 (gastric)

MDA-MB-361DYT2 (breast)

HT29 (colon)

KD (DNA)

1 2 3 4 5 6 7 8 9

echinomycin A echinomycin B echinomycin C SW-163D sandramycin quinaldopeptin luzopeptin A luzopeptin C triostin C

1.3 0.19 0.05 0.27 0.55 5.5 1.0 20 1.2

3.1 0.43 0.14 0.90 0.53 6.7 0.85 13 1.9

3.7 0.44 0.10 ND 0.11 4.3 0.37 18 1.5

21 8.6 17 6.5 0.020 32 ND 0.61 147

a

Cytotoxicity IC50 values from four cell line indications are reported as mean IC50 (nM) from 1 to 6 independent experiments. DNA binding data are mean Kd (nM). ND, not determined.

Natural Product Bis-Intercalators Intercalate DNA with Nanomolar Affinity. Compounds were further evaluated for affinity via surface plasmon resonance (SPR) to a short DNA sequence with known affinity for NPBIDs (GGAACGTAGGTTTCCTACGTTCC), and the observed KD values are summarized in Table 1. Sandramycin (5) exhibited the tightest binding to DNA tested (KD = 20 pM), primarily due to its very slow off rate (1 × 10−6 s−1). In contrast, triostin C (9) showed the weakest affinity for DNA intercalation with a KD = 147 nM, 5 orders of magnitude lower than sandramycin (Supplemental Table S1, Supporting Information). NPBIDs Demonstrated Variable Half-Lives upon Incubation in pH 7.4 Buffer, pH 4.5 Buffer, and Mouse Plasma. Following the decision to employ the phenolic positions on the heteroaromatic chromophores of NPBIDs as the site for putative linker attachment, those compounds bearing this moiety (sandramycin (5), SW-163D (4), and luzopeptin A (7)) were evaluated for their stability in various buffers and mouse plasma. While SW-163D exhibited good pH and plasma stability to 72 h, considerable ester hydrolysis was observed in the case of sandramycin, with up to 17% conversion to the ring-opened monoacid after 3 h at pH 7.4. In mouse plasma, cleavage at both esters was observed after 4 h incubation, with significant disappearance of the parent compound observed by 48 h (Supplemental Figure S2, Supporting Information). Luzopeptin A could not be evaluated for stability due to poor solubility. Anti-Her2 ADCs Prepared from SW-163D, Sandramycin, and Luzopeptin A Using Cleavable Linkers Showed Maximal Drug to Antibody Ratios and Minimal DAR Loss in Mouse Plasma and Were Potent against Her2 Expressing Cell Lines. In order to make an initial assessment of the conjugatability, stability, and in vitro potency of ADCs prepared from NPBID payloads, cleavable dipeptide linkers54 terminating in a N,N-dimethyl-1,2-aminoethane were em-

■

DISCUSSION The use of humanized antibodies to better direct potent chemotherapeutic agents to tumors - best exemplified in the antibody−drug conjugate (ADC) - has met with some success in recent years, but there nonetheless remain multiple factors that drive the efficacy and safety of these bioconjugates. The list of criteria to consider and vary when designing and testing ADCs is long - from choice of antigen, type of targeting protein, site of conjugation and associated chemistry, linkers (stability, properties), to the choice of payload. To balance potency and safety, there is a benefit to optimizing as many of these variables as possible while recognizing that there remains much to learn about how best to incorporate what has worked so as to move away from purely empirical approaches to ADC design and testing, given the complexity and expense of tracking all the moving parts that comprise the final conjugate. To this end, there is a general consensus that ultrapotency is required from the payload portion of the ADC, given the fraction of a typical dose that is delivered to the tumor and the limits (solubility, aggregation, clearance, and exposure) of how many molecules of payload can be conjugated to a single antibody, multivalent linkers56 notwithstanding. While microC


Article


Figure 2. Structures of antibody−drug conjugates (ADCs) prepared from NPBID payloads.

tubule interfering compounds (MTIs) have proven effective against a number of lymphomas (in the context of clinically approved ADCs), there is considerable current interest in DNA damaging agents as payload for ADCs that may provide

greater potency against solid tumors. Hence we set out to examine alternate mechanisms of DNA damage as a complement to existing payload classes (enediynes, DNA alkylators, etc.). D


Article


Table 2. Drug-to-Antibody Ratios (DAR), Plasma Stability, and in Vitro Cytotoxicity (nM) of anti-Her2 and Control ADCs Delivering NPBID Payloadsb mAb

conj. site

payload

N87 (Her2 +++)

MDA-MB-361-DYT2 (Her2 ++)

HT29 (Her2 − negative)

linker

DAR 4

0.76

1.97

143

4 4 4

1.42 0.34 0.26

1.82 0.45 0.30

240 481 755

2 2 4

0.38 0.30 262

0.81 0.25 504

460 261 999

10

trastuzumab

C183/290

SW-163D

11 12 13

trastuzumab trastuzumab trastuzumab

SW-163D luzopeptin A SW-163D

14 15 16

trastuzumab trastuzumab Neg 8.8

C183/290 C183/290 1,1′ and 3,3′a 3,3a 3a 1 and 3a

MalPeg6C2Asp2ValCitPABCDMAE mcAspAspValCitPABC-DMAE mcAspAspValCitPABC-DMAE AcLysValCitPABC-DMAE

SW-163D sandramycin SW-163D

AcLysValCitPABC-DMAE AcLysValCitPABC-DMAE AcLysValCitPABC-DMAE

a

Site of conjugation labels as described in ref 55, Figure S1. bCytotoxicity IC50 values from cell lines with various levels of Her2 antigen levels are reported as mean IC50 (nM) from 1 to 10 independent experiments.

microbes from our extensive collection and profiled a set of nine compounds (Figure 1) for their cytotoxicities against a number of human cancer cell lines (Table 1). Measures of intrinsic potency using cytotoxicity can sometimes be masked by a compound’s low cell permeability, hence SPR was employed as a direct binding measure for DNA intercalation (Table 1). Although all compounds tested showed cytotoxicities in line with previously published values, sandramycin (5) exhibited the tightest binding to DNA tested (KD = 20 pM), primarily due to its very slow off rate (1 × 10−6 s−1), making it a prime candidate for linker attachment and antibody conjugation. Lack of synthetic tractability (i.e., a functional group such as a phenol or amine to which a linker could be covalently attached) was also a criterion that prevented further evaluation of the echinomycins (1−3) and triostin (9). Plasma stability of payloads and of their respective ADCs is an extraordinarily important factor in determining what combinations of payload, linker, and conjugation site are likely to demonstrate activity in vivo.17 For this reason, ADCs bearing sandramycin (5) and luzopeptin (7) were deprioritized, since the former compound is unstable itself in mouse plasma, exhibiting rapid ester hydrolysis within minutes, while in the latter case the resultant ADC (12) showed significant DAR loss after 72 h in mouse plasma. This observation was borne out by the subsequent finding that only ADCs bearing SW-163D as a payload (ADCs 11, 13, and 14) showed activity in vivo (Figure 3A) in contrast to ADC 12 that employed luzopeptin A as a payload. Interestingly, the nature of the linker and the site of conjugation also played a major role in the efficacy displayed by SW-163D ADCs (10, 11, 13, and 14). The pegylated linker used in 10, for example, showed very little efficacy in contrast to the N-acetyl-lysine linker53 employed in ADC 13 that showed markedly superior efficacy. It should also be noted that the conjugation methodologies were also different when comparing 10 and 13 (Figure 3A). The former (10) employed a maleimide handle to form a thioether at two engineered cysteines (183/290) on the mAb, while the latter used bacterial transglutaminase to form a stable amide linkage to an engineered tag on the antibody that has been described previously.55 Encouraged by the initial efficacy observed for ADC 13 at a dose of 1 mg/kg (q4d x4) in an N87 xenograft mouse model, a negative control ADC using a non-Her2 targeting mAb with identical conjugation sites and linker-payload (ADC 16) was prepared, and a dose−response study was initiated comparing the efficacy of 13 versus 16 (Figure 3B). As expected, the negative control (16) at both 1 and 3 mg/kg exhibited no

Figure 3. Antitumor activity of NPBID ADCs in N87 tumor xenograft model in mice. (A) Athymic mice were inoculated with Her2-positive N87 tumor cells. When tumors reached approximately 300 mm3, mice were administered PBS vehicle or the indicated ADCs at 1 mg/kg every 4 days (days 1, 5, 9, 13). Data are mean tumor size ± SEM on the days measured. (B) ADCs were administered every 4 days; 13 was dosed at 0.1, 0.3, 1, and 3 mg/kg as indicated; negative control ADC 16 was dosed at 1 and 3 mg/kg. Data are mean tumor size ± SEM on the days measured.

Natural products produced by bacteria are an especially rich source of agents that disrupt essential biological pathways,57 including DNA damaging agents. The well-known class of natural product bis-intercalator depsipeptides (NPBIDs) possesses low nanomolar activities against multiple tumor cell lines, though their toxicity has limited their clinical use. We explored a set of these compounds that were produced by E


Article


Conjugation Reactions. A typical reaction is carried out at a final antibody concentration of 5 mg/mL with total organic solvent component adjusted to 15% (v/v) DMSO. Accordingly, the transglutaminase reactive glutamine containing antibody (8.0−27 mg/mL) was mixed in with a solution containing 25 mM Tris-HCl (pH 8.0), 150 mM sodium chloride, and DMSO (15% total reaction volume after linkerpayload addition). After adjusting the antibody concentration to 5 mg/mL with distilled water, the amino-alkyl linkerpayload (30 mM solution in DMSO) was added in a 15−20fold molar excess over antibody. Next the enzymatic reaction was initiated by the addition of 30 mg/mL bacterial transglutaminase (Ajinomoto Activa TI, Japan) and incubated at ambient temperature with gentle shaking (benchtop tube rotisserie). After 2−4 h, additional transglutaminase (40−70 mg/mL total reaction concentration) and linker-payload (5−7 molar excess over antibody) were added as needed to improve drug loading. After overnight, the crude reaction was buffer exchanged into Dulbecco’s phosphate buffered saline (DPBS, pH7.4, Lonza) using GE Healthcare Sephadex buffer exchange columns per manufacturer’s instructions. Crude material was purified by size exclusion chromatography (SEC; GE Superdex 200). After purification, the monomeric fractions were pooled and concentrated using a 50 kDa Amicon Ultra-15 centrifugal filter unit (Millipore Corporation) to give the ADC. Following purification, in order to ensure removal of any residual freedrug, the ADC was incubated with Bio-Beads SM-2 polystyrene adsorbent resin (Bio-Rad; ∼250 mg of Biobeads per 5 mL ADC) at 37 °C for 3 h (see detailed protocol described), filtered through a sterile 0.2 μm filter, and concentrated to 1−2 mg/mL for in vitro studies or 3−5 mg for in vivo studies. Removal of Free Drug. The ADC sample (∼5−10 mg/ mL) was treated with ∼50 mg of prewashed Bio-Beads per mL of sample. The sample was gently agitated (600 rpm) at 37 °C for ∼3 h. An aliquot was taken, filtered using a small filter unit, and analyzed by LCMS to confirm removal of free drug. The rest of the material was then filtered using a sterile filter unit with a 0.2 μm membrane (by spinning for ∼30 s at 300 rpm) to remove Bio-Beads. The beads were washed with PBS, and the filtering process was repeated. The filtrate was concentrated. Recovery is typically ≥75%. Prewashed Bio-Beads (Preparation of Bio-Beads SM2). Methanol (2 mL) was added to Bio-Beads (∼250−300 mg), gently stirred (600−800 rpm) at room temperature for a few minutes, and pipetted to remove solvent. Next, the beads were resuspended in 2 mL of fresh methanol and allowed to agitate at 37 °C overnight. Then the MeOH was removed, and the beads were rinsed (RT, 600−800 rpm) successively in distilled water (1 × 2 mL) and PBS (2 × 2 mL). The final PBS suspension was filtered to afford dry beads (Endotox level ≤0.25 Eu/mg). Cell Lines and Cytotoxicity Assay. N87 cells originated from a liver metastasis of a colon carcinoma patient, and HT29 was derived from colorectal adenocarcinoma. Both cell lines were obtained from ATCC (Manassas, VA). MDA-MB-361DYT2 cells are derived from metastatic breast carcinoma and were generously provided by D. Yang at Georgetown University (Washington, DC). Cells were maintained in RPMI, DMEM, or MEM media, respectively, supplemented with 10% fetal bovine serum (FBS), 1% L glutamine, and 1% sodium pyruvate. Cytotoxicity assessment was determined as reported previously.59 Briefly, cells were seeded in 96-well cell

effect on tumor growth compared to vehicle-treated animals. In contrast, both the 3 and 1 mg/kg doses of ADC 13 showed essentially complete response by day 50, with the 0.3 mg/kg dose demonstrating a cytostatic effect. Notably, we previously reported that T-DM1 in the same N87 xenograft model causes complete regression at 10 mg/kg but not at 6 mg/kg.58 Hence, ADC 13 treatment in the current study results in complete regressions at a 10-fold lower dose than we have observed for the reference Her2 ADC, T-DM1. Importantly, all animals gained weight over the course of the current study (Supplemental Figure S1, Supporting Information). In conclusion, we have shown that rational design of antibody−drug conjugates employing natural product bisintercalator depsipeptide payloads resulted in an ADC, PF06888667 (13), which showed promising efficacy in a preclinical model of cancer and was well tolerated. Careful consideration and evaluation of intrinsic potency (both in cells and via biophysical characterization of DNA binding) and plasma stability of the free payloads eliminated a number of potential candidates, greatly reducing the complexity and resources required for conjugate preparation and evaluation. Previous work on optimizing sites for conjugation to maximize stability and DAR was also leveraged to prepare a focused set of ADCs employing complementary conjugation chemistries. We therefore rapidly identified a potent, efficacious, stable, and well tolerated ADC from among the many payload contenders, linkers, and conjugation sites and combinations to newly enable this class of natural products. Although this class of compounds has been known for decades, their clinical use as free compounds has been severely limited by their systemic toxicity. We show for the first time that a new class of DNAdamaging agents, complementary to DNA double-strand cleavage agents and DNA alkylators, has potential for use as a new payload class for antibody−drug conjugates.

■

EXPERIMENTAL SECTION LC-MS Analysis of Conjugates. LCMS analysis was performed using an Aquity H-class UPLC connected to a Xevo G2-XS TOF mass spectrometer (ESI ionization; capillary 2.85 kV; sampling cone 75 V; source temperature 150 °C; desolvation temperature 600 °C). Samples were reduced with TCEP immediately prior to analysis. The separation was performed using an Acquity UPLC BEH-C18 column (1.7 um, 2.1 × 50 mm, P/N 186002350; flow rate 0.4 mL/min; column temperature 80 °C). A gradient from 10% acetonitrile to 95% acetonitrile in water (+0.1% formic acid) was performed. MS data was collected from 500 to 2000 m/z (positive, sensitivity mode). The protein peak was selected for deconvolution using MaxEnt1 software. Typical injection size is 0.2 μg of ADC. Size Exclusion Chromatography (SEC). Analytical SEC was performed on an Agilent 1100 HPLC using a GE Superdex 200 (5/150 GL; GE Healthcare) column. A 10 min isocratic gradient was used where the mobile phase was phosphate buffered saline (PBS) at pH 7.4 containing 2% acetonitrile. UV detection was performed at 220 and 280 nm. The flow rate was 0.25 mL/min at ambient column temperature. Typical injection size is 10 μg of ADC. Preparative SEC was typically performed on an Akta Explorer (GE Healthcare) using a Superdex 200 (10/300 GL) column. A 25 min isocratic gradient was used (1.1 column volumes) where the mobile phase was PBS at pH 7.4. The flow rate was typically 1 mL/ min at ambient temperature. Typical injection size is 5 mg of ADC. F


Article


tris(2-carboxyethyl)phosphine (TCEP) for a final TCEP concentration of 20 mM. The resulting samples (2 μL) were injected onto a BEH C4 column (150 μm × 50 mm, 1.7 μm, 300A, Waters) set at 85 °C, with an autosampler set at 4 °C. LC separation was achieved using a nanoacquity LC system (Waters Technology). Spectra were collected from 2 to 8 min using a Waters Synapt-G2S QToF equipped with an ionKey nanospray source (Waters Technology). Positive TOF-MS scan was collected over a m/z range of 800−2100 amu using MassLynx (Waters Technology) software and was deconvoluted using the MaxEnt1 algorithm in BioPharmaLynx software (Waters Technology). Surface Plasmon Resonance (SPR) Binding Assay. Three short DNA sequences with known affinity for NPBIDs were selected for evaluation: 5′-Biotin-TEG/GGAACGTAGGTTTTCCTACGTTCC-3′ (echinomycin specific), 5′-Biotin-TEG/GCATGCTTTTGCATGC-3′ (sandramycin specific), and 5′-Biotin-TEG/GACTAATTGACTTTTGTCAATTAGTC-3′ (random control). Instrument: Biacore T100; Conditions: 25 °C, flow rate of 30 μL/min; Buffer: 10 mM Hepes pH 7.5, 150 mM NaCl, 2 mM MgCl2, 0.5 mM EGTA, 0.01% Tween20, 2% DMSO. Temperature effect was evaluated at 25 and 35 °C. Oligomer DNA was annealed by heating it to 90 °C and cooling down gradually to room temperature. Immobilization on SPR sensorchip: neutravidin was immobilized on a CM5 chip through amine coupling (NHS/EDC activation first). The activated chip surface was deactivated using ethanolamine (1 mM pH8). The biotinylated DNA was captured on the neutravidin to about 2000 RU. The depsipeptide bis-intercalators at various concentrations were injected over the DNA chip. Real time association and dissociation between the DNA and the depsipeptides was detected and recorded as sensorgrams (60 s contact for association and 60 min for dissociation). The k-on, k-off, and KD for the binding were determined using Biacore T100 software and one binding model. Payload Plasma Stability Assay. To a 1.5 mL glass MS vial containing 400 μL of human (BioreclamationIVT, Cat#HMPLEDTA2), rat (Cat#RATPLEDTA-WH), or mouse (Cat#MSEPLEDTA3) plasma was added the ADC payload from a DMSO stock solution (typically 30 mM) to a final concentration of 150 μM. A time zero time point was immediately taken (50 μL), transferred to a glass 15 mL conical tube containing 150 μL of MeCN, and then placed in a −40 °C freezer. The plasma incubation was then capped and warmed to 37 °C incubator. Typically, time points were removed at 1.5, 4, 24, 48, 72, and 96 h (50 μL each) and quenched as previous in MeCN. At the completion of the experiment, quenched samples were centrifuged (10 min; ∼2K × g), and 50 μL of the supernatant was transferred to a MS vial containing 325 μL of H2O to give a final concentration of 5 μM (total payload-related material) in 10% MeCN/H2O. Samples were analyzed by UHPLC-UV-MS operated in positive ion mode using an Orbitrap Elite mass spectrometer. For UHPLC-UV-MS analysis, the capillary temperature was set at 275 °C, and the source potential was 3500 V. Other potentials were adjusted to provide optimal ionization and fragmentation of the parent compound. UV absorption spectra were obtained by an in-line Accela photodiode array detector. A Kinetex C18 100 Å column was used (2.1 × 150 mm, 1.7 μm) with a flow rate of 0.4 mL/min heated to 45 °C in a column heater (Analytical Sales and Services). Mobile phase A was comprised of 0.1% formic acid, and mobile phase B was

culture plates for 24 h before treatment and then treated with 3-fold serial dilutions of unconjugated compounds or ADCs in duplicates at 10 concentrations. Cell viability was determined by CellTiter 96 AQueousOne Solution Cell Proliferation MTS Assay (Promega, Madison, WI) after 96 h of treatment. Relative cell viability was determined as percentage of untreated control. IC50 values were calculated using a four parameter logistic model 203 with XLfit v4.2 (IDBS, Bridgewater, NJ). In Vivo Efficacy Studies. All activities involving animals were carried out in strict accordance with federal, state, local, and institutional guidelines governing the use of laboratory animals in research and were reviewed and approved by Pfizer (or relevant) institutional animal care and use committee. Female athymic nu/nu (Nude, Stock No: 002019 mice obtained from The Jackson Laboratory (Farmington, CT) were injected subcutaneously in the flank with suspensions of 1 × 106 of N87 cells respectively in 50% Matrigel (BD Biosciences, Franklin Lakes, NJ). Mice were randomized into study groups when tumors reached approximately 300 mm3. Either phosphate buffered saline (PBS, Gibco, Cat#14190-144, as vehicle) or the test ADC was administered intravenously starting on day 0 for a total of four doses, 4 days apart (q4d x4). Tumors were measured at least weekly with a calibrator (Mitutoyo, Aurora, Illinois), and the tumor mass was calculated as volume = (width × width × length)/2. Antibody PK Exposure by Ligand-Binding Assay. The total antibody concentrations were determined by an LBA where a sheep anti-human IgG antibody (Binding Site, San Diego, CA, USA) was used for capture and a goat anti-human IgG antibody (Bethyl Laboratories, Inc., Montgomery, TX, USA) was used for detection. Plasma concentration data for each animal was analyzed using Watson LIMS version 7.4 (Thermo). ADC Plasma Stability. From stock ADC solutions, 50 μg/ mL of each ADC was prepared in fresh pooled male CD-1 mouse plasma with sodium heparin. In a 96-well plate, 0 min time-point was sampled immediately after the ADC plasma preparation. The plate was then placed in a −80 °C freezer. The remaining ADC plasma samples in capped tubes were incubated at 37 °C in a 5% CO2 controlled incubator. Aliquots were removed after 24 and 72 h and frozen at −80 °C until analysis. At the time of analysis, the plasma samples were thawed and deglycosylated for 2 h at 37 °C using 2 μL of IgZero (Genovis, Switzerland). The immunocapture and LCMS method are described below. In Vivo Immunocapture LCMS. For DAR, evaluation and metabolite identification relied on an immunocapture high resolution LC/MS method. In short, analysis of samples from nu/nu mice (plasma) following bolus administration of ADC was performed by adding 50 μL of matrix to a 96-well LoBind plate (Eppendorf, Hamburg, Germany) followed by deglycosylation for 1.5 h at 37 °C using 2 μL of IgZero (Genovis, Switzerland). Capture of ADC was performed using biotinylated goat anti-human FC gamma (Jackson ImmunoResearch, West Grove, PA) at a ratio of 3:1 capture:ADC for 1 h at room temperature under gentle shaking. Streptavidin T1 beads (Life Technologies, Grand Island, NY) were washed and added to the samples, mixing for 0.5 h. The samples were washed with the aid of a magnet to retain the beads, and finally the ADC samples were eluted with 50 μL of 2% formic acid (is not this elusion buffer (0.6% FA in 90:10 H2O:ACN). The samples were analyzed in a reduced format by treatment with 200 mM G


Article


7, The Royal Society of Chemistry, London, DOI: 10.1039/ 9781849732178-00224. (5) Pilorge, S., Rigaudeau, S., Rabian, F., Sarkozy, C., Taksin, A. L., Farhat, H., Merabet, F., Ghez, S., Raggueneau, V., Terre, et al. (2014) Fractionated gemtuzumab ozogamicin and standard dose cytarabine produced prolonged second remissions in patients over the age of 55 years with acute myeloid leukemia in late first relapse. Am. J. Hematol. 89, 399−403. (6) Jen, E. Y., Ko, C.-W., Lee, J. E., Del Valle, P. L., Aydanian, A., Jewell, C., Norsworthy, K. J., Przepiorka, D., Nie, L., Liu, J., et al. (2018) FDA Approval: Gemtuzumab Ozogamicin for the Treatment of Adults with Newly Diagnosed CD33-Positive Acute Myeloid Leukemia. Clin. Cancer Res. 24, 3242−3246. (7) Hamann, P. R., Hinman, L. M., Hollander, I., Beyer, C. F., Lindh, D., Holcomb, R., Hallett, W., Tsou, H.-R., Upeslacis, J., Shochat, D., et al. (2002) Gemtuzumab Ozogamicin, A Potent and Selective AntiCD33 Antibody-Calicheamicin Conjugate for Treatment of Acute Myeloid Leukemia. Bioconjugate Chem. 13, 47−58. (8) Kantarjian, H. M., DeAngelo, D. J., Stelljes, M., Martinelli, G., Liedtke, M., Stock, W., Gökbuget, N., O’Brien, S., Wang, K., Wang, T., et al. (2016) Inotuzumab Ozogamicin versus Standard Therapy for Acute Lymphoblastic Leukemia. N. Engl. J. Med. 375, 740−753. (9) Lambert, J. M., and Chari, R. V. (2014) Ado-trastuzumab Emtansine (T-DM1): an antibody-drug conjugate (ADC) for HER2positive breast cancer. J. Med. Chem. 57, 6949−6964. (10) Senter, P. D., and Sievers, E. L. (2012) The discovery and development of brentuximab vedotin for use in relapsed Hodgkin lymphoma and systemic anaplastic large cell lymphoma. Nat. Biotechnol. 30, 631−637. (11) Kupchan, S. M., Komoda, Y., Branfman, A. R., Sneden, A. T., Court, W. A., Thomas, G. J., Hintz, H. P., Smith, R. M., Karim, A., Howie, G. A., et al. (1977) The maytansinoids. Isolation, structural elucidation, and chemical interrelation of novel ansa macrolides. J. Org. Chem. 42, 2349−2357. (12) Doronina, S. O., Toki, B. E., Torgov, M. Y., Mendelsohn, B. A., Cerveny, C. G., Chace, D. F., DeBlanc, R. L., Gearing, R. P., Bovee, T. D., Siegall, C. B., et al. (2003) Development of potent monoclonal antibody auristatin conjugates for cancer therapy. Nat. Biotechnol. 21, 778−784. (13) Maderna, A., Doroski, M., Subramanyam, C., Porte, A., Leverett, C. A., Vetelino, B. C., Chen, Z., Risley, H., Parris, K., Pandit, J., et al. (2014) Discovery of cytotoxic dolastatin 10 analogues with Nterminal modifications. J. Med. Chem. 57, 10527−10543. (14) Pettit, G. R., Kamano, Y., Herald, C. L., Tuinman, A. A., Boettner, F. E., Kizu, H., Schmidt, J. M., Baczynskyj, L., Tomer, K. B., and Bontems, R. J. (1987) The isolation and structure of a remarkable marine animal antineoplastic constituent: dolastatin 10. J. Am. Chem. Soc. 109, 6883−6885. (15) Sasse, F., Steinmetz, H., Heil, J., Hofle, G., and Reichenbach, H. (2000) Tubulysins, new cytostatic peptides from myxobacteria acting on microtubuli. Production, isolation, physico-chemical and biological properties. J. Antibiot. 53, 879−885. (16) Li, J. Y., Perry, S. R., Muniz-Medina, V., Wang, X., Wetzel, L. K., Rebelatto, M. C., Hinrichs, M. J., Bezabeh, B. Z., Fleming, R. L., Dimasi, N., et al. (2016) A Biparatopic HER2-Targeting AntibodyDrug Conjugate Induces Tumor Regression in Primary Models Refractory to or Ineligible for HER2-Targeted Therapy. Cancer Cell 29, 117−129. (17) Tumey, L. N., Leverett, C. A., Vetelino, B., Li, F., Rago, B., Han, X., Loganzo, F., Musto, S., Bai, G., Sukuru, S. C. K., et al. (2016) Optimization of Tubulysin Antibody−Drug Conjugates: A Case Study in Addressing ADC Metabolism. ACS Med. Chem. Lett. 7, 977− 982. (18) Verma, V. A., Pillow, T. H., DePalatis, L., Li, G., Phillips, G. L., Polson, A. G., Raab, H. E., Spencer, S., and Zheng, B. (2015) The cryptophycins as potent payloads for antibody drug conjugates. Bioorg. Med. Chem. Lett. 25, 864−868. (19) Sharkey, R. M., Govindan, S. V., Cardillo, T. M., and Goldenberg, D. M. (2012) Epratuzumab−SN-38: A New Anti-

comprised of MeCN. The gradient system used was as follows: initially, 5% B held for 0.8 min followed by a linear gradient to 95% B from 0.8 to 7.0 min, hold at 95% B until 9.0 min, a third linear gradient to 5% B at 9 to 9.2 min, and finally a 0.8 min reequilibration period at 5% B. Injections of 10 μL were made by a CTC PAL autosampler.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.bioconjchem.8b00843.

■

Procedures and analytical methods for linker-payload synthesis; Figure S1: body weights of mice treated with ADCs; Table S1: SPR data for selected natural product depsipeptide bis-intercalators; Figure S2: plasma stability data for compounds 4 and 5 (PDF)

AUTHOR INFORMATION

Corresponding Author

*E-mail: edmund.graziani@pfizer.com. Phone: (860)-7156768. ORCID

Edmund I. Graziani: 0000-0003-4742-3900 Present Addresses ∥

School of Pharmacy and Pharmaceutical Sciences, SUNY Binghamton, P.O. Box 6000, Binghamton, NY 13902-6000, USA. ⊥ Zymergen Inc., 5980 Horton St. #105, Emeryville, CA 94608, USA. # Amgen, 360 Binney St., Cambridge, MA 02141, USA. ∇ Integrated Commissioning & Qualification, Corp., 23 Frances Barber Dr., Hope Valley, RI 02832, USA. ○ Pfizer Ventures, 235 E 42nd St., New York, NY 10017, USA. Notes

The authors declare the following competing financial interest(s): All authors are or were employees and/or shareholders of Pfizer Inc. at the time the work was completed. § Retired.

■

ACKNOWLEDGMENTS We thank Xiaogang Han, Christopher Stratton, Andrew Bessire, Alex Porte, Tracey Clark, Chetan Sukuru, Qiming Mu, Baojiang Zheng, Justin Stroh, Qingshan Huang, Erlong Zhang, Junjuan Liu, Jianfeng Zhu, Puja Sapra, and Hans-Peter Gerber for support and input.

■

REFERENCES

(1) DeCarvalho, S., Rand, H. J., and Lewis, A. (1964) Coupling of Cyclic Chemotherapeutic Compounds to Immune Gamma-Globulins. Nature 202, 255−258. (2) Beck, A., Goetsch, L., Dumontet, C., and Corvaïa, N. (2017) Strategies and challenges for the next generation of antibody−drug conjugates. Nat. Rev. Drug Discovery 16, 315−337. (3) Graziani, E. I., and Tumey, L. N. (2013) Recent Advances in Antibody-Drug Conjugates. In Biotherapeutics: Recent Developments using Chemical and Molecular Biology (Jones, L., and McKnight, A., Eds.) pp 145−175, Chapter 6, The Royal Society of Chemistry, London, DOI: 10.1039/9781849737159-00145. (4) Hamann, P. R., and Dushin, R. G. (2011) Antibody−Drug Conjugates in Oncology (Bunnage, M. E., Ed.), pp 224−257, Chapter H


Article

Bioconjugate Chemistry body−Drug Conjugate for the Therapy of Hematologic Malignancies. Mol. Cancer Ther. 11, 224−234. (20) Wieland, H., and Hallermayer, R. (1941) Ü ber die Giftstoffe des Knollenblätterpilzes. VI. Amanitin, das Hauptgift des Knollenblätterpilzes. Justus Liebigs Annalen der Chemie 548, 1−18. (21) Moldenhauer, G., Salnikov, A. V., Lüttgau, S., Herr, I., Anderl, J., and Faulstich, H. (2012) Therapeutic potential of amanitinconjugated anti-epithelial cell adhesion molecule monoclonal antibody against pancreatic carcinoma. Journal of the National Cancer Institute 104, 622−634. (22) Puthenveetil, S., Loganzo, F., He, H., Dirico, K., Green, M., Teske, J., Musto, S., Clark, T., Rago, B., Koehn, F., et al. (2016) Natural Product Splicing Inhibitors: A New Class of Antibody-Drug Conjugate (ADC) Payloads. Bioconjugate Chem. 27, 1880−1888. (23) Yu, S. F., Zheng, B., Go, M., Lau, J., Spencer, S., Raab, H., Soriano, R., Jhunjhunwala, S., Cohen, R., Caruso, M., et al. (2015) A Novel Anti-CD22 Anthracycline-Based Antibody-Drug Conjugate (ADC) That Overcomes Resistance to Auristatin-Based ADCs. Clin. Cancer Res. 21, 3298−3306. (24) Krop, I. E., Kim, S.-B., González-Martín, A., LoRusso, P. M., Ferrero, J.-M., Smitt, M., Yu, R., Leung, A. C. F., and Wildiers, H. (2014) Trastuzumab emtansine versus treatment of physician’s choice for pretreated HER2-positive advanced breast cancer (TH3RESA): a randomised, open-label, phase 3 trial. Lancet Oncol. 15, 689−699. (25) Verma, S., Miles, D., Gianni, L., Krop, I. E., Welslau, M., Baselga, J., Pegram, M., Oh, D.-Y., Diéras, V., Guardino, E., et al. (2012) Trastuzumab Emtansine for HER2-Positive Advanced Breast Cancer. N. Engl. J. Med. 367, 1783−1791. (26) Elgersma, R. C., Coumans, R. G., Huijbregts, T., Menge, W. M., Joosten, J. A., Spijker, H. J., de Groot, F. M., van der Lee, M. M., Ubink, R., van den Dobbelsteen, D. J., et al. (2015) Design, Synthesis, and Evaluation of Linker-Duocarmycin Payloads: Toward Selection of HER2-Targeting Antibody-Drug Conjugate SYD985. Mol. Pharmaceutics 12, 1813−1835. (27) Hartley, J. A., Hamaguchi, A., Coffils, M., Martin, C. R. H., Suggitt, M., Chen, Z., Gregson, S. J., Masterson, L. A., Tiberghien, A. C., Hartley, J. M., et al. (2010) SG2285, a Novel C2-Aryl-Substituted Pyrrolobenzodiazepine Dimer Prodrug That Cross-links DNA and Exerts Highly Potent Antitumor Activity. Cancer Res. 70, 6849−6858. (28) Jeffrey, S. C., Burke, P. J., Lyon, R. P., Meyer, D. W., Sussman, D., Anderson, M., Hunter, J. H., Leiske, C. I., Miyamoto, J. B., Nicholas, N. D., et al. (2013) A Potent Anti-CD70 Antibody−Drug Conjugate Combining a Dimeric Pyrrolobenzodiazepine Drug with Site-Specific Conjugation Technology. Bioconjugate Chem. 24, 1256− 1263. (29) Zolova, O. E., Mady, A. S. A., and Garneau-Tsodikova, S. (2010) Recent developments in bisintercalator natural products. Biopolymers 93, 777−790. (30) Keller-Schierlein, W., Mihailovié, M. L., and Prelog, V. (1959) Stoffwechselprodukte von Actinomyceten. 15. Mitteilung. über die Konstitution von Echinomycin. Helv. Chim. Acta 42, 305−322. (31) Wang, Y., Liu, Y., Tang, F., Bernot, K. M., Schore, R., Marcucci, G., Caligiuri, M. A., Zheng, P., and Liu, Y. (2014) Echinomycin protects mice against relapsed acute myeloid leukemia without adverse effect on hematopoietic stem cells. Blood 124, 1127−1135. (32) Foster, B. J., Clagett-Carr, K., Shoemaker, D. D., Suffness, M., Plowman, J., Trissel, L. A., Grieshaber, C. K., and Leyland-Jones, B. (1985) Echinomycin: The first bifunctional intercalating agent in clinical trials. Invest. New Drugs 3, 403−410. (33) Chang, A. Y., Kim, K., Boucher, H., Bonomi, P., Stewart, J. A., Karp, D. D., and Blum, R. H. (1998) A randomized Phase II trial of echinomycin, trimetrexate, and cisplatin plus etoposide in patients with metastatic nonsmall cell lung carcinoma. Cancer 82, 292−300. (34) Park, Y.-S., Shin, W.-S., Kim, C.-S., Ahn, C. M., Qi, X.-F., and Kim, S.-K. (2018) Molecular and cellular toxicological profiling of DNA bis-intercalator, quinoxaline compounds: echinomycin as the versatile lead. Mol. Cell. Toxicol. 14, 9−18.

(35) Toda, S., Sugawara, K., Nishiyama, Y., Ohbayashi, M., Ohkusa, N., Yamamoto, H., Konishi, M., and Oki, T. (1990) Quinaldopeptin, a novel antibiotic of the quinomycin family. J. Antibiot. 43, 796−808. (36) Matson, J. A., and Bush, J. A. (1989) Sandramycin, a novel antitumor antibiotic produced by a Nocardioides sp. Production, isolation, characterization and biological properties. J. Antibiot. 42, 1763−1767. (37) Takahashi, K., Koshino, H., Esumi, Y., Tsuda, E., and Kurosawa, K. (2001) SW-163C and E, novel antitumor depsipeptides produced by Streptomyces sp. II. Structure elucidation. J. Antibiot. 54, 622−627. (38) Nakaya, M., Oguri, H., Takahashi, K., Fukushi, E., Watanabe, K., and Oikawa, H. (2007) Relative and absolute configuration of antitumor agent SW-163D. Biosci., Biotechnol., Biochem. 71, 2969− 2976. (39) Ohkuma, H., Sakai, F., Nishiyama, Y., Ohbayashi, M., Imanishi, H., Konishi, M., Miyaki, T., Koshiyama, H., and Kawaguchi, H. (1980) BBM-928, a new antitumor antibiotic complex. I. Production, isolation, characterization and antitumor activity. J. Antibiot. 33, 1087−1097. (40) Shoji, J. I., and Katagiri, K. (1961) Studies on quinoxaline antibiotics. II. New antibiotics, triostins A, B and C. J. Antibiot. 14, 335−339. (41) Lingham, R. B., Hsu, A. H., O’Brien, J. A., Sigmund, J. M., Sanchez, M., Gagliardi, M. M., Heimbuch, B. K., Genilloud, O., Martin, I., Diez, M. T., et al. (1996) Quinoxapeptins: novel chromodepsipeptide inhibitors of HIV-1 and HIV-2 reverse transcriptase. I. The producing organism and biological activity. J. Antibiot. 49, 253−259. (42) Wang, A. H., Ughetto, G., Quigley, G. J., Hakoshima, T., van der Marel, G. A., van Boom, J. H., and Rich, A. (1984) The molecular structure of a DNA-triostin A complex. Science (Washington, DC, U. S.) 225, 1115−1121. (43) Wang, A. H., Ughetto, G., Quigley, G. J., and Rich, A. (1986) Interactions of quinoxaline antibiotic and DNA: the molecular structure of a triostin A-d(GCGTACGC) complex. J. Biomol. Struct. Dyn. 4, 319−342. (44) Hattori, K., Koike, K., Okuda, K., Hirayama, T., Ebihara, M., Takenaka, M., and Nagasawa, H. (2016) Solution-phase synthesis and biological evaluation of triostin A and its analogues. Org. Biomol. Chem. 14, 2090−2111. (45) Katayama, K., Okamura, T., Sunadome, T., Nakagawa, K., Takeda, H., Shiro, M., Matsuda, A., and Ichikawa, S. (2014) Synthesis and Biological Evaluation of Quinaldopeptin. J. Org. Chem. 79, 2580− 2590. (46) Ho, Y. T. C., Leng, D. J., Ghiringhelli, F., Wilkening, I., Bushell, D. P., Kostner, O., Riva, E., Havemann, J., Passarella, D., and Tosin, M. (2017) Novel chemical probes for the investigation of nonribosomal peptide assembly. Chem. Commun. 53, 7088−7091. (47) Hotta, K., Keegan, R. M., Ranganathan, S., Fang, M., Bibby, J., Winn, M. D., Sato, M., Lian, M., Watanabe, K., Rigden, D. J., et al. (2014) Conversion of a disulfide bond into a thioacetal group during echinomycin biosynthesis. Angew. Chem., Int. Ed. 53, 824−828. (48) Lombo, F., Velasco, A., Castro, A., de la Calle, F., Brana, A. F., Sanchez-Puelles, J. M., Mendez, C., and Salas, J. A. (2006) Deciphering the biosynthesis pathway of the antitumor thiocoraline from a marine actinomycete and its expression in two streptomyces species. ChemBioChem 7, 366−376. (49) Mori, S., Shrestha, S. K., Fernández, J., Á lvarez San Millán, M., Garzan, A., Al-Mestarihi, A. H., Lombó, F., and Garneau-Tsodikova, S. (2017) Activation and Loading of the Starter Unit during Thiocoraline Biosynthesis. Biochemistry 56, 4457−4467. (50) Praseuth, A. P., Wang, C. C., Watanabe, K., Hotta, K., Oguri, H., and Oikawa, H. (2008) Complete sequence of biosynthetic gene cluster responsible for producing triostin A and evaluation of quinomycin-type antibiotics from Streptomyces triostinicus. Biotechnol. Prog. 24, 1226−1231. (51) Watanabe, K., Hotta, K., Nakaya, M., Praseuth, A. P., Wang, C. C. C., Inada, D., Takahashi, K., Fukushi, E., Oguri, H., and Oikawa, H. I


Article

Bioconjugate Chemistry (2009) Escherichia coli Allows Efficient Modular Incorporation of Newly Isolated Quinomycin Biosynthetic Enzyme into Echinomycin Biosynthetic Pathway for Rational Design and Synthesis of Potent Antibiotic Unnatural Natural Product. J. Am. Chem. Soc. 131, 9347− 9353. (52) Skinnider, M. A., Johnston, C. W., Zvanych, R., and Magarvey, N. A. (2015) Automated Identification of Depsipeptide Natural Products by an Informatic Search Algorithm. ChemBioChem 16, 223− 227. (53) Strop, P., Liu, S. H., Dorywalska, M., Delaria, K., Dushin, R. G., Tran, T. T., Ho, W. H., Farias, S., Casas, M. G., Abdiche, Y., et al. (2013) Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates. Chem. Biol. 20, 161− 167. (54) Dubowchik, G. M., Firestone, R. A., Padilla, L., Willner, D., Hofstead, S. J., Mosure, K., Knipe, J. O., Lasch, S. J., and Trail, P. A. (2002) Cathepsin B-Labile Dipeptide Linkers for Lysosomal Release of Doxorubicin from Internalizing Immunoconjugates: Model Studies of Enzymatic Drug Release and Antigen-Specific In Vitro Anticancer Activity. Bioconjugate Chem. 13, 855−869. (55) Strop, P., Delaria, K., Foletti, D., Witt, J. M., Hasa-Moreno, A., Poulsen, K., Casas, M. G., Dorywalska, M., Farias, S., Pios, A., et al. (2015) Site-specific conjugation improves therapeutic index of antibody drug conjugates with high drug loading. Nat. Biotechnol. 33, 694. (56) Puthenveetil, S., He, H., Loganzo, F., Musto, S., Teske, J., Green, M., Tan, X., Hosselet, C., Lucas, J., Tumey, L. N., et al. (2017) Multivalent peptidic linker enables identification of preferred sites of conjugation for a potent thialanstatin antibody drug conjugate. PLoS One 12, e0178452. (57) Dancik, V., Seiler, K. P., Young, D. W., Schreiber, S. L., and Clemons, P. A. (2010) Distinct biological network properties between the targets of natural products and disease genes. J. Am. Chem. Soc. 132, 9259−9261. (58) Sung, M., Tan, X., Lu, B., Golas, J., Hosselet, C., Wang, F., Tylaska, L., King, L., Zhou, D., Dushin, R., et al. (2018) CaveolaeMediated Endocytosis as a Novel Mechanism of Resistance to Trastuzumab Emtansine (T-DM1). Mol. Cancer Ther. 17, 243−253. (59) Loganzo, F., Tan, X., Sung, M., Jin, G., Myers, J. S., Melamud, E., Wang, F., Diesl, V., Follettie, M. T., Musto, S., et al. (2015) Tumor cells chronically treated with a trastuzumab-maytansinoid antibodydrug conjugate develop varied resistance mechanisms but respond to alternate treatments. Mol. Cancer Ther. 14, 952−963.

J


Natural Product Bis-Intercalator Depsipeptides as a New Class of

Recommend Documents