Observation by Real-Time NMR and Interpretation of Length- and

Sep 27, 2017 - (4, 5) Importantly, it has recently been shown that aberrant expression of A3B causes a genomic DNA lesion, which thereby results in se...
0 downloads 7 Views 560KB Size
Download PDF
Subscriber access provided by AUBURN UNIV AUBURN

Letter

Observation by real-time NMR, and interpretation of lengthand location-dependent deamination activity of APOBEC3B Li Wan, Takashi Nagata, Ryo Morishita, Akifumi Takaori-Kondo, and Masato Katahira ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/acschembio.7b00662 • Publication Date (Web): 27 Sep 2017 Downloaded from http://pubs.acs.org on September 29, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

Observation by real-time NMR, and interpretation of length- and location-dependent deamination activity of APOBEC3B Li Wana, Takashi Nagataa, Ryo Morishitab, Akifumi Takaori-Kondoc, Masato Katahira*a a

Institute of Advanced Energy and Graduate School of Energy Science, Kyoto University, Gokasho, Uji, 611-0011, Kyoto, Japan. *Email: [email protected] b

CellFree Sciences Co., Ltd. Matsuyama, 790-8577, Ehime, Japan

c

Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, 606-8507, Kyoto, Japan

Abstract: Human APOBEC3B (A3B) deaminates a cytosine into a uracil in single-stranded (ss) DNA, resulting in human cancers. A3B’s deamination activity is conferred by its Cterminal domain (CTD). However, little is known about the mechanism by which target sequences are searched and deaminated. Here, we applied the real-time NMR method to elucidate the deamination properties. We found that A3B CTD shows higher activity toward its target sequence in short ssDNA and efficiently deaminates a target sequence located near the center of ssDNA. These properties are quite different from those of well-studied APOBEC3G, which shows higher activity toward its target sequence in long ssDNA and one located close to the 5′-end. The unique properties of the A3B CTD can be rationally interpreted by considering that after non-specific binding to ssDNA, A3B slides only for a relatively short distance and tends to dissociate from the ssDNA before reaching the target sequence.

APOBEC3 (A3) proteins deaminate a cytosine into a uracil in single-stranded DNA (ssDNA).1–3 There are seven A3 proteins, each of which comprises either one (A3A, A3C, and A3H) or two (A3B, A3F, A3D, and A3G) deaminase domains. For the latter, only the C-terminal deaminase domain confers the cytosine deaminase activity.4,5 Importantly, it has recently been shown that aberrant expression of A3B causes a genomic DNA lesion, which thereby results in several cancer types such as breast, bladder, and cervix cancers.6–8 To date, research has been highly focused on A3G and A3F.9–12 A3G non-specifically binds to ssDNA, slides processively, and exhibits higher deamination activity toward a target 5′-CCC-3′ sequence located closer to the 5′-end than one located less close to the 3′-end (named 3′→5′ polarity).9,11 A3F also exhibits processivity.13 Previously, we developed a real-time NMR method to monitor the cytosine deamination by A3G and characterized the sliding of A3G on ssDNA.11,14,15 Compared to conventional biochemical methods, our method can monitor the reaction more quantitatively using data at much more time points and thus provide more accurate reaction rate. Here, we applied this method as well as biochemical methods to investigate the deamination properties of A3B. Regarding A3G, a target sequence in long ssDNA is deaminated more efficiently than one in shorter ssDNA.9 We first used the uracil DNA glycosylase (UDG) assay to analyse the ssDNA-length-dependent activity of the active C-

terminal domain (CTD) of A3B toward ssDNA ranging in size from 10 to 85 nucleotides (nt), each ssDNA containing a single 5′-TC-3′ target sequence located near the center (SFITC_10–85, Table 1). In Figure 1b, the ability of deamination by A3B CTD is plotted against the length of the ssDNA. A3B CTD's activity is high for short ssDNA. We also applied a real-time NMR method. We monitored the time-course of the intensity of the H5-H6 TOCSY correlation peak of the cytosine of 10 nt (STTCA, Table 1) and 46 nt (SmTTCA, Table 1) ssDNA (Figure 1c and 1d). It was indicated that the target sequence in STTCA is deaminated completely within 4 h, while in the case of SmTTCA, about 40 % of the substrate still remained unreacted after 16 h. These results clearly indicate that the A3B CTD has a tendency to efficiently deaminate a target sequence in short ssDNA. By the use of similar DNAs applied for A3B CTD as substrates, it was confirmed that A3G CTD efficiently deaminates a target sequence in long ssDNA (data not shown), which is consistent with previous report.9

Figure 1 Length-dependent deamination of ssDNA by A3B CTD. (a) Deamination activities of A3B CTD toward ssDNAs with different lengths were examined by UDG assay. The length of each ssDNA is indicated at the top of the gel. The upper and lower bands in each lane represent unreacted substrate and deamination product, respectively. (b) Efficiency of the deamination for each ssDNA revealed by UDG assay. (c) Deamination activities of A3B CTD monitored by the realtime NMR method. H5-H6 TOCSY correlation peaks for 10 nt STTCA (top) at 0 and 3.8 h, and 46 nt SmTTCA (bottom) at 0 and 16.3 h after addition of A3B CTD are shown. Correlation peaks for a cytosine and a produced uracil are labeled with C and U, respectively. (d) Timecourses of the change in the intensity of a cytosine peak for STTCA (green) and SmTTCA (blue).

ACS Paragon Plus Environment

ACS Chemical Biology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table 1 List of oligonucleotides used in this study. Name SFITC_10 SFITC_15 SFITC_22 SFITC_30 SFITC_49 SFITC_67 SFITC_85 STTCA SmTTCA S5́ TTCA S3́ TTCA SFITC_1 SFITC_2 Sss

Sequence* 5′˗(FITC)ATATTCAAAG˗3′ 5′˗(FITC)TGATATTCAAAGAGT˗3′ 5′˗(FITC)AAAGTGATATTCAAAGAGTAAA˗3′ 5′˗(FITC)AAAGAGAAAGTGATATTCAAAGAGTAAAGT˗3′ 5′˗(FITC)ATAATAATAATAATAATAATAATATTCATTTATAAT AATAATAATAATA˗3′ 5′˗(FITC)ATAATAATAATAATAATAATAATAATAATAATAAT AATAATATTCATTTATAATAATAATAATAATA˗3′ 5′˗(FITC)ATAATAATAATAATAATAATAATAATAATAATAATA ATAATATTCATTTATAATAATAATAATAATAATAATAATAAT AATAATA˗3′ 5′˗AAATTCAAAG˗3′ 5′˗A21TTCAA21˗3′ 5′˗AAAAATTCAA37˗3′ 5′˗A36TTCAAAAAAA˗3′ 5′˗(FITC)ATATATTCATAAAAA˗3′ 5′˗(FITC)AAAAATTCAAAAAAA˗3′ 5′˗ATATATTCATA23TTCA7TGTATGGTTATGGTGGTGTAA7˗3′

Sds

5′˗ATATATTCATA23TTCA6ATGTATGGTTATGGTGGTGTAA7˗3′ ACATACCAATACCACCACAT *The target cytosine of the 5́ -TC-3́ sequence is underlined.

We then investigated the binding ability of the A3B CTD by electrophoretic mobility shift assay (EMSA). For comparison, A3F CTD, which shares the same target sequence with A3B CTD, was used. The EMSA results showed the band of the A3F CTD-ssDNA complex (Supplementary Figure 1a). On the other hand, no band was observed for the A3B CTD-ssDNA complex (Supplementary Figure 1b), indicating low affinity. We also carried out steady-state fluorescence anisotropy (FA) measurement. We used 49 nt FITC-labelled ssDNA (SFITC_49, Table 1) as a substrate. The FA value of SFITC_49 increased upon addition of A3F CTD, indicating the formation of a complex. A3B CTD titration, however, caused no change in the FA value (Supplementary Figure 1c). These results indicate that the binding of A3B CTD to ssDNA is too weak to be detected. In our previous study on A3G CTD, the band of the complex with ssDNA was detected by EMSA analysis, and the dissociation constant, Kd, was determined to be ca. 0.1 mM.14 For A3B CTD, the band of the complex with ssDNA was not detected, which suggested that ssDNA-binding affinity of A3B CTD is weaker than that of A3G CTD. Therefore, for the discussion below, we assume the Kd value of 1 mM for the A3B CTD:ssDNA complex, which is larger than that for A3G CTD:ssDNA complex by one order. To interpret the ssDNA-length-dependent deamination activity of A3B CTD, we considered two substrates, 15 nt ssDNA (Figure 2a) and 45 nt ssDNA (Figure 2b - d), both having a single 5′-TC-3′ target sequence at the center. 45 nt ssDNA can be considered to comprise three sections, D1, D2, and D3. Considering the weak affinity of A3B CTD, the Kd value for the A3B CTD-15 nt ssDNA complex is tentatively assumed to be 1 mM. The total concentrations of A3B CTD and ssDNA applied for real-time NMR analysis (Figure 1c and d) were 1 µM and 200 µM, respectively. Under these conditions, the concentrations of A3B CTD bound to ssDNA were calculated to be 0.165 µM for 15 nt ssDNA and 0.375 µM for 45 nt ssDNA, where 200 µM × (45 nt / 15 nt) = 600 µM was used as an effective concentration of 45 nt ssDNA. Accordingly, A3B CTD bound at each 15 nt section (D1, D2, or D3) of 45 nt ssDNA can be deduced to be 0.125 µM (onethird of 0.375 µM). We assume, for simplicity, that all A3B CTD that bound to 15 nt ssDNA (D0) can reach the target sequence in D0 through sliding (Figure 2a). This means that

A3B CTD can slide along ssDNA by 7 nt without dissociation. The number of 7 nt was taken as one of the realistic numbers on the basis of the result of Figure 1b. It is similarly supposed that all A3B CTD that bound to the D2 section of 45 nt ssDNA (0.125 µM) can reach the target sequence in D2. It is supposed that A3B CTD that bound to the D1 (or D3) section slides along ssDNA, but that it mostly dissociates from the ssDNA before reaching the D2 section, because of weak affinity (Figure 2b or 2d). We assume, for example, that only 5% of A3B CTD that bound to the D1 (or D3) section can reach the D2 section ("survival"). In this case, the concentration of A3B CTD that bound to D1 (or D3) and slides over to D2 to reach the target sequence is estimated to be 0.125 µM × 0.05 = 0.00625 µM. Therefore, the expected concentration of the A3B CTD that can reach the target sequence in 45 nt ssDNA for possible deamination is 0.125 µM + 2 × (0.125 µM × 0.05) = 0.138 µM. This value is smaller than the concentration of A3B CTD that reaches the target sequence of 15 nt ssDNA (0.165 µM). This coincides with the fact that 15 nt ssDNA is deaminated with higher

Figure 2 Description of the target search by A3B CTD with binding, sliding, dissociation, and survival of sliding. (a) A case of 15 nt ssDNA (D0). (b - d) Cases of 45 nt ssDNA that comprises three 15 nt sections (D1, D2, and D3), having a target sequence, 5′-TC-3′, in D2. A3B CTD binds to either D1 (b), D2 (c) or D3 (d), respectively. (e g) Cases of 45 nt ssDNA which has the target sequence in either D1 (e), D2 (f), or D3 (g), respectively. A3B CTD binds to either D1, D2 or D3 in each case.

ACS Paragon Plus Environment

Page 2 of 6

Page 3 of 6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

activity than 45 nt ssDNA. The essence is that although D1 and D3 of 45 nt ssDNA serve as landing points to recruit A3B CTD to the target sequence in D2, they act more as competitors for binding of A3B CTD to the target sequence in D2 and thereby reduce the concentration of A3B CTD that reaches the target sequence in D2. This is due to the relatively short distance of sliding of A3B CTD as a result of weak affinity. Thus, the ssDNA-length-dependent deamination activity of A3B CTD can be rationally interpreted. In the interpretation above, the realistic Kd value of 1 mM, which was deduced from the experimental EMSA results and FA measurements, was assumed. To further justify the interpretation, we constructed a more general mathematical model in which no assumption on the Kd value was made (Appendix of Supplementary Information). The mathematical model could reproduce the higher activity of A3B CTD toward 10 nt ssDNA than toward 30 nt, as was observed in Figures 1a and 1b, on the basis of intrinsically the same idea described above. This result further justified the interpretation. Besides sliding, hopping/jumping may also be used for A3B CTD to search for the target sequence. This possibility is not excluded. Even in that case, the ssDNA-lengthdependent deamination activity can be explained basically in the same way. It was noticed in Figure 1b that the deamination efficiency reached the plateau level at the length of 30 nt, the efficiency being basically the same for longer ssDNAs. One possible interpretation is that the intersegmental transfer of A3B CTD occurs and contributes to the target search for longer ssDNAs. Intersegmental transfer is known as a phenomenon that the protein moves between two sites widely separated along the DNA contour but closely spaced in three dimensions.16,17 For longer ssDNA, two sites widely separated along the ssDNA contour can be closely spaced in three dimensions because of easiness of looping for longer ssDNA. Thus, the intersegmental transfer of A3B CTD could occur for longer ssDNAs, resulting in the efficient target search and deamination. This may compensate for the reduction in deamination efficiency caused by the competitive effect of longer ssDNAs. The contribution of the intersegmental transfer to the deamination was suggested for A3G18 and activation-induced deoxycytidine deaminase.19 Next, we examined the dependence of the deamination activity on the location of the target sequence, using three different ssDNAs, S5′TTCA, SmTTCA, and S3′TTCA (Table 1), having a single target sequence at a region close to the 5′-end, center, and 3′-end, respectively. The intensity of the peak of the cytosine in the 5′-TC-3′ target sequence was plotted for each ssDNA against time (Figure 3a). The substrate SmTTCA, which has a target sequence near the center, is deaminated most efficiently by A3B (Figures 3a and Supplementary Figure 2). This is quite different from the case of A3G, in which a target sequence located closer to the 5′-end is deaminated more effectively.9,11 This characteristics of A3G was confirmed by the use of similar DNAs applied for A3B as substrates (data not shown).

To interpret the location-dependent ability of deamination by A3B CTD, we consider three cases, in which 45 nt ssDNA has a single target sequence in either the D1, D2, or D3 section (Figure 2e - g). First, the case in which the target sequence is located in D2 (Figure 2f) is considered. It is supposed again, for simplicity, that all A3B CTD that bound to D2 can reach the target sequence through sliding (Figure 2f middle). It is supposed, however, that most A3B CTD that bound to D1 (or D3) cannot reach the target sequence due to dissociation during sliding (Figure 2f top or bottom). Secondly, the case in which the target sequence is located in

Figure 3 Location-dependent deamination activity of A3B CTD revealed by real-time NMR monitoring. (a) Time courses of the intensity of the target cytosine during deamination for C8 (●) of S5′TTCA, C24 (■) of SmTTCA, and C36 (▲) of S3′TTCA, respectively. Time courses of the intensity for C8 (●) and C36 (▲) of either Sss (b) or Sds (c).

D1 (Figure 2e) is considered. It is supposed similarly that all A3B CTD that bound to D1 can reach the target sequence (Figure 2e top). Most A3B CTD that bound to D2, however, is supposed not to be able to reach the target sequence due to dissociation (Figure 2e middle). It should be noted that it is even more difficult for A3B CTD that bound to D3 to reach the target sequence, because the distance between the target sequence in D1 and A3B CTD bound at D3 is greater and thus the possibility of dissociation during sliding is higher (Figure 2e bottom). In total, the concentration of A3B CTD that reaches the target sequence is higher for the case in which the target sequence is in the central section, D2, than for the case in which the target sequence is in the left section, D1. Thirdly, the case in which the target sequence is located in D3 (Figure 2g) should exhibit a similar situation as for the case in which the target sequence is located in D1. In summary, a target sequence located at the centre of ssDNA has more chance to meet A3B CTD for possible deamination than one located close to either the 5′- or 3′-end. The essence is when the target sequence is at the center, it has two DNA regions, one on both sides, which serve to recruit A3B CTD through sliding, while when the target sequence is close to either 5′- or 3′-end, it has only one DNA region on one side that serves for recruitment. In this way, the locationdependent deamination activity can be rationally interpreted. In order to further justify the interpretation, we again

ACS Paragon Plus Environment

ACS Chemical Biology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

constructed a mathematical model (Appendix of Supplementary Information). The mathematical model could reproduce the efficient deamination of the target sequence located near the center of ssDNA than one located close to either the 5′- or 3′-end, as was observed in Figures 3a, on the basis of intrinsically the same idea described in the previous section (Appendix of Supplementary Information). When, besides sliding, hopping/jumping is also used for A3B CTD to search for the target sequence, location-dependent deamination activity can be explained basically in the same way. The intersegmental transfer may compensate for the disadvantage in the target search for the target sequence located close to either the 5′- or 3′-end to some extent, as discussed for length-dependent deamination activity. To further validate the location-dependent deamination activity and its interpretation, we subsequently performed real-time NMR analysis using an ssDNA containing two target sequences, Sss (Table 1). The target sequences in Sss are located near the 5′-end and the center, respectively. We first confirmed by UDG assay using SFITC_1 and SFITC_2 (Table 1) that the difference in the sequences of the flanking regions does not affect the deamination activity (Supplementary Figure 3). It was also confirmed that no peak is observed in the imino proton region of 10 – 14 ppm for Sss (data not shown). This indicated that no base pair is formed for Sss, which excluded the possibility that Sss folded into structures. Then, real-time NMR analysis showed that C36 in the target sequence near the center is deaminated more effectively than C8 in the target sequence near the 5′-end (Figures 3b and Supplementary Figure 4), which is the same observation as Figure 3a and thus can be interpreted in the same way. Next, we introduced a twenty base-pair double-stranded DNA (dsDNA) region to downstream of the central target sequence in Sss and obtained Sds (Table 1), and examined the deamination activity. It turned out that the locationdependence of deamination activity was significantly lost on the introduction of the dsDNA (Figure 3c). A3B reportedly does not interact with dsDNA,20 therefore we can assume that there is no landing point downstream of C36 except for seven adenosine residues just behind it. When the dsDNA region and the following ssDNA region in a 3'-end are ignored, C8 and C36 are symmetrically located as to each other with respect to the center of the remaining ssDNA region of Sds, like C8 and C36 of Figure 3a. Thus, the concentration of A3B CTD that reaches either C8 or C36 of Sds through sliding should be basically the same, which rationally explains the results. It should be added that deamination activity increased for both C8 and C36, when the duplex was introduced (Figure 3b and c). The introduced duplex may repress the flexibility of a whole DNA including the singlestranded regions to some extent. This may enhance the deamination activity through the stabilization of the complex. In fact, the similar enhancement of the activity at two different sites on introduction of the duplex was observed for A3G as well.11 Observation of similar deamination activity of A3B CTD for a target sequence located close to either the 5′- or 3′-end

revealed that A3B does not exhibit 3′→5′ polarity. We previously observed 3′→5′ polarity for A3G CTD.11 We discussed that a bump hanging over one side of the catalytic pocket may be responsible for the 3′→5′ polarity (Supplementary Figure 5a).11 The surface around the catalytic pocket of the A3B CTD does not have a bump (Supplementary Figure 5b).21 The bump around the catalytic pocket is not present for the chimera A3B CTD bound to ssDNA, either.22 Therefore, we suppose that this structural feature of A3B CTD causes the lack of the 3′→5′ polarity of deamination. Recently, it was reported that A3B and other A3 family proteins preferentially deaminate the lagging strand template during DNA replication,23–25 althoug it is supposed that single-stranded DNA binding proteins cover the DNA during the replication and that so the accessibility of ssDNA segments to A3B and other enzymes is rather blocked. In the course of DNA replication, for the lagging strand template, there transiently exist multiple short ssDNA regions that are not base-paired by Okazaki fragments and exposed to the solvent.26 The target sequence present in these short ssDNA regions of the lagging strand template may be effectively deaminated by A3B that shows higher activity toward its target sequence in short ssDNA, resulting in the genomic DNA lesion related to cancers. The unique properties of A3B may have such a biological relevance. In conclusion, we investigated the characteristics of the enzymatic reaction of A3B CTD by combining a real-time NMR method, UDG assay, EMSA assay, and FA measurement. It turned out that the length- and locationdependence of the deamination activity of A3B CTD are quite different from those of A3G CTD. On the basis of the weak affinity of A3B CTD to ssDNA, these characteristics were rationally interpreted. The biological relevance of the unique characters of A3B CTD is implied. Finally, our realtime NMR method should be applicable to other enzyme systems to provide us with new insights into the behaviour of enzymes. Keywords APOBEC3B • cancer • deamination • real-time NMR Acknowledgements We are grateful for the extensive expert advice provided by Dr. K.Kamba. This work was supported by JSPS KAKENHI to M.K. (#15H01256, #16H00833, and #16K14678) and to T.N. (#15H01634 and #26440026). Supplementary Information The Supplementary Information is available free of charge on the ACS Publications website at DOI: Full experimental methods and Supplementary Figures S1 to S5. References 1.

Petersen-Mahrt, S. K., and Neuberger, M. S. (2003) In vitro deamination of cytosine to uracil in single-stranded

ACS Paragon Plus Environment

Page 4 of 6

Page 5 of 6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

DNA by apolipoprotein B editing complex catalytic subunit 1 (APOBEC1), J. Biol. Chem. 278, 19583–19586. 2. Beale, R. C., Petersen-Mahrt, S. K., Watt, I. N., Harris, R. S., Rada, C., and Neuberger, M. S. (2004) Comparison of the differential context-dependence of DNA deamination by APOBEC enzymes: correlation with mutation spectra in vivo, J. Mol. Biol. 337, 585–596. 3. Sharma, S., Patnaik, S. K., Taggart, R. T., Kannisto, E. D., Enriquez, S. M., Gollnick, P., and Baysal, B. E. (2015) APOBEC3A cytidine deaminase induces RNA editing in monocytes and macrophages, Nat. Commun. 6, 6881. 4. Conticello, S. G. (2008) The AID/APOBEC family of nucleic acid mutators, Genome Biol. 9, 229. 5. LaRue, R. S., Andresdottir, V., Blanchard, Y., Conticello, S. G., Derse, D., Emerman, M., Greene, W. C., Jonsson, S. R., Landau, N. R., Lochelt, M., Malik, H. S., Malim, M. H., Munk, C., O'Brien, S. J., Pathak, V. K., Strebel, K., Wain-Hobson, S., Yu, X. F., Yuhki, N., and Harris, R. S. (2009) Guidelines for naming nonprimate APOBEC3 genes and proteins, J. Virol. 83, 494–497. 6. Shinohara, M., Io, K., Shindo, K., Matsui, M., Sakamoto, T., Tada, K., Kobayashi, M., Kadowaki, N., and TakaoriKondo, A. (2012) APOBEC3B can impair genomic stability by inducing base substitutions in genomic DNA in human cells, Sci. Rep.2, 806. 7. Burns, M. B., Lackey, L., Carpenter, M. A., Rathore, A., Land, A. M., Leonard, B., Refsland, E. W., Kotandeniya, D., Tretyakova, N., Nikas, J. B., Yee, D., Temiz, N. A., Donohue, D. E., McDougle, R. M., Brown, W. L., Law, E. K., and Harris, R. S. (2013) APOBEC3B is an enzymatic source of mutation in breast cancer, Nature 494, 366–370. 8. Burns, M. B., Temiz, N. A., and Harris, R. S. (2013) Evidence for APOBEC3B mutagenesis in multiple human cancers, Nat. Genet. 45, 977–983. 9. Chelico, L., Pham, P., Calabrese, P., and Goodman, M. F. (2006) APOBEC3G DNA deaminase acts processively 3′→5′ on single-stranded DNA, Nat. Struct. Mol. Biol. 13, 392–399. 10. Siu, K. K., Sultana, A., Azimi, F. C., and Lee, J. E. (2013) Structural determinants of HIV-1 Vif susceptibility and DNA binding in APOBEC3F, Nat. Commun. 4, 2593. 11. Furukawa, A., Sugase, K., Morishita, R., Nagata, T., Kodaki, T., Takaori-Kondo, A., Ryo, A., and Katahira, M. (2014) Quantitative analysis of location- and sequence-dependent deamination by APOBEC3G using real-time NMR spectroscopy, Angew. Chem. Int. Ed. 53, 2349–2352. 12. Chen, Q., Xiao, X., Wolfe, A., and Chen, X. S. (2016) The in vitro Biochemical Characterization of an HIV-1 Restriction Factor APOBEC3F: Importance of Loop 7 on Both CD1 and CD2 for DNA Binding and Deamination, J. Mol. Biol. 428, 2661–2670. 13. Ara, A., Love, R. P., and Chelico, L. (2014) Different mutagenic potential of HIV-1 restriction factors APOBEC3G and APOBEC3F is determined by distinct single-stranded DNA scanning mechanisms, PLoS Pathog. 10, e1004024. 14. Furukawa, A., Nagata, T., Matsugami, A., Habu, Y., Sugiyama, R., Hayashi, F., Kobayashi, N., Yokoyama, S.,

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

Takaku, H., and Katahira, M. (2009) Structure, interaction and real-time monitoring of the enzymatic reaction of wild-type APOBEC3G, The EMBO J. 28, 440–451. Kamba, K., Nagata, T., and Katahira, M. (2015) Catalytic analysis of APOBEC3G involving real-time NMR spectroscopy reveals nucleic acid determinants for deamination, PloS one10, e0124142. Halford, S. E., and Marko, J. F. (2004) How do sitespecific DNA-binding proteins find their targets? Nucleic Acids Res. 32, 3040–3052. Mechetin, G. V., and Zharkov, D. O. (2014) Mechanisms of diffusional search for specific targets by DNAdependent proteins, Biochemistry 79, 496–505. Nowarski, R., Britan-Rosich, E., Shiloach, T., and Kotler, M. (2008) Hypermutation by intersegmental transfer of APOBEC3G cytidine deaminase, Nat. Struct. Mol. Biol. 15, 1059–1066. Mak, C. H., Pham, P., Afif, S. A., and Goodman, M. F. (2013) A Mathematical Model for Scanning and Catalysis on Single-stranded DNA, Illustrated with Activation-induced Deoxycytidine Deaminase, J. Biol. Chem. 288, 29786–29795. Yu, Q., Chen, D., Konig, R., Mariani, R., Unutmaz, D., and Landau, N. R. (2004) APOBEC3B and APOBEC3C are potent inhibitors of simian immunodeficiency virus replication, J. Biol. Chem. 279, 53379–53386. Byeon, I. J., Byeon, C. H., Wu, T., Mitra, M., Singer, D., Levin, J. G., and Gronenborn, A. M. (2016) Nuclear Magnetic Resonance Structure of the APOBEC3B Catalytic Domain: Structural Basis for Substrate Binding and DNA Deaminase Activity, Biochemistry 55, 2944– 2959. Shi, K., Carpenter, M. A., Banerjee, S., Shaban, N. M., Kurahashi, K., Salamango, D. J., McCann, J. L., Starrett, G. J., Duffy, J. V., Demir, O.; Amaro, R. E., Harki, D. A., Harris, R. S., Aihara, H. (2017) Structural basis for targeted DNA cytosine deamination and mutagenesis by APOBEC3A and APOBEC3B. Nat. Struct. Mol. Biol. 24, 131–139. Bhagwat, A. S., Hao, W., Townes, J. P., Lee, H., Tang, H., and Foster, P. L. (2016) Strand-biased cytosine deamination at the replication fork causes cytosine to thymine mutations in Escherichia coli, Proc. Natl. Acad. Sci. USA. 113, 2176-2181. Haradhvala, N. J., Polak, P., Stojanov, P., Covington, K. R., Shinbrot, E., Hess, J. M., Rheinbay, E., Kim, J., Maruvka, Y. E., Braunstein, L. Z., Kamburov, A., Hanawalt, P. C., Wheeler, D. A., Koren, A., Lawrence, M. S., and Getz, G. (2016) Mutational Strand Asymmetries in Cancer Genomes Reveal Mechanisms of DNA Damage and Repair, Cell 164, 538–549. Hoopes, J. I., Cortez, L. M., Mertz, T. M., Malc, E. P., Mieczkowski, P. A., and Roberts, S. A. (2016) APOBEC3A and APOBEC3B Preferentially Deaminate the Lagging Strand Template during DNA Replication, Cell Rep. 14, 1273–1282. Voet. D, Voet. J. G.(2010) Biochemistry. John Wiley & Sons, 4th ed., pp 1173–1180, Chichester.

ACS Paragon Plus Environment

ACS Chemical Biology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

40x13mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 6 of 6