Environ. Sci. Technol. 2008, 42, 5055–5061
Occurrence of Two Genotypes of Tetracycline (TC) Resistance Gene tet(M) in the TC-Resistant Bacteria in Marine Sediments of Japan M. HABIBUR RAHMAN, LISA NONAKA, RYOSUKE TAGO, AND SATORU SUZUKI* Center for Marine Environmental Studies (CMES), Ehime University, Matsuyama 790-8577, Japan
Received November 30, 2007. Revised manuscript received March 11, 2008. Accepted March 26, 2008.
The tetracycline (TC) resistance gene tet(M) was monitored in bacteria isolated from Japanese coastal and off-shore marine sediments. The high rate of occurrence of TC resistant (TCr) bacteria (120 µg mL-1 TC) was observed at frequency ranges between 0.0-0.08% in Tokyo Bay, 1.67-1.82% in Sagami Bay and 0.0-4.35% in the open Pacific Ocean. The tet(M) gene was PCR amplified from the TCr isolates, showing 127 of 209 isolates (60.8%) as positive. The rate of occurrence of tet(M) was between 32.0-96.0%, 21.1 -28.0% and 0.0-83.3% in the isolates from Tokyo Bay, Sagami Bay and the open Pacific Ocean, respectively. The tet(M) positive isolates belonged to 4 orders of bacteria. Bacillales was the most dominant order (121 strains) among tet(M) possessing bacteria, followed by Actinomycetales (three strains), Flavobacteriales (one strain) and Pseudomonadales (one strain). This indicates that tet(M) is present in various bacterial species and suggests that marine sediments are a natural reservoir of the tet(M) gene. Nucleotide sequence of the tet(M) revealed that two genotypes of tet(M) were found in the bacteria. The two genotypes were placed in genetically distant branches of the phylogenetic tree, suggesting that the two tet(M)s have different origins.
Introduction Drug and chemical-resistant bacteria are released from human clinical sources to the natural environment, which can in-turn initiate and spread drug resistance genes to naturally occurring bacteria in the environment (1, 2). Tetracyclines (TCs) are broad-spectrum antibiotics that are used in human therapy, veterinary medicine, agriculture, and aquaculture. The increase of TC resistant bacteria is a serious issue in recent years, not only in human clinical but also in other fields (3, 4). Chronic, low-dose application of TC for the promotion of growth of farm animals, particularly cultured for food, causes an increase in the presence of TC resistant bacteria, not only in pathogenic bacteria but also in commensal environmental bacteria. Bacterial resistance to TC is mediated primarily by two mechanisms; one is the energy dependent efflux pump and the other occurs through the ribosomal protection protein (RPP) (5). Other minor examples of resistance mechanisms are also known such as enzymatic inactivation of TC (6). Among the TC resistance genes, tet(M), one of the RPP genes, * Corresponding author phone: +81-89-927-8552; fax: +81-89927-8552; e-mail:
[email protected]. 10.1021/es702986y CCC: $40.75
Published on Web 06/17/2008
2008 American Chemical Society
has been studied for its distribution in terrestrial environments (7, 8). Recent reports (9–11) showed that the tet(M) gene is distributed in coastal aquaculture areas and sediments in Mekong River, Vietnam. Various genotypes of the tet(M) gene are known to occur as human and animal pathogens (7, 12) in the Mekong River sediments (11), and coastal aquaculture sites in Japan (10). The tet(M) gene is known to associate with mobile genetic elements such as plasmids, transposons, conjugative transposons, and integrons (5, 13, 14). This enables tet(M) to move easily from species to species (15), and thus may result in its wide distribution among numerous bacteria in the environment (7). It is known that drug resistant bacteria occur even in environments without drug contamination (16), suggesting that nonpolluted environment also can contain hidden reservoirs of the TC resistance gene. It is presumed that open Pacific Ocean is not a drug-polluted environment, however, little is known on the occurrence of TC resistance in the marine environment. To examine the potential presence and distribution of TC resistant bacteria and the tet(M) gene in coastal and oceanic environments with little or no known exposure to drugs, we examined the occurrence of TC resistant bacteria and the tet(M) in marine sediments from coastal to off-shore areas of Japan. The tet(M) possessing bacteria were classified by 16S rRNA gene analyses. Sequence of the tet(M) was also analyzed, indicating two types of tet(M) in the isolates.
Materials and Methods Sampling Area. Sampling sites are shown in Figure 1. Sampling was performed between 25 June to 1 July, 2004 at two stations in Tokyo Bay (T1 and T2), one station in Sagami Bay (S1) and three stations in the open Pacific Ocean (S4, S3, and S2) in cruice of the R/V Tansei-Maru, Japan Marine Science and Technology Center (JAMSTEC), Japan. Tokyo Bay is located almost in the center of Japan, and has an area of 1000 km2 with inlet of four rivers. Sagami Bay is located in the southwest of Tokyo Bay. Water exchange rate is high, because Sagami Bay is well connected to the open Pacific Ocean and the Kuroshio current flows strongly offshore. Of the three open Pacific Ocean stations two were located near the northeastern part of Sagami Bay, with one station situated in the center of (S3) and one was out side (S2) of the Kuroshio Current. Depth and water temperature of the sampling area are shown in the Table 2. Sampling Procedure. Sediment core samples were collected using a Freger core sampler in Tokyo Bay, and with a Multiple corer in Sagami Bay and the open Pacific Ocean sites. Core samples from 0-3 cm of the surface floor and 15-18 cm below the sea floor (BSF) slices from the same core (Figure 1B), were used for analysis. Sliced samples were transferred into sterile plastic bags and stored at -20 °C on board and at -80 °C in the laboratory until use. Viable Count of Tetracycline Resistant (TCr) Bacteria. To enumerate the percentage of TCr bacteria, 1 g of wet sediment was thoroughly suspended in 9 mL of sterile phosphate buffered saline (PBS) by vortex and a 10-fold serial dilution was made. Plate counts were performed on marine broth 2216E (Difco, Detroit, MI) plus 1.5% bacto agar (BD and Co., Sparks, MD) containing 0, 60, 120, or 240 µg mL-1 of TC (Sigma, St. Louis, MO). The plates were incubated at 25 °C for 7 days. Duplicate counting was performed, and colony forming unit (CFU) per g sediment was calculated. DNA Extraction from Isolates. For detection of tet(M) in the TCr isolates, a total of 209 TCr isolates were randomly chosen from the plate containing 60 and 120 µg mL-1 of TC. VOL. 42, NO. 14, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
5055
FIGURE 1. A, map of sampling location in Tokyo Bay (T1, T2), Sagami Bay (S1), and open Pacific Ocean (S2, S3, and S4). B, sample sections taken from the surface layer (0-3 cm), and 15-18 cm below the sea floor (BSF).
TABLE 1. PCR Primers Used in This Study primer
target gene
sequence
amplicon size (bp)
reference
tet (M)-1 (forward) tet (M)-2 (reverse) f341 (forward) r534 (reverse) T7 (forward) SP6 (reverse)
tet (M)
5′-(GTTAAATAGTGTTCTTGGAG)-3′ 5′-(CTAAGATATGGCTCTAACAA)-3′ 5′-(CCTACGGGAGGCAGCAG)-3′ 5′-(ATTACCGCGGCTGCTGG)-3′ 5′-(TAATACGACTCACTATAGGG)-3 5′-(GATTTAGGTGACACTATAG)-3′
617
3, 10
160
17
3208
10, 32
16S rRNA 16S rRNA
TABLE 2. Viable count of TCr Bacteria in the Sediments and Detection Rates of tet (M) Gene in the TCr Isolates viable count (CFU/g wet weight) concentration of TC (µ g/mL) sample water water namea depth (m) temp (°C) T1S T1B T2S T2B S1S S1B S4S S4B S3S S3B S2S S2B
15
20.1
32
15.7
1510
2.3
2680
1.5
2279
1.9
4030
1.7
0
60
(1.3 ( 0.42) × (1.9 ( 0.14) × 105 (1.4 ( 0.42) × 105 (1.3 ( 0.28) × 105 (6.6 ( 0.35) × 104 (6.0 ( 0.63) × 104 (3.0 ( 0.14) × 104 (3.2 ( 0.42) × 104 (1.3 ( 0.14) × 104 (4.7 ( 0.42) × 103 (2.3 ( 0.28) × 103 0d 105
120
(2.1 ( 0.14) × (1.62%) (1.5 ( 0.14) × 103 (0.79) 3 (2.0 ( 0.14) × 10 (1.43) (2.3 ( 0.07) × 103 (1.77) (3.2 ( 0.70) × 103 (4.85) (5.5 ( 0.70) × 103 (9.17) (1.1 ( 0.28) × 103 (3.67) (4.7 ( 0.28) × 103 (14.7) (7.0 ( 0.14) × 102 (5.38) (3.0 ( 0.14) × 102 (6.38) (1.5 ( 0.70) × 102 (6.52) 0 103
b
(1.0 ( 0.28) × 102 (0.08%) (1.0 ( 0.42) × 102 (0.05) 0 (1.0 ( 0.72) × 102 (0.08) (1.2 ( 0.28) × 103 (1.82) (1.0 ( 0.42) × 103 (1.67) (1.0 ( 0.21) × 102 (0.33) (1.0 ( 0.42) × 102 (0.31) (4.5 ( 2.12) × 102 (3.46) 0 (1.0 ( 0.28) × 102 (4.35) 0
no. of tet (M) positive 240 isolates/TCr isolatesc 0 0 0 0 0 0 0 0 0 0 0 0
8/25 (32.0) 24/25 (96.0) 24/25 (96.0) 22/25 (88.0) 7/25 (28.0) 4/19 (21.1) 7/13 (53.8) 3/13 (23.1) 18/22 (81.8) 10/12 (83.3) 0/5 (0) 0/0 (0) 127/209 (60.8)e
a Location of T1, T2, S1, S4, S3, and S2 are shown in Figure 1A. S, 0-3 cm or 0-1 cm surface layer; B, 15-16 cm or 15-16 cm BSF layer. b Number in parentheses are percentages of TCr bacteria in total CFU. c Total number of isolates resistant to 60 and 120 µ g/ mL TC were considered as a TCr. d Below detection limit. e Total tet (M) positive isolates in total TCr isolates examined.
To detect tet(M) by PCR, genomic DNA was extracted from the 209 TCr isolates following the method of Kim et al. (9). TCr isolates were cultured in a marine broth 2216E liquid medium at 25 °C for 48 h. Cells were harvested by centrifugation at 3000g for 10 min and suspended in 100 µL of lysozyme solution containing 10 µg lysozyme (Sigma, St. 5056
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 14, 2008
Louis, MO) in 10 mM Tris-HCl (pH 8.0). This was incubated at room temperature for 15 min, then 100 µL of isolation solution containing 1 M NaCl, 0.5 M EDTA, 10 mg mL-1 RNaseA and 20% sodium dodecyl sulfate (SDS) was added to the mixture and mixed smoothly. The mixture was incubated at 65 °C for 10 min and then 500 µL of a solution
containing 1 M NaCl, 0.1 M EDTA and 0.5% SDS was added to the mixture and mixed. DNA was purified by extraction with phenol saturated with a TE buffer (10 mM Tris-HCl, pH 8.0 and 1 mM EDTA) then with a mixture of phenol: chloroform: iso-amyl alcohol (25:24:1, v/v/v) and finally with chloroform. The DNA was dissolved in TE buffer and stored at -20 °C. PCR Amplification of tet(M) Gene. Specific primers of tet(M) detection, tet(M)-1 (5′-GTTAAATAGTGTTCTTGGAG3′) and tet(M)-2 (5′-CTAAGATATGGCTCTAACAA-3′) (3, 10) were used, whose product length was expected to be 657 bp. PCR amplification was performed with a GeneAmp* 9700 PCR system (Applied Biosystems, Foster City, CA). Reaction mixture for PCR contained 1 × Ex Taq reaction buffer (TaKaRa, Otsu, Japan), 2 µL each of 0.2 mM dNTP, 25 pmol of each primer, 0.62 U of Ex Taq DNA polymerase (TaKaRa, Otsu, Japan), and 20-80 ng of template DNA in a final volume of 25 µL. PCR cycles consisted of denaturing at 94 °C for 1 min, annealing at 56 °C for 30 s, and elongation at 72 °C for 1 min. The reaction was performed for 30 cycles and the final extension was performed for 5 min. Aliquots (5 µL) of PCR products were analyzed by electrophoresis on a 1.5% (w/v) agarose gel. Gels were stained with ethidium bromide and visualized on an Epi-Light UV FA1100 system with a Luminous Imager version 2.0 (Aisin Cosmos R and D, Aichi, Japan). Classification of tet(M) Possessing Isolates by 16S rRNA Gene Analysis. To classify tet(M) positive isolates, PCR amplification of the V3 variable region of 16S rRNA gene was performed using a primer set of f341 (5′-CCTACGGGAGGCAGCAG-3′) and r534 (5′-ATTACCGCGGCTGCTGG-3′) (17). The product length was expected to be 194 bp. The reaction mixture for PCR contained 5 µL of 10 × PCR Gold buffer, 4 µL each of 0.2 mM dNTP, 4 µL each of 25 mM MgCl2, 50 pmol of each primer, 2.5 U of Gold Taq DNA polymerase (Applied Biosystem, Foster City, CA), and 25-90 ng of template DNA in a final volume of 50 µL. PCR cycles consisted of denaturing at 94 °C for 1 min, annealing at 56 °C for 1 min, and elongation at 72 °C for 3 min. The reaction was performed for 25 cycles and the final extension was 7 min. Five µL of PCR product was separated and visualized following the same method described above. Cloning and Sequencing of 16S rRNA and tet(M) Genes. The PCR products of the 16S rRNA gene were cloned into plasmid pGEM-T Easy vector (Promerga Corporation, Madison, WI), and Escherichia coli JM109 was used for transformation. To check the correct insertion of the expected size, colony-direct PCR was performed using T7 primer (5′TAATACGACTCACTATAGGG-3′) and SP6 primer (5′-GATTTAGGTGACACTATAG-3′). Plasmids were extracted as explained by Sambrook and Russell (18). Cloned plasmid DNA was employed for sequencing of both strands using a Big Dye terminator version 1.1 or 3.1 cycle reaction kit (Applied Biosystems, Foster City, CA) on a 3100 ABI Prism DNA sequencer (Applied Biosystems, Foster City, CA). The PCR products of the tet(M) gene were purified using a Montage PCR purification kit (Millipore, Bedford, MA), and sequenced as in the same procedure mentioned above. Online similarity searching was performed using the Basic Local Alignment Search Tool (BLAST) at the National Center for Biotechnology Information Web site (NCBI, http://www.ncbi.nlm.nih. gov/). Nucleotide sequences of tet(M) were aligned using the multiple sequence alignment program CLUSTAL W (19), and a neighbor-joining tree was constructed using the same program (20). The statistical significance of branching was evaluated by bootstrap analysis involving the construction of 1000 trees from resampled data (21). Nucleotide Sequence Accession Numbers. The sequences of 16S rRNA and tet(M) obtained in this study were deposited into DDBJ (DNA Data Bank of Japan) database under the
accession numbers of AB301104-AB301229 (16S rRNA gene) and AB369825-AB369861 (tet(M)).
Results Bacterial Viable Count. Table 2 shows the CFU numbers and occurrence rate of TCr bacteria. Total viable numbers in surface layers were found at a range of 1.3-1.4 × 105 CFU g-1 (Tokyo Bay), 6.6 × 104 CFU g-1 (Sagami Bay), and 2.3 × 103-3.0 × 10 (4) CFU g-1 (open Pacific Ocean). Results of the BSF layers showed 1.3-1.9 × 105 CFU g-1 (Tokyo Bay), 6.0 × 104 CFU g-1 (Sagami Bay), and 4.7 × 103-3.2 × 104 CFU g-1 (open Pacific Ocean). For the S2B sample, no colony’s was formed in duplicate experiments. The percentage of the TCr bacteria to 60 µ g mL-1 was calculated as 1.43-1.62% (Tokyo Bay), 4.85% (Sagami Bay) and 3.67-6.52% (open Pacific Ocean) in the surface layer, and 0.79-1.77% (Tokyo Bay), 9.17% (Sagami Bay) and 0.00-14.70% (open Pacific Ocean) in the BSF layer. The occurrence rates of TCr bacteria to 120 µ g mL-1 of TC were less than the cases of 60 µg mL-1 in all samples (Table 2). The TCr bacteria to 240 µg mL-1 of TC were not found in all samples. Detection of tet(M) Gene from TCr Isolates. We assessed the possession of the tet(M) gene in TCr bacteria. The tet(M) detection by PCR revealed that 32.0-96.0% (Tokyo Bay isolates), 21.1-28.0% (Sagami Bay isolates) and 0.0-83.3% (open Pacific Ocean isolates) of TCr bacteria possessed tet(M) (Table 2). TCr bacteria isolated from TC-plate with 60 µ g mL-1 showed 110/176 (62.5%) tet(M)-positive and those from TC-plate with 120 µ g mL-1 showed 17/33 (51.5%) tet(M)-positive, which were not significantly different (P < 0.05). Overall, 60.8% of TCr bacteria possessed tet(M). The tet(M) was detected in the isolates from both 0-3 cm surface and the 15-18 cm BSF layer taken from T1, T2, S1, S4, and S3. No tet(M) positive isolates in the five TCr strains were observed from station S2 sediments, where the water depth was 4030 m. Identification of tet(M) Possessing Bacteria. To classify tet(M) possessing bacteria, all 127 tet(M) positive isolates were employed for 16S rRNA gene analysis, and it was found that four classes of bacteria possessed the tet(M) gene (Table 3). Among them, Bacilli (121 strains) was the most dominant followed by Actinobacteridae (3 strains), Flavobacteria (1 strain), and Gamma-proteobacteria (1 strain) (Table 3). Among 121 strains of Bacilli, 10 different groups were found (Table 3). Phylogenetic Analysis of tet(M) gene. We sequenced PCR products of tet(M) from 37 isolates obtained from all stations, except station S3B. Results showed two types of tet(M) (Figure 2); these were same as marine type tet(M)-A and marine type tet(M)-B (10). The marine type tet(M)-A was detected in all isolates from the station S1 (Sagami Bay) and S4 (open Pacific Ocean) (Table 3). The marine type tet(M)-B was detected in all the isolates from stations T1, T2 (Tokyo Bay), and S3 (open Pacific Ocean) (Table 2). A neighbor-joining tree of tet(M) showed that the two types were located in the most distant branches (Figure 2). Other known tet(M)s were located between tet(M) marine types tet(M)-A and tet(M)-B. The marine type tet(M)-A was identical to tet(M) of Clostridium perfingens transposon (acc no. AF329848) and Neisserria meningitides (acc. no. X75073). The marine type tet(M)-B was more closely related to the tet(M) sequence of Streptococcus mitis (acc no. AJ580977).
Discussion Several studies have suggested that increasing use of antibiotics has promoted the dissemination of antibiotic resistant bacteria and resistance genes in the localized natural environment (1, 8, 22). However, detection of resistant bacteria has also been observed in environments seemingly VOL. 42, NO. 14, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
5057
TABLE 3. Distribution of Marine Type tet (M)-A and Marine Type tet (M)-B Among the TCr Isolates sampling point
T1S
phylum
class
firmicutes
bacilli
firmicutes
bacilli
ordera
bacillales bacillales actinobacteria actinobacteridae actinomycetales
T1B
bacillales bacillales bacillales
sequence type
no. of tet (M) positive isolates
1c 6 2d
6 1 1
AB301163-AB301168 1 AB301223 1 AB311224 0
B B ND
1 2 7
22 1 1
AB301141-AB301162 5 AB301225 1 AB301214 0
B B ND
accession numbers (16S rRNA)
no. of tet (M) genotype sequenced of tet (M)b isolates
T2S
firmicutes bacilli bacillales actinobacteria actinobacteridae actinomycetales
1 1
22 2
AB301188-AB301209 7 AB301219-AB301220 1
B B
T2B
firmicutes
1 5
19 1 1
AB301169-AB301187 4 AB301222 1 AB301221 1
B B B
1
AB301229
0
ND
bacilli
bacteriodes
bacillales bacillales flavobacteriales
flavobacteria gammaproteobacteria pseudomonadales proteobacteria S1S
firmicutes
bacilli
bacillales bacillales
1 8
6 1
AB301106-AB301111 2 AB301226 0
A ND
S1B
firmicutes
bacilli
bacillales bacillales bacillales
1 2 3
2 1 1
AB301104-AB301105 1 AB301210 1 AB301217 1
A A A
S4S
firmicutes
bacilli
bacillales
1
7
AB301134-AB301140 5
A
S4B
firmicutes
bacilli
bacillales bacillales
2 4
2 1
AB301211,AB301212 2 AB301218 1
A A
S3S
firmicutes
bacilli
1 2 9
unknown
unknown
bacillales bacillales bacillales unknown
14 2 1 1
AB301120-AB301133 1 AB301213, AB301215 1 AB301227 0 0
B B ND ND
firmicutes
bacilli
bacillales bacillales bacillales
1 2 10
8 1 1
AB301112-AB301119 0 AB301216 0 AB301228 0
ND ND ND
S3B
a Isolates were identified up to order on the basis of 16S rRNA gene sequences using the species types in the DDBJ database that are closest relatives in the culture isolates. b Accession numbers for tet (M) are; type-A (AB369825-AB369837) and type-B (AB369838-AB369861). c In Order Bacillales, 1-10 have different sequences. d Actinomycetales 1 and 2 have different sequences; ND, not done.
distant from drug contamination (9, 11, 16). This study examined the occurrence of TCr bacteria and tet(M) in marine sediments taken from two coastal regions of Tokyo Bay and Sagami Bay, and off-shore of the coast of Japan. Results showed the presence of TCr bacteria in coastal to off-shore sediment samples. A large number of TCr bacteria were found in sediment samples under aerobic culture condition. However, the occurrence rate of TCr bacteria varied between different stations, where the sediment characters should be different. The occurrence rate of TCr bacteria against 60 µg mL-1 was 0.79-14.7%, and against 120 µg mL-1 was 0.0-4.4%, which were significantly different (P < 0.05). Surprisingly, the prevalence of TCr bacteria in open Pacific Ocean sites was higher than in Tokyo Bay (P < 0.05). This tendency was found in TCr at 120 µg mL-1. Sizemore and Colwell (23) detected antibiotic resistant bacteria including TCr in seawater collected from the Atlantic Ocean and observed that the percentage of resistant bacteria were higher in samples collected from off-shore than near-shore sites. They also indicated that the occurrence of antibiotic resistant bacteria in the marine environment was related to the presence of sewage effluent. It is likely that marine environments are the major recipients of sewage or domestic effluents. For example, in Mobile Bay of New York, the distribution of antibiotic resistant bacteria was found to be related to fecal 5058
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 14, 2008
pollution occurring from urban areas (24). Several studies (25–27) observed antibiotic resistant bacteria in sewage outlet samples from sewage treatment plants, indicating a primary source for the occurrence of drug resistant bacteria to marine environments. Tokyo Bay is a major recipient of domestic sewage treated water coming from hospital effluents and domestic wastes via river water. Kobashi et al. (28) reported that TCr bacteria in feces of broiler chickens, farmyard manure and farmland in Japan were 3.83 × 106 to 3.66 × 109 CFU g-1 dry matter, respectively, which could add to the contamination of sewage or domestic effluents. Cheee-Sanford et al. (1) observed that fecal waste from animal farms could be a major source of resistant bacteria to various environments. Although sewage treatment in metropolitan areas of Japan are rigorous, drug resistance genes may not be decomposed completely and may pass through to the environment. Including localized runoff, Tokyo Bay receives water from four rivers passing through the Tokyo area. If wastewater treatment is ineffective, particularly during high rain events where the system is overloaded, various chemicals may be released into river and coastal waters. Multidrug resistance (MDR) is known to occur through selective pressure by chemicals other than antibiotics (29, 30). Such MDR is suggested to be produced and continuously spread in chemical contaminated areas.
FIGURE 2. Phylogenetic tree of tet(M). A neighbour-joining tree was constructed from 657-bp-length DNA fragments of the tet(M) gene detected in the TCr isolates obtained from the sediments of Tokyo Bay, Sagami Bay and open Pacific Ocean. EF-G was used as an out group for rooting the tree. The numbers shown in the branch are branch length of tet(M) clusters. Scale bar (0.5) ) fixed nucleotide substitution per sequence position. Most MDR occur through an efflux-based drug resistance mechanism (31). Detection of tet(M) in this study showed 21-96% of TCr bacteria possessed the tet(M) gene, suggesting that tet(M) is a significant contribution to the TCr mechanism in environmental bacteria. The possessing rate of tet(M) was almost the same between isolates from culture plates with high and low concentrations of TC, suggesting that the tet(M) possessing rate was not depend on TCr level. Our recent observation showed that some Gram-positive isolates possessing tet(M) were TC sensitive (32), indicating that TCr was occurred when the gene expressed. Over a broad spatial scale we observed tet(M) from 78 isolates out of 100 (78.0%) in Tokyo Bay (T1 and T2 stations), 11 isolates out of 44 (25.0%) in Sagami Bay (S1 station), and 38 isolates out of 65 (58.5%) in the open Pacific Ocean (S4, S3, and S2 stations), indicating that tet(M) is widely distributed in marine sediment microbes of Japan. The higher prevalence of tet(M) from Tokyo Bay is reasonable because Tokyo Bay receives continuous and substantial amounts of anthropogenic substances through rivers and nonpoint source pollutants. The higher potential of gene-related effluents in Tokyo Bay is also another reason for the higher incidence of tet(M). Aarestrup et al. (3) reported that the tet(M) has been detected in 95% of Enterococcus faecalis and Entercoccus faecium which are from human or animal origin, suggesting the relationship between drug use in humans/animals and the high occurrence of drug resis-
tance. The sampling sites in our study do not directly receive antibiotics, and if the area is contaminated by drugs, these are usually readily degraded (33) and diluted. Therefore, it is suggested that the tet(M) gene is naturally distributed even in nonpolluted marine environments. As previously reported, several antibiotic resistance determinants have been shown to originate from antibiotic producing microbes (5, 34). The acquisition of the resistance gene may actually increase the fitness of bacteria in the absence of selection pressures by antibiotics, thus allowing an increase, in antibiotic resistance in the marine environment. Kobayashi et al. (35) recently demonstrated that the origin of ribosomal protection protein (RPP) genes, including tet(M), should be established before division of super kingdoms of biota on the Earth. They indicated that evolution of RPPs started before separation of prokaryote and eukaryote. We propose two possibilities of the origin of the tet(M) gene in the marine environment; one is through the natural gene pool from the preantibiotic era, and another the spreading by selection, increase, and horizontal gene transfer. Two types of tet(M) alleles were found in marine isolates, with phylogenetic analysis showing marine type tet(M)-A and marine type tet(M)-B placed at the most distant branches. All known tet(M) genes were placed between these two marine types (Figure 2). Oggioni et al. (12) reported that allelic variation within tet(M) is due to homologous recombination between two distinct alleles found in Tn1545 and Staphylococcus aureus. The novel tet VOL. 42, NO. 14, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
5059
determinants could be a mosaic structure formed by recombination of tet(M) and the mosaic genes formed between two distinct classes of TCr determinants (36–38). Thus, until now sequence variation of tet(M) might have occurred between marine type tet(M)-A and marine type tet(M)-B. Recently, Agerso et al. (39) reported three genotypes of tet(M)-I, -II, and -III, in terrestrial bacteria on the basis of bootstrap value (100% confidence). In our study it was found that marine tet(M)-A corresponded to Agerso’s tet(M)-II, whereas marine tet(M)-B corresponded to tet(M)-III. We confirmed our tet(M)-A and tet(M)-B could be separated based on the criteria of Agerso’s phylogeny (39, 40). If compared to other genotyping (38, 41), our marine type-A and type-B correspond to tet(M)-2 and tet(M)-1 by Gevers et al. (38), respectively, and corresponds to type-I and type-V by Huys et al. (41). When one studies natural microflora, culture method, and storage of samples should give a bias for detecting microflora. However, most studies on drug-resistant bacteria until now have used isolated strains, and the comparison of isolated strains of drug resistant bacteria is still are useful approach to understand the prevalence of drug resistance genes among microbial ecosystem. We examined the classification of tet(M) possessing bacteria for among isolated strains. We found various bacterial Class possessing tet(M) in this study. Bacilli was the major host followed by Actinobacteridae, Flavobacteria and Gamma-proteobacteria. To our knowledge detection of tet(M) in the Order Flavobacteriales possessing tet(M) in the marine sediments is the first record. D’Hondt et al. (42) showed that most common Phylum in subseafloor sediments were Firmicutes, which includes Bacilli. Many studies (e.g., refs 5, 8, and 14) indicated that gene transfer is one of the potential ways for the spread of antibiotic resistance to numerous bacterial species in the environment. The tet(M) gene has mainly been detected from Gram positive cocci as shown in Figure 2 (3, 41). However, we found both Gram positive and Gram negative bacterial genera possessing tet(M) in the sediments, although Gram negative bacteria were less frequent. Among Order Bacillales, 10 genotypic variations were present suggesting that the occurrences of various Bacillales possessing tet(M) gene in the sediments. The tet(M) gene could be transferred within commensal and pathogenic bacteria, that may accelerate the spread of tet(M) in the marine ecosystem. Agerso et al. (14) performed a filter mating experiment for tet(M) transfer from indigenous soil Bacillus cereus to Enterococcus faecalis and E. faecium, which showed high transfer frequencies and indicated that tet(M) can be transferred among various bacterial species in different environments. Our data showed that tet(M) can be transferred from marine fish origin bacteria Lactococcus garviae to E. faecalis (32). Kong (43) found that Bacillus sp. is common in marine invertebrates, which are eaten by bigger higher trophic level animals. Thus the tet(M) gene might be circulated among marine animals originally conveyed by environmental bacteria. Cooke (44) reported that antibiotic resistance has been detected from marine shellfish in New Zealand and mentioned that raw or undercooked shellfish may serve as a vehicle for transmission of antibiotic resistance in humans. Considering our data and previous reports, it is suggested that marine sediments are reservoirs of drug resistance genes to the environments.
Acknowledgments This research was partly supported by the 21st Century COE program (MEXT) and Grant-in-Aids from JSPS (14208063). M.H.R is a postdoctoral fellow funded by 21st Century COE program and Global COE program. We thank Dr. Todd Miller and Professor Annamalai Subramanian for their critical review of this manuscript. 5060
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 42, NO. 14, 2008
Literature Cited (1) Chee-Sanford, J. C.; Aminov, R. I.; Krapac, I. J.; GarriguesJeanjean, N.; Mackie, R. Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities. Appl. Environ. Microbiol. 2001, 67, 494–502. (2) Schmidt, A. S.; Bruun, M. S.; Dalsgaard, I.; Larsen, J. L. Incidence, distribution, and spread of tetracycline resistance determinants and integron-associated antibiotic resistance genes among motile aeromonads from a fish farming environment. Appl. Environ. Microbiol. 2001, 67, 5675–5682. (3) Aarestrup, F. M.; Agerso, Y.; Gerner-Smidt, P.; Madsen, M.; Jensen, L. B. Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn. Microbiol. Infect. Dis. 2000, 37, 127–137. (4) Schmidt, A. S.; Bruun, M. S.; Dalsgaard, I.; Pedersen, K.; Larsen, J. L. Occurrence of atimicrobial resistance in fish-pathogenic and environmental bacteria associated with four Danish rainbow trout farms. Appl. Environ. Microbiol. 2000, 66, 4908–4915. (5) Chopra, I.; Roberts, M. C. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232– 260. (6) Roberts, M. C. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 2005, 245, 195–203. (7) Aminov, R. I.; Garrigues-Jeanjean, N.; Mackie, R. I. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline esistance genes encoding ribosomal protection proteins. Appl. Environ. Microbiol. 2001, 67, 22–32. (8) Miranda, C. D.; Kehrenberg, C.; Ulep, C.; Schwarz, S.; Roberts, M. C. Diversity of tetracycline resistance genes in bacteria from Chilean salmon farms. Appl. Environ. Microbiol. 2003, 47, 883– 888. (9) Kim, S. R.; Nonaka, L.; Suzuki, S. Occurrence of tetracycline resistance genes tet(M) and tet(S) in bacteria from marine aquaculture site. FEMS Microbiol. Lett. 2004, 237, 147–156. (10) Nonaka, L.; Ikeno, K.; Suzuki, S. Distribution of tetracycline resistance gene tet(M), in gram-positive and gram-negative bacteria isolated from sediment and seawater at a coastal aquaculture site in Japan. Microbes Environ. 2007, 22, 335–364. (11) Kobayashi, T.; Suehiro, F.; Tuyen, B. C.; Suzuki, S. Distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins in Mekong river sediments in Vietnam. FEMS Microbiol. Ecol. 2007, 59, 729–737. (12) Oggioni, M. R.; Dowson, C. G.; Smith, J. M.; Provvedi, R.; Pozzi, G. The tetracycline resistance gene tet(M) exhibits mosaic structure. Plasmid 1996, 35, 156–163. (13) Roberts, M. C. Plasmid-mediated tet(M) in Haemophilus ducreyi. Antimicrob. Agents Chemother. 1989, 33, 1611–1613. (14) Agerso, Y.; Jensen, L. B.; Givskov, M.; Roberts, C. The identificati on of a tetracycline resistance genetet(M), on a Tn916-like transposon, in the Bacillus cereus group. FEMS Microbiol. Lett. 2002, 214, 251–256. (15) Licht, T. R.; Christensen, B. B.; Krogfelt, K. A.; Molin, S. Plasmid transfer in the animal intestine and other dynamic bacterial populations: the role of community structure and environment. Microbiology 1999, 145, 2615–2622. (16) Gilliver, M. A.; Bennett, M.; Begon, M.; Hazel, S. M.; Hart, C. A. Antibiotic resistance found in wild rodents. Nature 1999, 401, 233–234. (17) Muyzer, G. ; De Wall, E. C.; Uitterlinden, A. G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. (18) Sambrook, J.; Russell, D. W., Eds. Molecular cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 2001. (19) Thompson, J. D.; Higgins, D. G.; Gibson, T. J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. (20) Saitou, N.; Nei, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. (21) Felsenstrein, J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 1985, 39, 783–791.
(22) Agerso, Y.; Sengelov, G.; Jensen, L. B. Development of a rapid method for direct ditection of tet(M) genes in soil from Danish farmland. Environ. Int. 2004, 30, 117–122. (23) Sizemore, R. K; Colwell, R. R. Plasmids carried by antibiotic resistant marine bacteria. Antimicrob. Agents Chemother. 1977, 12, 373–382. (24) Koditschek, L. K.; Guyre, P. Antimicrobial resistant coliforms in New York Bright. Mar. Pollut. Bull. 1974, 5, 71–74. (25) Andersen, S. A. Effects of waste water treatment on the species composition and antibiotic resistance of coliform bacteria. Curr. Microbiol. 1994, 26, 97–103. (26) Andersen, S. A.; Sandaa, R. A. Distribution of tetracycline resistance determinants among gram-negative bacteria isolated from polluted and unpolluted marine sediments. Appl. Environ. Microbiol. 1994, 60, 908–912. (27) Vilanova, X.; Manero, A.; Cerda-Cuellar, M.; Blanch, A. R. The composition and persistence of faecal coliforms and enterococcal populations in sewage treatment plants. J. Appl. Microbiol. 2004, 96, 279–288. (28) Kobashi, Y.; Hasebe, A.; Nishio, M. Antibiotic resistant bacteria from feces of livestock, farmyard manure and farmland in Japan case report. Microbes Environ. 2005, 20, 53–60. (29) Rasmussen, L. D.; Sorensen, S. J. The effect of long term exposure to mercury on the bacterial community in the marine sediment. Curr. Microbiol. 1998, 36, 291–297. (30) McArthur, J. V.; Tuckfield, R. C. Spatial patterns in antibiotic resistance among stream bacteria: effects of industrial pollution. Appl. Environ. Microbiol. 2000, 66, 3722–3726. (31) Zgurskaya, H. I.; Nikaido, H. Multidrug resistance mechanisms: drug efflux across two membrane. Mol. Microbiol. 2000, 37, 219–225. (32) Neela, F. A.; Nonaka, L.; Suzuki, S. Transfer of tetracycline resistance gene tet(M) from marine environmental bacteria to human enteric bacteria. Chemical Pollution and Environmental Changes, Tanabe, S.; Takeoka, H.; Isobe, T.; Nishibe, Y. Eds. Universal Academy Press, Inc.: Tokyo, 293–296, 2006. (33) Kolpin, D. W.; Furlong, E. T.; Meyer, M. T.; Thurman, E. M.; Zaugg, S. D.; Barbar, L. B.; Buxton, H. T. Pharmaceuticals, hormones, and other organic wastewater contaminants in U.S. streams 1999-2000: A national reconnaissance. Environ. Sci. Technol. 2002, 36, 1202–1211. (34) Pang, Y.; Brown, B. A.; Steingrube, V. A., Jr.; Wallace, R. J.; Roberts, M. C. Tetracycline resistance determinants in Mycobacterium
(35)
(36)
(37)
(38)
(39)
(40) (41)
(42)
(43) (44)
and Streptomyces species. Antimicrob. Agents Chemother. 1994, 38, 1408–1412. Kobayashi, T.; Nonaka, L.; Maruyama, F.; Suzuki, S. Molecular evidence for the ancient origin of the ribosomal protection protein that mediates tetracycline resistance in bacteria. J. Mol. Evol. 2007, 66, 228–235. Doherty, N.; Trzcinski, K.; Pickerill, P.; Zawadzki, P.; Dawson, C. G. Genetic diversity of the tet(M) gene in tetracycline resistant clonal lineages of Streptococcu pneumoniae. Antimicrob. Agents Chemother. 2000, 11, 2979–2984. Stanton, T.; Humphrey, S. B. Isolation of tetracycline resistant Megasphaera elsdenii strains with novel mosaic gene combinations of tet(O) and tet(W) from swine. Appl. Environ. Microbiol. 2003, 69, 3874–3882. Gevers, D.; Daniclsen, M.; Huys, G.; Swings, J. Molecular characterization of tet(M) genes in the Lactobacillus isolates from different types of fermented dry sausage. Appl. Environ. Microbiol. 2003, 69, 1270–1275. Agerso, Y.; Pederson, A. G.; Aarestrup, F. M. Identification of Tn5397-like and Tn916-like transposons and diversity of the tetracycline resistance gene tet(M) in enterococci from humans, pigs and poultry. J. Antimicrob. Chemother. 2006, 57, 832–839. Dopazo, J. Estimating errors and confidence intervals for branch lengths in phylogenetic trees by a bootstrap approach. J. Mol. Evol. 1994, 38, 300–304. Huys, G.; D’Haene, K.; Collard, J. M.; Swings, J. Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl. Environ. Microbiol. 2004, 70, 1555–1562. D’Hondt, S.; Jorgensen, B. B.; Miller, D. J.; Batzke, A.; Blake, R.; Cragg, B. A.; Cypionka, H.; Dickens, G. R.; Ferdelman, T.; Hinrichs, K. U.; Holm, N. G. ; Mitterer, R.; Spivack, A.; Wang, G. ; Bekins, B.; Engelen, B.; Ford, K.; Gettemy, G.; Rutherford, S. D.; Sass, H.; Skilbeck, C. G.; Aiello, I. W.; Guerin, G.; House, C. H.; Inagaki, F.; Meister, P.; Naehr, T.; Niitsuma, S.; John, P. R.; Schippers, A.; Smith, D. C.; Teske, A.; Wiegel, J.; Padilla, C. N.; Acosta, J. L. S. Distribution of microbial activities in deep subseafloor sediments. Science 2004, 306, 2216–2221. Kong, H. Bacillus species in the intestine of termites and other soil invertebrates. J. Appl. Microbiol. 2006, 101, 620–627. Cooke, M. D. Antibiotic resistance among coliform and fecal coliform bacteria isolated from sewage, seawater and marine shellfish. Antimicrob. Agents Chemother. 1976, 6, 879–884.
ES702986Y
VOL. 42, NO. 14, 2008 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
5061
