OligonucleotideâPolymer Conjugates - American Chemical Society

Bioconjugate Chem. 2000, 11, 795−804

795

Oligonucleotide-Polymer Conjugates: Effect of the Method of Synthesis on Their Structure and Performance in Diagnostic Assays Claire Minard-Basquin, Carole Chaix,* Christian Pichot, and Bernard Mandrand UMR

2142

CNRS/bioMe´rieux,

ENS

Lyon,

46

alle´e

d’Italie,

69364

Lyon

Cedex

7,

France.

Received January 31, 2000; Revised Manuscript Received June 25, 2000

Oligonucleotide-polymer conjugates have been described to improve the sensitivity of an enzymelinked oligosorbent assay diagnostic test. To understand the influence of their structure and conformation in solution on the efficiency of the test during the capture step, two different ways of synthesizing these conjugates were compared. The first consisted of coupling 5′ amino modified oligonucleotides to poly(maleic anhydride-alt-methylvinyl ether) and poly(maleic anhydride-altethylene). The second resulted from direct synthesis of oligonucleotides from poly(maleic anhydridealt-ethylene) previously grafted onto a controlled pore glass support. The different conjugates were analyzed by size-exclusion chromatography and viscometry. The former method for conjugate synthesis produced aggregates, which was not the case for the latter. These conjugates were then used in the capture phase of a hybridization assay using a HBV DNA target, on a bioMe´rieux VIDAS instrument. Different parameters were studied, such as the purity of the conjugate solution and the number of oligonucleotides per polymer chain. The amount of conjugate coated on the solid-phase receptacle surface at the time of the capture phase was evaluated by radioactive labeling. Finally, it was demonstrated that conjugates produced an amplification factor of 50 versus the capture oligonucleotide probe used as the reference. The detection limit reached 108 copies/mL.

INTRODUCTION

Hepatitis B virus (HBV) disease is a major worldwide health problem, affecting millions of people. The diagnosis of the infection traditionally depends on various serologic HBV markers. However, the quantitation of HBV DNA in serum by molecular hybridization represents the most informative method for determining viral replication and serum infectivity (1). In the past, different hybridization assays for HBV DNA measurement have been developed. Dot blot (2) and liquid hybridization (3) were first employed, but were found to lack sensitivity. Later on, the polymerase chain reaction (PCR) efficiently improved the limits of HBV DNA detection. However, this very sensitive method often lacked reproducibility and stringent conditions were also required to avoid contamination (4). In this context, new signal amplification strategies were investigated as an alternative to target enzymatic amplification. These methods enabled direct measurement of HBV DNA in serum, allowing its quantitation. First of all, it was envisioned to develop modified oligonucleotides used as probes carrying multiple nonradioactive labels, e.g., fluorophore (5) or biotin (6), with the purpose of increasing sensitivity. Furthermore, to reduce nonspecific binding, another hybridization assay was developed that used branched DNA (bDNA) (7-9). More recently, oligonucleotide dendrimers were described to amplify radioactive or fluorescent signals in hybridization tests (10). In this context, our laboratory focused early on the detection of viral nucleic acid material using the ELOSA technique (enzyme-linked oligosorbent assay) (Figure 1) (11). The principle of this test is (i) to isolate the DNA target using a capture oligonucleotide (ON) probe immobilized on a solid support and (ii) to detect and * To whom correspondence should be addressed.

Figure 1. ELOSA sandwich test.

quantify the DNA target using a detection probe labeled by an enzyme. With this strategy, oligonucleotidepolymer conjugates used as probes for both capture and detection of the nucleic acid target (12, 13) have been described to improve the sensitivity of the test on a bioMe´rieux VIDAS immunoanalysis instrument (Figure 2). In the capture step, oligonucleotide-polymer conjugates were used to increase the coating of the probe on the solid support. Likewise, in the detection step, oligonucleotide-polymer conjugates have been described to improve detection signal due to an increase in the enzyme concentration. These conjugates were previously obtained by the coupling of 5′ amino modified oligonucleotides onto polymer reactive functions. Several polymers have been investigated such as poly(N-vinylpyrrolidone-N-acryloxysuccinimide) (P[NVPNAS]) (14), maleic anhydride copolymers (15), N-(2,2-dimethoxyethyl)-N-methacrylamide (16) and 6-deoxy-6-methacryloylamido-D-glucopyranose (17). It has been demonstrated that conjugates obtained

10.1021/bc000010p CCC: $19.00 © 2000 American Chemical Society Published on Web 09/28/2000

796 Bioconjugate Chem., Vol. 11, No. 6, 2000

Minard-Basquin et al.

Figure 3. Linear structure of copolymer (Mnapp ) apparent number average molecular weight). EXPERIMENTAL SECTIONPROCEDURES

Figure 2. Sandwich hybridization assay with capture and detection amplification.

with the poly(maleic anhydride-alt-methylvinyl ether) (P[MAMVE]) copolymer increased the sensitivity of an ELOSA diagnostic test in the capture phase (18) and that the P[NVPNAS] conjugate copolymer used in the detection step also enhanced detection signal (18). However, the coupling method has shown some drawbacks. Indeed, the coupling reaction led to the formation of aggregates that entrapped ONs and hindered their accessibility. Several hypotheses were put forward to explain such aggregate formation: (i) cross-linking of several polymer chains (19) and/or (ii) coupling side reactions induced by exocyclic amine functions of the nucleic bases (18, 20). To avoid the aggregation process observed during the coupling reaction and to control biomolecule orientation onto the polymer chain, a new method of conjugate synthesis has been recently described (21). Direct synthesis of oligonucleotides has been performed on the poly(maleic anhydride-alt-ethylene)(P[MAE])andtheP[MAMVE] (Figure 3) previously grafted on a solid support (controlled pore glass). P[MAE] was preferred to P[MAMVE] because of its good stability under ammonia treatment used for nucleic base deprotection. To compare the two families of conjugates, both synthesis methods were carried out (Figure 4). Conjugates were analyzed by SEC and SEC-MALLS-viscometry with the aim of evaluating their structure in solution. They were then tested in the capture phase of the HBV DNA sandwich hybridization diagnostic assay. The correlation between their structure and their ability to amplify the DNA detection signal is discussed in this work. Different parameters were examined, such as the influence of the free ON part and the number of ONs per copolymer chain. Finally, conjugates were compared by running an ELOSA sandwich test with a range of concentrations of the HBV DNA target. This experiment allowed us to estimate the real influence of conjugates on the sensitivity limits of the test. Moreover, the amount of conjugate coated on the SPR surface during the capture phase was evaluated by radioactive labeling.

Materials.P[MAE]wasobtainedfromAldrich.P[MAMVE] was obtained from PolyScience Inc. Their number average molecular weight (Mn) of 27 000 and 67 000 g/mol, respectively, was determined by size-exclusion chromatography (SEC) in organic solvent (DMSO) using poly(ethylene oxide) standards. P[NVPNAS] (22) was obtained by free radical polymerization in N,N-dimethylformamide (DMF). The copolymer was characterized by UV spectroscopy and by 13C nuclear resonance spectroscopy to determine respectively its composition and the monomer sequence distribution. The apparent number average molecular weight (Mn,app) of 35 000 g/mol was determined by SEC coupled to a multiangle laser light scattering detector (conditions described below) with a dn/dc of 0.2 mL/g. Anhydrous dimethyl sulfoxide (DMSO) and DMF were purchased from Aldrich. Oligonucleotide syntheses were carried out on an Expedite System Instrument (Millipore). SEC analyses were performed using a Waters UltraHydrogel 500 column or a Waters UltraHydrogel 500 column and a Waters UltraHydrogel 2000 column on line, a Kontron HPLC 420 pump running in a 0.1 M phosphate buffer, pH 6.8, and a Kontron 430 UV detector. Detection was achieved by absorbance at 260 nm which corresponded to the λmax adsorption of the oligonucleotide. Viscometry analyses were performed using SEC coupled to a multiangle laser light scattering detector and coupled to an on line viscometer in a triple detector configuration (SEC-MALLS-viscometry). Two associated columns (Waters UltraHydrogel 500 and 2000) were connected to a Spectra-physics isochrome pump running in a 0.1M phosphate buffer/20 mM NaCl, pH 6.6. For the detection part, a seventeen angle DAWN DSP (WYATT Technology) operating at 690 nm, a viscometer H502 (Viscotek) and a Waters 510 differential refractometer were used on line. (R-32P)ddATP was obtained from Amersham and (γ32P)ATP from NEN. Terminal transferase was purchased from Boehringer Mannheim and T4 polynucleotide kinase from Ozyme. Radioactivity was counted with a Liquid Scintillation Analyzer 1900 TR (Packard). Conjugates Obtained by ON Coupling. Conjugates were obtained according to the protocol described by Ladavie`re et al. (15). Oligonucleotides (ONs) used in this part (ON1, Table 1), were synthesized by standard DNA cyanoethyl N,N-diisopropylamino phosphoramidite chemistry. ONs were modified at their 5′ position by an

Oligonucleotide−Polymer Conjugates

Bioconjugate Chem., Vol. 11, No. 6, 2000 797

Figure 4. Conjugate synthesis methods. Table 1. ON Sequences ON number ON1 ON1b ON2 ON3

sequence (5′-3′)

name

TCAATCTCGGGAATCTCAATGTTAG TCAATCTCGGGAATCTCAATGTTAGTTTTT AACGCTACTACTATTAGTAG CTACTAATAGTAGTAGCGTT

capture ON capture ON detection ON complementary of ON2

Table 2. Reaction Conditions for Conjugates Obtained by Coupling

conjugate

polymer used

amount of polymer introduceda (mg)

amount of ON introducedb (nmol)

coupling yield (%)

ONs/copolymer chainc

[1] [2] [3] [4] [5] [6] [7] [8] [9]

P[MAMVE] P[MAMVE] P[MAMVE] P[MAMVE] P[MAMVE] P[MAMVE] P[MAMVE] P[MAE] P[NVPNAS]

0.15 0.15 0.101 0.071 0.07 0.07 0.011 0.058 0.021

10.5 15 15 15 15 15 30 15 15

64 84 94 87 88 93 10 85 75

3 6 9 12 13 13 18 6 19

a Amount of polymer introduced in the mixture. b Amount of ON introduced in the mixture (ON1 for P[MAMVE] and ON3 for P[NVPNAS]). c see Characterization of Conjugates part.

aminohexyl arm for coupling to the copolymer. The appropriate amount of polymer (P[MAMVE]) or (P[MAE]) was first dissolved in 1 mL of DMSO at 37 °C. Dried ON1 was dissolved in 7 µL of 0.1M sodium borate/0.5 M sodium chloride buffer pH 9.3. Then, 10 µL of the polymer solution and 143 µL of DMSO were added. The reaction was carried out for 3 h at 37 °C. Before use, the solvents were removed under vacuum, and the conjugates resuspended in water. Coupling conditions were described in Table 2. For P[NVPNAS], the coupling protocol differed (23). Dried 5′ amino modified ON2 (15 nmol) was dissolved in

10 µL of 0.1M sodium borate buffer, pH 9.3. Then 21 µL of polymer solution at 1 mg/mL in DMF and 70 µL of DMF were added. The reaction was carried out for 2 h at 50 °C. After drying, conjugates were resuspended in water and purified by SEC. Conjugates Obtained by Direct ON Synthesis on CPG Support. Conjugates were synthesized according to the protocol described by Chaix et al. (21). The P[MAE] used in this strategy was first functionalized with different amounts of the nucleotide initiator of ON synthesis (Figure 4). In a second step, the resulting polymer was grafted onto a hydroxylated CPG support. The amount



Table 3. Conjugates Obtained by Direct Synthesis conjugate [10] [11] [12] [13] [14] [15] [16] [17] [18] [19]

conjugate purity (%)a 100 88 70-88 95 93 23 16 79 80 68

minimal ONs/ copolymer chainb 11 19 36 62 65 81 87 87 92 109

a Conjugate purity was determined by SEC compared to free ON population. b Estimated minimal number (see Characterization of Conjugates part).

of starter nucleotide bound to CPG via the polymer was established by trityl cation measurement (21). It was estimated to be from 1.49 to 4.25 µmol/gram of support, according to the quantities of nucleotide introduced in the mixture. ON1b (Table 1) was synthesized from this functionalized CPG by standard DNA cyanoethyl N,Ndiisopropylamino phosphoramidite chemistry on an Expedite Nucleic Acid Synthesis Instrument (Millipore). Conjugates were recovered in solution after ammonia treatment (NH4OH 30%, 16 h at 60 °C). Before use, conjugates were dried under vacuum, resuspended in water and purified by filtration on Centricon (cutoff 100 000 g/mol). The structure and purity of the conjugates used are summarized in Table 3. Detection of HBV DNA by ELOSA Test. Molecular Tools To Run Sandwich Test. The capture probe consisted of an ON-polymer conjugate carrying an oligonucleotide sequence complementary to HBV DNA from position 2430 to 2454 (ON1, Table 1). The conjugate was diluted at 150 nM in 4× phosphate buffer saline (PBS) (10× PBS is 1.37 M NaCl, 27 mM KCl, 43 mM Na2HPO4, and 14 mM KH2PO4). The target used was a PCR product of HBV DNA (double-stranded 2339 bp) cloned in pBR 322 and purified by agarose gel electrophoresis as previously described by Erout et al. (23). The PCR target was diluted in PEG buffer (0.1 M sodium phosphate pH 7, 0.5 M NaCl, 0.65% Tween, 0.14 mg/mL DNA salmon sperm, 2% PEG 4000). Before use, the target was denatured in 1.4 N NaOH (5 min at room temperature) and neutralized by 1.4 N acetic acid. The intermediate ONs (mix) contained 17 ONs complementary to 17 highly conserved regions of HBV sequence. These 17 ONs have an identical non-HBV sequence of 20 nucleotides in length in their 3′ position (ON3, Table 1). The mix was diluted at 26.85 nM, for each ON, in PEG buffer. The detection phase used a conjugate ON2-P[NVPNAS], complementary to the non-HBV common sequence of the mix (ON3), and complementary to a probe covalently linked to an enzyme (alkaline phosphatase) (ON3-AP). The conjugate ON2-P[NVPNAS] and the ON3-AP were diluted at 15 nM in PEG buffer. The enzyme detection substrate used was 4-methylumbelliferyl phosphate (4-MUP). The washing buffer used was PBS-Tween (1X PBS with 0.5% Tween). HBV DNA Test on VIDAS. Detection was performed using a bioMe´rieux VIDAS immunoanalysis instrument. The test was based on sandwich hybridization (24, 25) using specific probes complementary to highly conserved regions of the HBV DNA sequence. For the capture phase, the conjugate ON1(1b)-copolymer was coated on the inside of a disposable conical VIDAS solid-phase

receptacle (SPR) by passive adsorption (23). After 1 h of coating at 37 °C, the SPRs were washed with PBS-Tween to remove the uncoated conjugates. The hybridization test was performed for 3h at 37 °C during which the following steps occurred: capture of the target by ON1(1b)copolymer conjugate, washing, incubation with the mix, washing, incubation with ON2-P[NVPNAS] conjugate, washing, incubation with ON3-AP and AP substrate. The enzymatic reaction converted the substrate into a detectable fluorescent signal expressed in Relative Fluorescent Units (RFU) by the VIDAS detector. Quantitation of the ON Number Adsorbed onto the VIDAS Solid-Phase Receptacle (SPR). 32P Labeling. The conjugates obtained by the coupling reaction and the 5′ amino modified oligonucleotide (ON1, Table 1) were labeled in their 3′ position as follows: 30 pmol of conjugate (concentration of nucleic acid part measured at 260 nm) or ON were mixed with 4 µL of 5× reaction buffer (5× reaction buffer is comprised of 1 M potassium cacodylate, 1.25 mM Tris-HCl, bovine serum albumin, 1.25 mg/mL, pH 6.6 at 25 °C), 2 µL of 25 mM cobalt chloride solution, 1 µL of terminal transferase (25 units), and 3 µL of (R32P)ddATP (30 µCi). The final volume was adjusted to 20 µL with water. The reaction was left for 1 h at 37 °C. The enzyme was then inactivated at 70 °C for 10 min. The conjugate was purified by two filtrations with 500 µL of water on Centricon (cutoff, 100 000 g/mol). The 5′ amino modified ON1 was purified using a G25 column. The conjugates obtained by ON direct synthesis were labeled in their 5′ position. 30 pmol of the conjugate nucleic acid material were mixed with 2 µL of 10× T4 polynucleotide kinase buffer (1× final concentration is 70 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, pH 7.6 at 25 °C), 1 µL of T4 polynucleotide kinase (10 units), 3 µL (γ-32P)ATP (15µCi). The final volume was adjusted to 20 µL with water. The reaction was left for 1 h at 37 °C. The enzyme was inactivated at 70 °C for 10 min. The conjugates were purified by two filtrations with 500 µL of water on Centricon (cutoff, 100 000 g/mol). After purification, the specific activity of each product was measured. Coating. To a conjugate or ON solution at 150 nM (concentration of nucleic acid part measured at 260 nm) in PBS 4×, 300 000 counts/minute (cpm) of labeled conjugates or ON were introduced, respectively (total volume of the reaction ) 600 µL). A total of 300 µL of solution was introduced into the VIDAS conical SPRs sealed at the narrow extremity. SPRs were made of Polystyrene-polybutadiene plastic. The coating was realized by aspirating and dispensing the liquid in the SPR (35 times) for 50 min with a pipetman. SPRs were then washed twice with 300 µL of PBS-Tween, and counted in a liquid scintillation analyzer. Data are summarized in Figure 12. RESULTS AND DISCUSSION

Conjugates Obtained by the ON Coupling Reaction. Conjugates were produced by coupling ON1 on P[MAMVE] or P[MAE]. Different amounts of ON or polymer were introduced to obtain conjugates with various ON/polymer ratios and purity levels. The reaction was controlled by SEC analysis. Experimental conditions and the corresponding coupling yields are summarized in Table 2. Figure 5 shows an example of SEC analysis for the coupling of ON1 to P[MAMVE] copolymer, in which three different populations were separated by chromatography. The first population (peak 1) was eluted as an excluded



Figure 6. SEC analysis of ON1b-PMAE conjugate (conjugate [15]) using Waters UltraHydrogel 500 and 2000 columns on line in 0.1M phosphate buffer pH 6.8. (Flow ) 0.5 mL/min) Two main populations were observed: (2) conjugate, (3) parasite population.

Figure 5. SEC analysis of ON1-PMAMVE conjugate (conjugate [1]) using Waters UltraHydrogel 500 column in 0.1M phosphate buffer pH 6.8. (Flow ) 0.5 mL/min) Three populations appeared: (1) excluded peak, (2) lower molecular weight conjugate, (3) free oligonucleotide.

peak corresponding to high molecular weight conjugates. As demonstrated by Ladavie`re et al. (15), this population showed a very high molecular weight (more than 2 000 000 g/mol) when analyzed by SEC coupled to a multiangle laser light scattering detector (SEC-MALLS). The second population eluted (peak 2) corresponded to conjugate with lower molecular weight and the last population (16 min. to 22 min) to residual ONs (peak 3). From that analysis, the coupling yield (R) has been defined as the ratio of ON-copolymer versus the total amount of ON introduced in the reaction mixture:

R)

area(ON/polymer) ) area(ON/polymer) + area(freeON) area(peak1 + peak2) (1) area (peak1 + peak2) + area(peak3)

This calculation takes into account that at 260 nm, the molar extinction coefficient of the ON bound to conjugate is the same as for free ON (15). The ratio R enables determination of the average number N of ONs per copolymer chain according to:

N)

nON ×R ncopolymer

(2)

where nON and ncopolymer are the amount in moles of the ON and copolymer introduced in solution, respectively. Conjugates Obtained by ON Direct Synthesis. Before running ON synthesis on an Expedite DNA synthesis instrument, polymer functionalized CPG was performed as follows: First, the nucleotide 1 coupling yield on polymer was optimized at 90% in a 4 h reaction in DMSO (21). Second, hydroxyl-CPG was added to the solution and grafting of the nucleotide activated polymer was performed for 24 h (Figure 4). According to the amount of nucleotide initially introduced into the reaction mixture, different functionalized CPGs were obtained, from 1.49 to 4.25 µmol of 1 per gram

of support. ON1b were then synthesized from these functionalized supports with a sequence differing from ON1 by a supplement of five thymidine in the 3′ position. Indeed, in direct synthesis, ONs were developed from 3′ to 5′. So, this short oligothymidine spacer was necessary to distance the ON1 sequence from the polymer chain, thereby avoiding steric hindrance phenomena. Conjugates were recovered in solution by ammonia treatment, and analyzed by SEC. Results are summarized in Table 3. Figure 6 shows an example of SEC analysis of a ON1b-P[MAE] conjugate. As we can see, three kinds of peaks are also observed. The first population of conjugates formed a weak shoulder at the excluded volume (14 min in the chromatographic conditions). But the main population of conjugates was under peak 2 and corresponded to lower masses. Finally, a third population (peak 3) was identified as free ON by 32P labeling (26). This latter result was unexpected and was attributed to the following phenomena. (i) An adsorption of both nucleotide 1 and phosphoramidite monomers on the support initiated uncontrolled DNA synthesis. Nucleotide 1 was adsorbed on the CPG surface during the preparation of functionalized support and phosphoramidite monomers during the first cycle of ON synthesis (26). (ii) Some starter nucleotide (1) was coupled to the polymer by its nucleic base exocyclic amine function. Indeed, by capillary electrophoresis, it appeared that almost 10% of the nucleotide 1 was bound via this more labile link and was cleaved under ammonia treatment (unpublished results). (iii) It was also demonstrated that about 20% of the amide bond between polymer and starter was broken during ammonia treatment (27). Consequently, to approximate the real number N of ONs per copolymer chain, the initial equivalent number of nucleotides incorporated on P[MAE] (considering the coupling reaction yield) was reduced to 30% (step one, Figure 4). The estimations of the number of ONs per polymer chain are summarized in Table 3. Conjugate Structure. From SEC analyses in 0.1 M phosphate buffer, pH 6.8, it can be observed that conjugates obtained using the two different methods of synthesis exhibit different structures. Indeed, it was shown that conjugates obtained by the coupling reaction mainly produced aggregates of high molecular weight. For instance, the percentage of aggregates was close to 100% in the case of the P[NVPNAS] coupling reaction with ONs (results not shown). In contrast, no excluded peak was observed for conjugates obtained by direct synthesis, which tends to prove that no aggregated structure was formed.



Table 4. Conjugate Structure conjugate

a parameter

Rg,app (nm)

[2] (peak 1) [2] (peak 2) [5] (peak 1) [5] (peak 2) [15] (peak 1) [15] (peak 2)

0.36 0.81 0.34 0.73 0.38 0.73

78 38 81 38 106 47

a

% of conjugate populationa 55 45 73 27 27 73

UV detection.

Conjugates were also analyzed by SEC coupled to a multiangle laser light scattering detector and a viscometer on line. This analytical system enabled the estimation of the a parameter from the Mark-HouwinkSakurada relationship: [η] ) KMa (28) and measurement of the radius of gyration, for populations of conjugates separated by chromatography (two columns, UltraHydrogel 500 and 2000). These data provide information concerning the structure of conjugates in 0.1 M phosphate buffer/20 mM NaCl, pH 6.6. For those obtained by the ON coupling reaction strategy, two populations were previously identified (Figure 5). SEC-MALLS-viscometry analyses revealed some differences in their conformation, as reported in Table 4. Whereas the aggregates (peak 1) had an apparent radius of approximately 78 nm for conjugate [2] and 81 nm for conjugate [5] with a compact random coil form (a ≈ 0.3), the lower molecular weight conjugate population eluted from 10 to 16 min (peak 2) had a smaller apparent radius of gyration of approximately 38 nm with a more expanded random coil form (a ≈ 0.8). As the proportion of aggregates was predominant (>50%), the conjugates were considered to be essentially in a random coil form in solution with a relatively compact structure. On the other hand, SEC analyses of conjugates obtained by ON direct synthesis (Figure 6) and data obtained by SEC-MALLS-viscometry system (Table 4) showed the presence of a small amount of aggregates which eluted close to the excluded volume of 14 min in the experiment (peak 1, Figure 6). This population had an apparent radius of gyration of 106 nm with a compact random coil form (a ≈ 0.38). However, the main population of conjugates had an apparent radius of gyration of approximately 47 nm with a more expanded random coil form (a ≈ 0.8). This latter population corresponded to the nonaggregated ON-polymer conjugates, as confirmed by the apparent number average molecular weight (Mn,app) of 345 000 g/mol measured by SEC-MALLS in 0.1 M phosphate buffer, pH 6.8. In Figure 7, we have attempted to depict conjugate conformation in aqueous media. Regarding the form parameter and the apparent radius of gyration calculated from viscometry and light-scattering experiments, different structures can be proposed. For conjugates obtained by the coupling reaction, the conformation was essentially in a compact random coil form. With an apparent radius of gyration of 80 nm, it could be suggested that in this case, ON-polymer conjugate chains were essentially entangled, forming huge and compact aggregates (Figure 7). On the other hand, the strategy of direct ON synthesis produced conjugates in a more expanded form with an apparent radius of gyration around 40 nm. This time we supposed that the molecule could simply be folded up on itself maintaining a nonassociated expanded structure in solution. It was also demonstrated that the number of ONs per copolymer chain varied from one method to another. For conjugates obtained by the coupling reaction, this number rose from 3 to 18. It was not possible to graft a larger

amount of ONs per polymer chain because of the decrease in the coupling yield. Indeed, referring to the last experiment that led to 18 ONs/P[MAMVE] chain, the observed coupling yield was already down to 10%. In contrast, conjugates obtained by direct synthesis contained a larger number of ON, from 11 to 109. However, conjugates were not pure, with either method, since a percentage of free ONs was evidenced. So, to examine the influence of free ONs on the VIDAS signal, conjugates were purified at different stages. After characterization, all these conjugates have been used in hybridization assays in order to evaluate their performances in the capture phase. Use of the ON-Copolymer Conjugates in the Detection of HBV DNA. An efficient sandwich hybridization assay on the automated VIDAS immunoanalysis instrument has been previously developed by bioMe´rieux and our laboratory (29), using specific probes to detect highly conserved regions of HBV DNA. Optimized probe sequences used for the capture and detection phases of the test are described in Table 1. In the capture phase, ON1 and ON1b were used, according to the conjugate synthesis method. The ON-copolymer conjugates described previously were tested for their ability to improve the detection limits of HBV DNA target (Figure 2). ON1P[MAMVE], ON1-P[MAE], and ON1b-P[MAE] resulting from the two different methods of synthesis were evaluated at the capture phase. ON1-P[MAMVE] conjugate obtained by the coupling method was used as the reference for the diagnostic test described here, as it was considered to be the best candidate to improve capture phase efficiency (18). In both cases, the same ON3P[NVPNAS] conjugate was used in the detection step. Effect of Free ON on VIDAS Signal. As discussed above, conjugates were contaminated by free ONs. Consequently, it was necessary to study the effect of the conjugate purity on the VIDAS signal. To do so, the two conjugates ([7] and [16]) were progressively purified by successive filtrations, using Centricon with a 100 000 g/mol cutoff, and the purity checked by SEC analysis. For both conjugates, ELOSA experiments were run at all stages of the purification. The test was performed using 1010 copies/mL of HBV target (30). As we can see on Figure 8, the effect of the free ON part on the signal differed from one conjugate to another. For conjugates obtained by the coupling reaction, the effect was minor (Figure 8a). An increase of 1.1 of the RFU was observed with an increase from 10 to 87% of the conjugate purity. In contrast, for conjugates obtained by direct synthesis, the effect was not negligible (Figure 8b). the RFU signal increased with conjugate purity up to 60%, and then remained stable. To clearly understand the real action of the free ON part in mixtures of conjugates at the capture step, various ELOSA experiments were run, by addition of a percentage of 5′ aminolinked free ON increasing progressively (from 10 to 100%) to an initial solution of conjugates purified at about 93%. Conjugate [6] (Table 2) for conjugate obtained by the coupling reaction and conjugate [14] (Table 3) for the conjugate obtained by direct synthesis were used. RFU signals were recorded and summarized in Figure 9. It appeared that from 7 to 60% of ON in the capture solution, no effect on the RFU signal was observed for conjugate obtained by the coupling reaction, whereas for conjugate obtained by direct synthesis, the free ON population immediately reduced the signal intensity. Thus, in this latter case, a competition was evidenced between ONs and conjugates



Figure 7. Modeling of conjugate conformation in 0.1 M phosphate buffer/20 mM NaCl pH 6.6. Rg,app ) apparent radius of gyration and a ) form parameter calculated from the Mark-Houwink-Sakurada relationship: [η] ) KMa.

Figure 9. Effect of the percentage of free ON in the capture solution on the VIDAS signal. Mean values of duplicate measurements for a set of three experiments. [6]: P[MAMVE] (obtained by coupling, 93% conjugate purity, 13 ON/copolymer chain). [14]: P[MAE] (obtained by direct synthesis, 93% conjugate purity, 65 ON/copolymer chain).

Figure 8. Effect of the conjugate purity on the VIDAS signal. Mean values of duplicate measurements.

for adsorption onto the SPR surface during the capture step. Above 60% of ON in solution, both signals rapidly decreased. From these studies, it can be concluded that conjugates obtained by the coupling reaction could be used without any purification up to a level of 60% of ONs in the crude product. In contrast, conjugates obtained by direct synthesis required a purification step, because of competition between free ONs and conjugates for coating onto the SPR surface. Effect of the ON Number per Polymer Chain on the VIDAS Signal. As emphasized in the conjugate structure part, the number of ONs per copolymer chain changed from one conjugate to another, according to the method of synthesis. The effect of this difference on the VIDAS signal was therefore assessed. For all conjugates used

in the experiment, purity was raised to 60% (from 68 to 88%) to directly correlate the result with the influence of the ONs tethered to the copolymer chain. The hybridization test was performed using 1010 copies/mL of HBV target. As shown in Figure 10, conjugates exhibited different behaviors. For conjugates obtained by the coupling reaction (Figure 10a), the RFU signal was increased until 12 ONs/copolymer chain and then remained stable. The rise in the signal could be explained by both the increase in the number of ONs and the aggregated form. Indeed, the higher the number of ONs per polymer chain, the more numerous the aggregates observed on chromatography. For conjugate [1], the percentage of aggregated form was close to 55% whereas for conjugate [4], it was close to 80%. Consequently, it seemed that aggregates might play an important role in the capture phase of the ELOSA test. For conjugates obtained by direct synthesis (Figure 10b), the signal intensity remained stable for experiments run with conjugates [11], [12], and [18] (from 19 to 92 ONs/chain). Concerning the most functionalized conjugate (109 ONs bound to a polymer chain that bears around 210 maleic anhydride-ethylene units), the decrease was certainly due to steric hindrance phenomena. Finally, two conjugates obtained by the coupling reaction ([4] and [8]) and two conjugates obtained by direct synthesis ([10] and [18])



Figure 11. Comparison of conjugates in VIDAS. [4]: P[MAMVE] (obtained by coupling, 87% conjugate purity, 12 ON/copolymer chain). [18]: P[MAE] (obtained by direct synthesis, 80% conjugate purity, 92 ON/copolymer chain).

Figure 10. Effect of the number of ONs per polymer chain on the VIDAS signal. Mean values of duplicate measurements. The purity of all conjugates was raised to 60%.

were compared (Figure 10c). For conjugate [8] synthesized with P[MAE], no more than 6 ONs by chain can be obtained. Indeed, as in the case of P[MAMVE], it was not possible to couple a larger amount of ON because of the coupling yield decrease. To control the effect of the copolymer on the VIDAS signal, the two conjugates obtained by the coupling reaction ([4] and [8]) were compared. As can be seen, the RFU signal was identical with both P[MAE] conjugate [8] and P[MAMVE] conjugate [4]. In both cases, the maximum of ONs per polymer chain was reached, leading to the formation of aggregates. As previously discussed, these two parameters (high ON number and aggregate form) were essential for the improvement of test sensitivity. But no other effect was observed on the signal in relation to the length or the comonomer nature of the polymer used. Conjugate [10] was obtained by direct synthesis. In this case, the ON number on P[MAE] was low (11 ONs/chain) and the resulting VIDAS signal was compared to experiments run with conjugates [4] and [8]. It was observed that the signal for conjugate [10] was slightly inferior to those with conjugates [4] and [8]. But, when the number of ONs per chain was increased (conjugate [18]), the RFU signal was partly recovered. In conclusion, a higher number of ONs for conjugates obtained by direct synthesis could balanced the “aggregate” parameter that improves VIDAS sensitivity. Comparison of the Two Conjugates. Conjugates [4] and

[18] were compared in a hybridization test using a set of diluted HBV targets from 108 to 1011 copies/mL. The capture oligonucleotide (ON1, Table 1) was used as a control. In Figure 11, the signal/noise ratio versus the concentration of HBV target is represented. As can be seen, the ratio increased with the concentration of targets to reach a plateau at 5 × 1010 copies/mL. To determine the sensitivity limit of the conjugates, a cutoff of 2 for the signal/noise ratio, was applied. As shown in Figure 11b, sensitivity was the same for both conjugates, i.e., about 108 copies/mL, whereas the capture oligonucleotide used as reference had a sensitivity limit near to 5 × 109 copies/ mL. Hence, an amplification factor of 50 was reached by using the conjugates in the capture step. In conclusion, conjugates obtained by direct synthesis were as efficient as those obtained by the coupling reaction. In both cases, the detection limit was close to 108 copies/mL, using P[NVPNAS] conjugate in the detection step. Quantitation of the ON Number Adsorbed onto the VIDAS SPRs. To clearly understand what occurred during the coating step, an attempt was made to quantify the number of ONs adsorbed on the SPR surface. To do so, radioactive labeling of nucleic acid material was envisioned. The conjugate obtained by the coupling reaction ([5]) and ON1 used as the control were labeled at their 3′ position, whereas conjugates obtained by ON direct synthesis ([10] and [13]) were labeled at their 5′ position. After purification, these “hot” molecules were mixed with a solution of “cold” compounds, at 150 nM. In this case, the concentration of radiolabeled molecules added was negligible. After coating and washing, SPRs radioactivity was measured and the number of picomoles (N) adsorbed were determined according to the following equation:


N)

ω 1 × As R


(3)

where ω is the number of counts per minute (cpm) of the SPR, As, the specific activity (cpm/pmol) of compounds, and R, the ratio of the amount of labeled product versus the total amount introduced. Moreover, it was controlled that neither the SPR screen radioactive signal nor the presence or absence of liquid in the SPR disturb the measure. As can be seen in Figure 12, a major difference is observed between conjugates and ON1. Indeed, about 1 pmol was adsorbed on the SPR for ON1, whereas from 3 to 7 pmol of nucleic acid material were adsorbed using conjugates. This result was in agreement with VIDAS experiments, which have demonstrated that the use of conjugates versus ON enhanced the signal. Between the conjugates [5] and [13], no difference was clearly evidenced. The conjugate obtained by the coupling reaction gave an average value of 6.4 pmol and about 5.3 pmol of oligonucleotides were coated with the conjugate obtained by the second method. It was also remarked that the standard deviation of (3.1 pmol observed for conjugate [5] after six experiments seemed to emphasize a lower reproducibility of the coating in this case. Results were correlated with VIDAS experiments where the detection limit was the same with both conjugates, but the signal at 1010 copies/mL was slightly higher with conjugate [5] (results not shown). The number of ONs per chain for conjugate [5] was much lower than that of conjugate [13], signifying that the layer of conjugates coated onto the surface was more important in the first case. On the contrary, conjugate [13] obtained by ON direct synthesis was less efficiently adsorbed on the SPR surface, but the resulting amount of ONs coated was almost the same as for conjugate [5]. Between conjugates [5] and [10], a significant difference was observed. Indeed, an average of 2.8 pmol of ONs were coated with conjugate [10] obtained by direct synthesis. In this case, the number of ONs per chain was the same for both conjugates. So the difference in coating could be explained by their difference of structure. Unlike conjugate [10], conjugate [5] was essentially in an aggregated form. It appeared that this latter conformation favored conjugate coating on the SPR surface. Between conjugates [10] and [13], a real difference in coating was also observed. Indeed, for conjugate [13] twice as many picomoles of ONs were adsorbed. As their structure was the same, this difference could be explained by their number of ONs bound to the copolymer chain. These results were in agreement with VIDAS experiments where the signal was higher for conjugate [13] (VIDAS signal was identical for conjugates [13] and [18]). CONCLUSION

The goal of this study was to assess the effect of conjugate (ONs-polymer) structure on their capacity to increase the detection signal of an ELOSA type diagnostic test. For this purpose, two different methods of synthesis were studied. One method consisted of coupling 5′ amino modified ONs to P[MAMVE] or P[MAE] reactive polymer and the second methods relied on direct synthesis of ONs from the P[MAE] polymer previously grafted onto CPG support. It was evidenced by SEC and SEC-MALLS-viscometry that the first method led to a main population of aggregated conjugates, in a compact coil conformation in solution, whereas the second strategy produced nonag-

Figure 12. Evaluation of the number (N) of picomoles adsorbed on the SPR surface by 32P labeling. Number of picomoles adsorbedon the SPR for conjugates (a) [5], (b) [13], (c) [10], and (d) ON1, respectively. Mean values of six experiments.

gregated conjugates, in an expanded random coil form. Another difference was in the number of ONs linked to the polymer chain. The coupling method allowed a limited number of ONs per chain to be tethered (18 ONs/ P[MAMVE], 6 ONs/P[MAE]) in order to keep a correct coupling yield. In contrast, the latter strategy was more efficient, permitting a range from 11 to 109 ONs per P[MAE] chain. Both conjugates were evaluated for amplification of the detection signal of an HBV DNA hybridization sandwich test developed on a bioMe´rieux VIDAS instrument. Only the capture step of the test was investigated in this work and the improvement of detection sensitivity was demonstrated with both conjugates. Then, the effect of the free ON population present in the crude products of synthesis was evaluated. A low influence was observed for conjugates from the first method meaning that aggregated conjugates were adsorbed preferentially onto the surface of the VIDAS SPR, during the coating step. In contrast, conjugates obtained by ON direct synthesis appeared to be in competition with free ON population. Their nonaggregated structure was closer to that of a nucleic acid fragment and the higher the percentage of free ON population, the poorer the signal. Finally, it was demonstrated that the use of P[MAE] instead of P[MAMVE] for conjugates obtained by the coupling reaction did not affect the capture efficiency of the test. After selection of the best conjugates from the two different methods and optimization of their purity, the detection limits of the ELOSA test were improved by both conjugates by a factor 50 compared to the capture oligonucleotide probe used as the reference. At this stage of the work, the question was to know whether one type of conjugate was adsorbed more efficiently on the SPR surface, offering more ONs to capture DNA target, thereby improving test sensitivity, or, on the contrary, one of them simply offered after coating a majority of more accessible ONs for the capture step. An experiment of 32P labeling of the ONs linked to the polymer chain demonstrated that in fact the amount of oligonucleotides coated on the surface was almost the same for both conjugates. As the number of ONs per chain was much lower for the macromolecules obtained by the coupling reaction, this signified that the thickness of the conjugate layer on the SPR surface was much more important in this case. This can be explained by the aggregated compact structure which may favor the adsorption of a bulky layer of conjugates. Regarding capture phase effectiveness, a higher number of ONs tethered to the polymer chain can balanced the lack of aggregates for


conjugates obtained by ON direct synthesis. On the contrary, the second kind of conjugates obtained by direct synthesis may flatten onto the SPR surface because of its more expanded conformation, thereby limiting the amount of molecule coated and possibly, to some extent, the accessibility of few ONs. In conclusion, it should be interesting to investigate the synthesis of artificial aggregates which could be grafted onto the surface of a CPG support to develop direct ON synthesis. This kind of macrostructure, with a high number of tethered ONs, should be a suitable candidate as a probe for the capture phase of an ELOSA diagnostic test. ACKNOWLEDGMENT

We wish to thank J. M. Lucas and A. Domard for viscometry analyses and helpful discussions. We also thank M. H. Charles for her precious help in VIDAS experiments, G. Oriol and V. Cheney for 32P labeling, training and advice, and the Fondation Merieux for financial support. LITERATURE CITED (1) Bonino, F., Hoyer, B., Nelson, J., Engle, R., Verme, G., and Gerin, J. (1981) Hepatitis B virus DNA in the sera of HBsAg carriers: a marker of active hepatitis B virus replication in the liver. Hepatology 1 (5), 386-391. (2) Nair, P. M., Tong, M. J., Stevenson, D., Roskamp, D., and Boone, C. (1986) A pilot study on the effects of prednisone withdrawal on serum hepatitis B virus DNA and HBeAg in chronic active hepatitis B. Hepatology 6 (6), 1319-1324. (3) Hwang, S. J., Lee, S. D., Lu, R. H., Chan, C. Y., Lai, L., Co, R. L., and Tong, M. J. (1996) Comparison of three different hybridization assays in the quantitative measurement of serum hepatitis B virus DNA. J. Virol. Methods 62, 123129. (4) Kessler, H. H., Pierer, K., Santner, B. I., Vellimedu, S. K., Stelzl, E., Lackner, H., Moser, A., and Marth, E. (1998) Quantitative detection of hepatitis B virus DNA with a new PCR assay. Clin. Chem. Lab. Med. 36 (8), 601-604. (5) Haralambidis, J., Angus, K., Pownall, S., Duncan, L., Chai, M., and Tregear, G. W. (1990) The preparation of polyamideoligonucleotide probes containing multiple nonradioactive labels. Nucleic Acids Res. 18 (3), 501-505. (6) Pieles, U., Sproat, B. S., and Lamm, G. M. (1990) A protected biotin containing deoxycytidine building block for solid-phase synthesis of biotinylated oligonucleotides. Nucleic Acids Res. 18 (15), 4355-4360. (7) Urdea, M. S., Running, J. A., Horn, T., Clyne, J., Ku, L. and Warner, B. D. (1987) A novel method for the rapid detection of specific nucleotide sequences in crude biological samples without blotting or radioactivity; application to the analysis of hepatitis B virus in human serum. Genes 61, 253-264. (8) Horn, T., and Urdea, M. S. (1989) Forks and combs and DNA: the synthesis of branched oligodeoxyribonucleotides. Nucleic Acids Res. 17 (17), 6959-6967. (9) Urdea, M. S. (1994) Branched DNA signal amplification. Does bDNA represent post-PCR amplification technology? BioTechnology 12, 926-928. (10) Shchepinov, M. S., Udalova, I. A., Bridgman, A. J., and Southern, E. M. (1997) Oligonucleotide dendrimers: synthesis and use as polylabeled DNA probes. Nucleic Acids Res. 25 (22), 4447-4454. (11) Mallet, F., Hebrard, C., Brand, D., Chapuis, E., Cros, P., Allibert, P., Besnier, J. M., Barin, F., and Mandrand, B. (1993) Enzyme-linked oligosorbent assay for detection of polymerase chain reaction-amplified human immunodeficiency virus type 1. J. Clin. Microbiol. 31 (6), 1444-1449. (12) Mabilat, C., Cros, P., Erout, M. N., Thiercy, J. M., Pichot, C., and Mandrand, B. (June 1993) French Pat. 9,307,797. (13) Mandrand, B., Cros, P., Delair, T., Charles, M. H., Erout, M. N., and Pichot, C. (September 1993), French Pat. 9,311,006.

Minard-Basquin et al. (14) Erout, M. N., Elaissari, A., Pichot, C., Cros, P., and Kurfurst, R. (1996) Characterization of the grafting reaction between oligodeoxyribonucleotides and N-vinylpyrrolidone/ N-acryloxysuccinimide copolymers by size exclusion chromatography and free solution capillary electrophoresis. Int. J. Polym. Anal. Charact. 2, 253-269. (15) Ladavie`re, C., Ve´ron, L., Delair, T., Domard, A., Pichot, C., and Mandrand, B. (1997) Reactive polymers in diagnostics: syntheses and characterizations of nucleic acid probes and (maleic anhydride-co-methyl vinyl ether) polymers. J. Appl. Polym. Sci. 65, 2567-2577. (16) Ve´ron, L., De Bignicourt, M. C., Delair, T., Pichot, C., and Mandrand, B. (1996) Syntheses of poly(N-(2,2-dimethoxyethyl)-N-methyl acrylamide) for the immobilization of oligonucleotides. J. Appl. Polym. Sci. 60, 235-244. (17) Delair, T., Badey, B., Domard, A., Pichot, C., and Mandrand, B. (1997) Syntheses and characterization of conjugates of nucleic acid probes and 6-aminoglucose-based polymers. Polym. Adv. Technol. 8, 297-304. (18) Delair, T., Charles, M. H., Cros, P., Laayoun, A., Mandrand, B., and Pichot, C. (1998) Synthesis and characterization of nucleic acid-(co)polymer conjugates: application to diagnostics. Polym. Adv. Technol. 9, 349-361. (19) Ladavie`re, C. (1998) Doctorat thesis, Universite´ Claude Bernard, Lyon. (20) Ferraton, N., Delair, T., Laayoun, A., Cros, P., and Mandrand, B. (1997) Covalent immobilization of nucleic acid probes onto reactive synthetic polymers. J. Appl. Polym. Sci. 66, 233-242. (21) Chaix, C., Minard-Basquin, C., Delair, T., Pichot, C., and Mandrand, B. (1998) Oligonucleotide synthesis on maleic anhydride copolymers covalently bound to silica spherical support and characterization of the obtained conjugates. J. Appl. Polym. Sci. 70 (12), 2487-2497. (22) Erout, M. N., Elaissari, A., Pichot, C., and Llauro, M. F. (1996) Radical initiated copolymers of N-vinylpyrrolidone and n-acryloxysuccinimide: kinetic and microstructure studies. Polymer 37 (7), 1157-1165. (23) Erout, M. N., Troesch, A., Pichot, C., and Cros, P. (1996) Preparation of conjugates between oligonucleotides and Nvinylpyrrolidone/N-acryloxysuccinimide copolymers and applications in nucleic acid assays to improve sensitivity. Bioconjugate Chem. 7 (5), 568-575. (24) Allibert, P., Cros, P., and Mandrand, B. (1992) Automated detection of nucleic acid sequences of HPV 16, 18 and 6/11. Eur. J. Biomed. Technol. 14, 152-155. (25) Mabilat, C., Desvarenne, S., Panteix, G., Machabert, N., Bernillon, M. H., Guardiola, G., and Cros, P. (1994) Routine identification of Mycobacterium tuberculosis complex isolates by automated hybridization. J. Clin. Microbiol. 32 (11), 27022705. (26) Minard-Basquin, C., Chaix, C., Pichot, C., and Mandrand, B. (1999) Oligonucleotide synthesis on linear reactive polymer grafted onto solid support, medical diagnostics applications. Nucleosides Nucleotides 18 (6, 7), 1285-1287. (27) Unpublished results. (28) Houwink, R. (1940) J. Prakt. Chem. 157, 15. (29) Troesch, A., unpublished results. (30) It is important to notice that, in the range of target concentrations from 1010 to 1012 copies/mL, the relative fluorescent unit (RFU) signal drastically increases to saturate at about 10 000. Consequently, RFU signal fluctuated a lot in this very sensitive area, from 1 day to another. Therefore, results recorded from one series of experiments run at the same time could easily be compared, whereas those corresponding to tests run on different days could not be correlated. In this context, only data obtained from the same set of assays have been compared and discussed in this work.

BC000010P

OligonucleotideâPolymer Conjugates - American Chemical Society

Recommend Documents

OligonucleotideâPolymer Conjugates - American Chemical Society