Oxidative Quenching of Quinone Methide Adducts Reveals Transient

Subscriber access provided by FONDREN LIBRARY, RICE UNIVERSITY

Article

Oxidative Quenching of Quinone Methide Adducts Reveals Transient Products of Reversible Alkylation in Duplex DNA Michael P McCrane, Mark A Hutchinson, Omer Ad, and Steven E. Rokita Chem. Res. Toxicol., Just Accepted Manuscript • DOI: 10.1021/tx500152d • Publication Date (Web): 04 Jun 2014 Downloaded from http://pubs.acs.org on June 10, 2014

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Chemical Research in Toxicology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Chemical Research in Toxicology

“Oxidative Quenching of Quinone Methide Adducts Reveals Transient Products of Reversible Alkylation in Duplex DNA”

Michael P. McCrane,† Mark A. Hutchinson,‡ Omer Ad,† and Steven E. Rokita†‡*

†Department of Chemistry and Biochemistry, University of Maryland, College Park, MD, 20742 USA ‡

Department of Chemistry, Johns Hopkins University, Baltimore, MD, 21218, USA

Byline: Detection of metastable adducts of DNA after oxidative trapping

TOC

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 39

Abstract ortho-Quinone methides (ortho-QM) and para-quinone methides are generated by xenobiotic metabolism of numerous compounds including environmental toxins and therapeutic agents. These intermediates are highly electrophilic and have the potential to alkylate DNA. Assessing their genotoxicity can be difficult when all or some of their resulting adducts form reversibly. Stable adducts are most easily detected but are not necessarily the most prevalent products formed initially as DNA repair commences. Selective oxidation of ortho-QM-DNA adducts by bis[(trifluoroacetoxy)iodo]benzene (BTI) rapidly quenches their reversibility to prevent QM regeneration and allows for observation of the kinetic products. The resulting derivatives persist through standard enzymatic digestion, chromatography and mass spectral analysis. The structural standards required for this approach have been synthesized and confirmed by two-dimensional NMR spectroscopy. The adducts of dA N6, dG N1, dG N2 and guanine N7 are converted to the expected para-quinol derivatives within 5 min after addition of BTI under aqueous conditions (pH 7). Concurrently, the adduct of dA N1 forms a spiro derivative comparable to that characterized previously after oxidation of the corresponding dC N3 adduct. By application of this oxidative quenching strategy, the dC N3 and dA N1 adducts have been identified as the dominant products formed by both single- and double-stranded DNA under initial conditions. As expected, however, these labile adducts dissipate within 24 h if not quenched with BTI. Still, the products favored by kinetics are responsible for inducing the first response to ortho-QM exposure in cells and hence, they are also key to establishing the relationship between biological activity and molecular structure.

2


Page 3 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Study of DNA alkylation has primarily focused on the formation of irreversible adducts for which correlations between chemical structure and mutagenic effect may be established directly. Irreversible adducts lend themselves to simple manipulation since they can survive lengthy assays (>8 h) often required for enzymatic digestion and work-up prior to tandem liquid chromatography-mass spectrometry (LC/MS).1-3 In contrast, establishing a structural basis for the biological effects of transient, reversible adducts presents significant challenges. Reversible DNA adducts may have lifetimes that are too short for convenient detection, yet persist long enough to stimulate DNA repair. Only minutes are required before a biological response to DNA damage can be observed.4,5 In addition, excision of a reversible adduct may not even alleviate its threat since the reactive intermediate has the potential to regenerate after excision and reestablish new adducts in DNA repeatedly.6-9 Such reversibility consequently may extend the effective lifetime and potential harm of DNA damage in vivo. Thus, the concentration necessary for an agent to elicit a biological effect could be much lower when acting reversibly versus irreversibly. This enhanced activity can be beneficial for therapeutic agents as illustrated with duocarmycin10 and ecteinascidin 743 (Et 743),11,12 but deleterious for mutagens such as malondialdehyde6,13 and acrolein.14,15 Quinone methides (QMs) and related electrophilic intermediates also have the potential to act reversibly, but their characterization to date has primarily focused on the most accessible and stable adducts. These intermediate are typically formed in vivo and in vitro through activation of certain drugs, food additives, natural products and synthetic derivatives by mechanisms involving either oxidation, isomerization, photochemical excitation or elimination.16-18 Initial model studies provided details on many of the adducts formed between QMs and various amino acids, peptides and nucleosides.19-22 Some of the corresponding adducts have since been isolated from cell culture and

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 39

whole organisms. For example, tamoxifen-DNA adducts have been detected in breast cancer patients.23 Protein adducts generated from a QM intermediate of butylated hydroxytoluene have been observed in mouse epithelial cells,24 and both DNA and protein adducts were discovered in human intestinal and hepatic cells treated with the QM forming flavonoid quercetin.25 The existence of reversible adducts would not have been apparent from the existing assays used for in vivo analysis. Instead, model studies based on nucleosides and a simple ortho-QM demonstrated that reaction occurs most readily and reversibly with the strongest nitrogen nucleophiles of DNA (dA N1, dC N3 and dG N7).26,27 The inability to detect an intermediate or product does not necessarily reflect its lack of formation or lack of influence within a biological system. If reversible DNA adducts have the potential to form, then their evaluation is essential. Data on the transient adducts becomes particularly important to determine the molecular basis of toxicity.1,28 Detection of transient yet biologically relevant products could also influence the toxicology rating of a chemical and, alternatively, aid in design of more selective therapeutic agents targeted at DNA. Criteria for trapping or stabilizing labile adducts are quite stringent by necessity. The best protocols should act under ambient aqueous conditions in an efficient and rapid manner without decomposition or denaturation of the unmodified DNA. For example, the electron rich phenol derivative formed by QM alkylation of dC was susceptible to oxidative dearomatization by bis[(trifluoroacetoxy)iodo]benzene (BTI) that blocks regeneration and release of the intermediate QM (Scheme 1).29 Equivalent oxidative trapping has now been extended to the remaining ortho-QMnucleoside adducts that form reversibly and irreversibly with dA and dG. Investigations did not include dT since its lack of nucleophilicity does not yield an adduct with the simple ortho-QM.26,27 Synthesis and characterization of the complete profile of oxidized adducts also allowed identification of otherwise transient adducts in single- and double stranded DNA as described below.

4


Page 5 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Experimental Procedures Materials. Starting materials, reagents, and solvents were obtained commercially and used without further purification. Bis[(trifluoroacetoxy)iodo]benzene (BTI) was purchased from Acros and acetonitrile (HPLC grade) was purchased from Fisher Scientific. Water was purified to a resistivity of 18.2 MΩ-cm. The silyl-protected quinone methide precursor 1 was prepared as described previously.26,30 The complementary oligonucleotides OD1 (5′d[ACAGTACACCATCACCATCACCAT TAGGCGGCCGCTATCA]) and OD2 (5′[TGATAGCGGCCGCCTAATGGTGATGGTGATGGTGT ACTGT]) were purchased from Integrated DNA Technologies with standard desalting and not further purified prior to use. Oligonucleotide concentrations were calculated from their absorbance at 260 nm and their extinction coefficients provided by the manufacturer. Alkaline phosphatase from Escherichia coli and phosphodietserase I from Crotalus adamanteus venom were purchased from Sigma-Aldrich as lyophilized solids. These enzymes were stored at concentrations of 0.1 unit/µL and 0.004 unit/µL, respectively, in a solution of 50 mM TRIS·HCl pH 8, 50 µM ZnSO4, 10 mM MgCl2 and 50% glycerol. Instrumentation and analytical methods. Solid-phase extraction was carried out using Waters Sep-Pak® (plus) C18 short cartridges (360 mg sorbent, 55-105 µm particle size, 125 Å pore size). NMR spectra were determined with Bruker 400, 500 and 600 MHz spectrometers in deuterated solvents. The residual proton signals contained within these solvents were used as internal standards. Chemical shifts (δ) and coupling constants (J) are reported in parts per million (ppm) and Hertz (Hz), respectively. DNA melting temperatures were measured with a Cary 100 Bio UV/Vis spectrometer. Jasco HPLC instruments were used for preparative isolation with an Alltech C18 Econosphere semipreparative column (250 mm × 10 mm, C18, 10 µm, 100 Å) and for small-scale purification and adduct

5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 39

detection with a Varian C18 Microsorb column (250 mm × 4.6 mm, C18, 5 µm, 300 Å). Low resolution mass spectral data were collected with a JEOL AccuToF-CS in an ESI+ ionization mode, and high resolution mass spectral data were collected with a VG-70SE magnetic sector mass spectrometer using FAB ionization with 3-nitrobenzyl alcohol as the matrix for accurate mass analysis. LC/MS was performed on a Thermo-Finnigan Surveyor LC interfaced with a Thermo LCQ Fleet ion-trap mass spectrometer in ESI+ mode, and samples were introduced through an Agilent ZORBAX Eclipse Plus C18 RRHT column (50 mm × 2.1 mm, C18, 1.8 µm, 95 Å). dA N1 adduct (6) generated by the MeQM 2. Alkylation was initiated by addition of aqueous KF (1.25 M) to a mixture of the MeQM precursor 1 (52 mM) and dA (28 mM) in 50% aq. DMF (100 µL). The reaction was stirred at room temperature for 30 min and then passed through a 0.2 µm nylon66 syringe filter and separated by preparative reverse-phase HPLC using a 5 - 30% gradient of acetonitrile in 50 mM triethylammonium acetate (TEAA) pH 4 over 30 min (5 mL/min, tr = 13.6 min). 1

H NMR (400 MHz, DMSO-d6): δ 2.18 (s, 3H), 2.26 (m, 1H), 2.61 (m, 1H), 3.51 (m, 1H), 3.56 (m,

1H), 3.84 (m, 1H), 4.37 (m, 1H), 5.06 (s, 2H), 6.23 (t, J = 6.7 Hz, 1H), 6.66 (d, J = 7.9 Hz, 1H), 6.98 (dd, J= 2.2, 7.9, 1H), 7.30 (d, J = 2.2 Hz, 1H), 8.24 (s, 1H), 8.58 (s, 1H). 13C NMR (100 MHz, DMSOd6): δ 20.0, 39.6, 47.0, 61.6, 70.6, 83.8, 88.0, 117.9, 121.7, 122.8, 127.6, 130.5, 131.1, 138.8, 142.3, 147.8, 154.0, 154.4. ESI+-MS: m/z 372.17 (M+H)+. Calcd for C18H22N5O4+ (M+H)+: 372.17. λmax = 245, 272, and a 291 nm (Jasco diode array detector), 11% aq. acetonitrile in 45 mM TEAA pH 4. Oxidation of the dA N1 adduct (7). The dA adduct 6 was generated in situ as described above at room temperature for 30 min and then treated with BTI in acetonitrile (50 µL, 200 mM) for 5 min at room temperature. The mixture was diluted with water (100 µL) and washed with water-saturated diethyl ether (3 × 300 µL). The aqueous phase was passed through a 0.2 µm nylon-66 syringe filter and fractionated by preparative reverse-phase C18 HPLC using a 3 - 33% gradient of acetonitrile in 10 mM

6


Page 7 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ammonium formate pH 6.9 over 60 min (5 mL/min). The desired oxidized adduct 7 was collected as a diastereomeric mixture (tr = 18.0 and 18.9 min) and lyophilized to yield a white solid. A reliable yield could not be measured due to the small amounts of product isolated from individual cycles of sequential preparations and isolations that were required to obtain sufficient quantities for NMR spectroscopy. 1H NMR (400 MHz, DMSO-d6): δ 1.93 (d, J = 1.5 Hz, 3H), 2.27 (m, 1H), 2.58 (m, 1H), 3.55 (m, 2H), 3.84 (m, 1H), 4.07 (d, J = 11.2 Hz, 1H), 4.30 (d, J = 11.2 Hz, 1 H), 4.37 (m, 1H), 6.00 (d, J = 9.9 Hz, 1 H), 6.08 (d, J = 2.3 Hz, 1H), 6.23 (t, J = 6.7 Hz, 1H), 7.06 (dd, J = 2.3, 9.9 Hz, 1H), 8.11 (s, 1H), 8.18 (d, J = 1.8 Hz, 1H). 13C NMR (100.6 MHz, DMSO-d6): δ 20.5, 39.5, 53.7, 61.6, 70.6, 73.7, 83.7, 87.9, 119.7, 123.6, 128.8, 137.0, 137.6, 144.2, 144.3, 146.3, 151.4, 200.2. HRMS (FAB): m/z 370.1516 (M + H+). Calcd for C18H20N5O4+ (M + H+): 370.1515. λmax = 221, 273, 308 nm (Jasco diode array detector, 12% acetonitrile in 9 mM ammonium formate pH 6.9). dA N6 adduct (8) generated by the MeQM 2. Alkylation was initiated by addition of aqueous KF (80 µL, 2.50 M) to a mixture of the MeQM precursor 1 in acetonitrile (100 µL, 200 mM), dA in DMF (180 µL, 112 mM), and potassium phosphate (40 µL, 50 mM, pH 7). The reaction was maintained at 37 °C for 72 h and then cooled, passed through a 0.2 µm nylon-66 syringe filter, and fractionated by analytical reverse-phase C18 HPLC using a 3 - 30% gradient of acetonitrile in ammonium formate pH 6.9 over 89 min (1 mL/min, tr = 70). 1H NMR (400 MHz, DMSO-d6): δ 2.11 (s, 3H), 2.26 (m, 1H), 2.73 (m, 1H), 3.56 (m, 2H), 3.87 (m, 1H), 4.41 (m, 1H), 4.57 (s, 2H), 6.35 (t, J = 6.3 Hz 1H), 6.69 (dd, J = 1.9, 8.0 Hz, 1H), 6.85 (d, J = 8.0 Hz, 1H), 6.91 (s, 1H), 8.21 (s, 1H), 8.36 (s, 1H).

13

C NMR (125 MHz, DMSO-d6): δ 20.2, 38.5, 39.2, 61.8, 70.9, 83.2, 87.9, 115.3, 119.6, 125.3,

127.2, 128.1, 128.6, 139.6, 148.2, 152.1, 152.6, 154.3. ESI+-MS: m/z 372.17 (M + H)+. Calcd for C18H22N5O4+ (M + H)+: 372.17. λmax = 243, 271, 291 nm (Jasco diode array detector, 24% acetonitrile in 8 mM ammonium formate pH 6.9).

7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 39

Oxidation of the dA N6 adduct (9). The lyophilized dA adduct 8 was directly dissolved in 50% aq. acetonitrile (200 µL) and oxidized in aliquots of 50 µL as described above. The desired product 9 was collected at its tr of 33 min using HPLC conditions described for isolating the parent adduct 8. The resulting fractions were lyophilized to a yellow solid. A reliable yield was not estimated due to an uncertainty of the quantity of initial QM adduct. 1H NMR (500 MHz, DMSO-d6): δ 1.25 (s, 3H), 2.27 (m, 1H), 2.73 (m, 1H), 3.61 (m, 1H), 3.88 (m, 1H), 4.28 (bs, 0.5H), 4.33 (bs, 0.5H), 4.41 (m, 1H), 6.07 (d, J = 9.9 Hz, 1H), 6.35 (t, J = 7.4 Hz, 1H), 6.59 (s, 1H), 6.94 (dd, J = 2.9, 9.9 Hz, 1H), 8.19 (s, 1H), 8.38 (s, 1H).

13

C NMR (125 MHz, DMSO-d6): δ 27.3, 37.8, 39.5, 61.8, 66.3, 70.8, 83.9,

87.9, 119.6, 125.5, 131.9, 139.5, 147.9, 148.2, 152.2, 154.2, 154.2, 185.1. HRMS (FAB): m/z 388.1618 (M + H)+. Calcd for C18H22N5O5 (M + H)+: 388.1621. λmax = 243, 271 nm (Jasco diode array detector, 13% acetonitrile in 9 mM ammonium formate pH 6.9). dG N1, dG N2, dG N7, and guanine N7 adducts (10, 11, 12, and 13, respectively) generated by the MeQM 2. Alkylation was initiated by addition of aqueous KF (100 mM) to a mixture of the MeQM precursor 1 (50 mM) and dG (50 mM) in aq. DMF (35%). The reaction was incubated under various conditions indicated in the text and fractionated by semi-preparative reverse-phase C-18 HPLC using a gradient of 3 - 12% acetonitrile in 10 mM TEAA pH 5 over 10 min followed by a constant 12% acetonitrile in 10 mM TEAA pH 5 for an additional 30 min at 5 mL/min. dG N1 adduct (10): 1H NMR (400 MHz, DMSO-d6): δ 2.10 (s, 3H), 2.19 (m, 1H), 2.45 (m, 1H), 3.52 (m, 2H), 3.80 (m, 1H), 4.34 (m, 1H), 5.06 (s, 2H), 6.13 (q, J = 6.9 Hz, 1H), 6.76 (s, 1H), 6.78 (d, J = 8.2 Hz, 1H), 6.90 (d, J = 8.2 Hz, 1H), 7.96 (s, 1H). ESI+-MS: m/z 388.26 (M + H)+. Calcd for C18H22N5O5+ (M + H)+: 388.16. tr = 30 min. λmax = 255, 271 nm (Jasco diode array detector, 12% acetonitrile in 10 mM TEAA pH 5).

8


Page 9 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dG N2 adduct (11): 1H NMR (400 MHz, DMSO-d6): δ 2.17 (s, 3H), 2.22 (m, 1H), 2.61 (m, 1H), 3.53 (m, 2H), 3.82 (m, 1H), 4.35 (m, 1H), 4.36 (s, 2H), 6.18 (t, J = 6.9 Hz, 1H), 6.72 (d, J = 8.3 Hz, 1H), 6.89 (dd, J = 8.3, 1.6 Hz, 1H), 7.03 (d, J = 1.6 Hz, 1H), 7.90 (s, 1H). ESI+-MS: m/z 388.27 (M + H)+. Calcd for C18H22N5O5+ (M + H)+: 388.16. tr = 34 min. λmax = 247, 275 nm (Jasco diode array detector, 12% acetonitrile in 10 mM TEAA pH 5). dG N7 adduct (12): 1H NMR (600 MHz, DMSO-d6): δ 2.17 (s, 3H), 2.33 (m, 1H), 2.56 (m, 1H), 3.60 (m, 2H), 3.89 (m, 1H), 4.36 (m, 1H), 5.52 (d, J = 5.8 Hz, 2H), 5.86 (s, 2H), 6.21 (t, J = 6.2 Hz, 1H), 6.74 (d, J = 8.3 Hz, 1H), 6.98 (dd, J = 1.8, 8.3 Hz, 1H), 7.22 (d, J = 1.8 Hz, 1H), 9.18 (s, 1H). tr = 22.5 min. λmax = 259, 279 nm (Jasco diode array detector, 12% acetonitrile in 10 mM TEAA pH 5). Guanine N7 adduct (13): 1H NMR (400 MHz, DMSO-d6): δ 2.11 (s, 3H), 5.30 (s, 2H), 6.72 (d, J = 8.0 Hz, 1H), 6.80 (d, J = 1.8 Hz, 1H), 6.90 (dd, J = 1.6, 8.2 Hz, 1H), 7.84 (s, 1H). ESI+-MS: m/z 272.18 (M + H)+. Calcd for C13H14N5O2+ (M + H)+: 272.11. tr = 25 min. λmax = 283 nm (Jasco diode array detector, in 12% acetonitrile in 10 mM TEAA pH 5). Oxidation of the dG N7 and guanine N7 adducts (14, 15 respectively). Adducts 12 and 13 were dissolved in 50 % acetonitrile in 25 mM potassium phosphate (pH 7, 200 µL) and treated with BTI in acetonitrile (200 mM, 100 µL) for 5 min under ambient conditions. This mixture was then washed with water-saturated diethyl ether and filtered as described above. Products were fractionated by analytical reverse-phase C-18 HPLC using a linear gradient of 3 - 25% acetonitrile in 10 mM ammonium formate (pH 6.9) over 76 min (1 mL/min). The product 14 and 15 were collected together (tr = 9 - 13 min) and lyophilized to yield a white solid. This material was dissolved in 50% aq. DMSO and heated to 37 oC for 6 hours to degylcosylate the remaining 14 to form 15. The final product was purified by HPLC as described above to yield the guanine N7 product exclusively. 1H NMR (600 MHz, DMSO-d6): δ 1.25 (s, 3H), 4.99 (d, J = 15.7 Hz, 1H), 5.04 (d, J = 15.7 Hz, 1H), 6.06 (d, J = 10.1

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hz, 1H), 6.51 (s, 1H), 6.95 (dd, J = 2.8, 10.1 Hz, 1H), 7.84 (s, 1H).

13

Page 10 of 39

C NMR (150 MHz, DMSO-d6): δ

27.1, 43.8, 66.3, 107.9, 125.2, 131.3, 143.4, 150.6, 154.6, 184.1. HRMS (FAB): m/z 288.1097 (M + H)+. Calcd for C13H14N5O3+ (M + H)+: 288.1097. λmax = 239, 283 nm (Jasco diode array detector, 9% acetonitrile in 9 mM ammonium formate pH 6.9). Oxidation of the dG N1 and dG N2 adducts (16, 17 respectively). Oxidation of 10 and 11 was performed as described for 12 and 13. The products 16 and 17 were collected independently (tr = 25 min and 30 min) and lyophilized to yield a yellow solid (16) and a white solid (17). Oxidized adduct of dG N1 (16): 1H NMR (600 MHz, DMSO-d6): δ 1.25 (s, 3H), 2.22 (m, 1H), 2.54 (m, 1H), 3.53 (m, 2H), 3.81 (m, 1H), 4.34 (m, 1H), 4.62 (d, J = 15.7 Hz, 1H), 4.88 (d, J = 15.7 Hz, 1H), 6.09 (d, J = 10.0 Hz, 1H), 6.13 (m, 1H), 6.15 (t, J = 6.9 Hz, 1H), 6.95 (dd, J = 2.9, 10.0 Hz, 1H), 7.97 (s, 1H).

13

C NMR (150 MHz, DMSO-d6): δ 27.4, 39.4, 39.5, 61.7, 66.5, 70.8, 82.2, 87.6, 115.6, 125.5,

129.5, 135.7, 146.3, 149.4, 153.9, 154.3, 156.2, 184.8. HRMS (FAB): m/z 404.1564 (M + H)+. Calcd for C18H22N5O6+ (M + H)+: 404.1570. λmax = 243, 271 nm (Jasco diode array detector, 10% acetonitrile in 9 mM ammonium formate pH 6.9). Oxidized adduct of dG N2 (17): 1H NMR (600 MHz, DMSO-d6): δ 1.31 (s, 3H), 2.19 (m, 1H), 2.58 (m, 1H), 3.50 (m, 2H), 3.80 (m, 1H), 4.11 (bs 0.5H), 4.12 (bs, 0.5H), 4.32 (m, 1H), 6.06 (d, J = 10.0 Hz, 1H), 6.14 (t, J = 6.9 Hz, 1H), 6.80 (m, 1H), 6.96 (dd, J = 2.9, 10.0 Hz, 1H), 7.91 (d, J = 2.5 Hz, 1H).

13

C NMR (150 MHz, DMSO-d6): δ 27.3, 38.9, 39.3, 61.8, 66.4, 70.8, 82.8, 87.6, 117.0, 125.5,

131.7, 135.7, 149.4, 150.3, 152.4, 154.5, 156.6, 185.1. HRMS (FAB): m/z 404.1564 (M + H)+. Calcd for C18H22N5O6+ (M + H)+: 404.1570. λmax = 243, 271 nm (Jasco diode array detector, 12% acetonitrile in 9 mM ammonium formate pH 6.9). DNA alkylation and subsequent product analysis. Alkylation was initiated by addition of aqueous KF (500 mM) to a mixture of the QM precursor 1 (100 mM) and either OD1 or an OD1/OD2

10


Page 11 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


duplex (20 mM in nucleotides) in sodium phosphate (25 mM pH 7) and 30% acetonitrile (total volume, 200 µL). The duplex was formed prior to reaction by heating a stoichiometric mixture of the DNA strands in 50 mM sodium phosphate (pH 7) to 90 oC followed by slow cooling overnight. Reaction samples were stirred in sealed 0.3 mL glass vials and maintained at 37 °C for the indicated time. The resulting alkylated derivatives were then oxidized by direct addition of BTI in acetonitrile (40 µL, 1.00 M) while stirring at room temperature for 5 min. Final mixtures were then diluted with water (100 µL) and washed with water-saturated diethyl ether (3 x 300 µL). The DNA was precipitated by addition of cold ethanol (400 µL, 0 °C) and incubated at -20 °C for 30 min. The precipitate was isolated by centrifugation (5 min, 14,800 rpm) and washed with cold 80% aqueous ethanol (140 µL). The solid was dissolved in 11 mM MgCl2 in 50 mM TEAA pH 10 (200 µL) and hydrolyzed by alkaline phosphatase (10 units) and phosphodiesterase I (0.23 units) at 37 °C for 6 h and then neutralization by addition of 1% aqueous acetic acid (5 µL). This mixture was subject to solid-phase extraction using a Waters Sep-Pak® (plus) that was pre-conditioned by washing with acetonitrile (2 mL) and water (2 mL). Bound material was washed with H2O (1 mL) and eluted with acetonitrile (2 mL). Solvent was removed by rotary evaporation, and the solid residue was stored at -20 °C until needed. For product analysis, the dried samples were dissolved in 50% aqueous acetonitrile (100 µL), filtered through a 0.2 µm syringe filter and fractionated by analytical reverse-phase C18 chromatography using a gradient of 3% -13 % acetonitrile in 10 mM ammonium acetate pH 5.5 over 10 min followed by a constant 13% acetonitrile for 20 min and finally 13% to 33% acetonitrile for an additional 15 min (200 µL/min). Products were detected by an attached mass spectrometer in ESI+ mode.

Results and Discussion

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 39

The lability of reversible QM-DNA adducts complicates their detection and biological evaluation, but a method based on oxidative trapping was expected to provide access to these transient species as suggested by preliminary results with a dC adduct (Scheme 1).29 Under these conditions, adducts should be stabilized for detection by LC/MS and provide the first data on the kinetic profile of reversible QM adducts formed in DNA. As described below, this approach was successfully extended to the adducts of dA and dG using the same oxidative trapping agent, bis[(trifluoroacetoxy)iodo]benzene (BTI), applied previously to the dC N3 adduct.29 The appropriate dA and dG adducts and their derivatives formed by oxidation have now been synthesized and characterized for use as standards during LC/MS analysis of DNA. Prior study relied on in situ formation of the dC N3 adduct with a model MeQM 2 followed by immediate oxidation with a 4-fold excess of BTI. The resulting spirocyclization was not initially anticipated but could be easily rationalized by (a) intramolecular addition of the N4 amino group of dC to the ortho position of the reaction intermediate rather than the more usual (b) intermolecular addition of water to its para position (Scheme 1).29 Adducts of dG N1, dA N6 and dA N1 had the potential to undergo similar types of reaction with BTI. Formation and subsequent oxidation of adducts formed by dA. Alkylation of dA with MeQM 2 yielded adducts from reaction of the nucleophilic N1 and N6 positions as detected previously using a QM lacking the para-methyl substituent.31 The dA N1 adduct formed very quickly but was also highly reversible with a half-life of approximately 4 h under neutral conditions.26 In contrast, the analogous dA N6 adduct formed more slowly over 24 h and persisted without evident lability. These differences in reactivity and stability facilitated their individual preparation and characterization necessary for establishing standards of oxidative trapping. Yield of the MeQM-dA N1 adduct (6) was maximal under the same short reaction time (20 min) used to generate the dC adduct.29 MeQM 2 was generated under ambient conditions in the presence of dA by deprotection of its silyl-protected

12


Page 13 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


precursor 1 with aqueous KF (Scheme 2). Reaction was alternatively stopped after 30 min for isolation and characterization of the alkylated product or quenched after 30 min by direct addition of BTI (4 equivalents) to generate its oxidized derivative. Oxidation was complete within 5 min at room temperature as determined by reverse phase HPLC. Two closely eluting materials were generated and are consistent with a diasteromeric pair of products similar to those formed by oxidation and intramolecular cyclization of the dC N3 adduct.29 The MeQM-dA N6 adduct 8 was formed in situ under nearly the same conditions as 6 above (Scheme 2) except for an increase in temperature (37 °C) and an extended reaction time (72 h). Direct addition of BTI to this mixture generated numerous unidentified compounds as indicated by reversephase HPLC. This was likely the consequence of the many additional products of MeQM 2 that accumulate from its polymerization and competing addition of water and other weak nucleophiles over the long incubation. The MeQM-dA N6 adduct 8 was therefore isolated by reverse-phase HPLC, dried and then redissolved in 50% aqueous acetonitrile for oxidization with excess BTI for 5 min. Reversephase HPLC confirmed complete transformation of the dA N6 adduct to a single new product that was isolated and characterized as described below. Identification of the reversible MeQM-dA N1 adduct (6). The structure of 6 was confirmed by 1H NMR, 13C NMR, and MS with aid from data on the parent nucleoside32 and previous QM-dA adducts.21,31 The molecular ion of adduct 6 matched the expected m/z for a MeQM-dA adduct (m/z 372 (M + H)+), and the predicted structural connectivities were confirmed by NMR spectroscopy. The C2 and H2 atoms were most diagnostic of the MeQM-dA attachment (Table 1). The proton H2 of 6 (8.58 ppm) was shifted downfield from its dA parent (8.34 ppm) concurrent with an upfield shift for carbon C2 (147.8 ppm) relative to its corresponding signal in the same parent (153.0 ppm). These chemical shifts are consistent with those observed after alkylation of dA N1 by a QM lacking the methyl

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 39

substituent (H2 = 8.73 ppm, C2 = 148.5 ppm).31 Additionally, the benzylic protons (H10) and carbon (C10) of these related adducts differ by only 0.20 ppm for the proton signals and 1.2 ppm for the carbon signals. Chemical shifts of the corresponding atoms in the N6 adduct of QM, however, vary by 0.42 ppm (proton) and 4.4 ppm (carbon).21 The assignment of alkylation at the N1 position was further confirmed by the extensive analysis of its subsequent oxidized product. Characterization of the oxidized adduct formed by MeQM-dA N1 (7). Initial characterization by MS and 1H NMR supported formation of an oxidized, spiro derivative similar to that formed by MeQM-dC N3 (5) (Scheme 1). Low resolution ESI+-MS detected a m/z of 370 consistent with this assignment (calculated m/z 370 (M + H)+) and not the alternative para-quinol derivative (calculated m/z 388 (M + H)+). The chemical shifts and splitting pattern of the 1H NMR signals are also comparable to those of the dienone moiety formed by spiro-cyclization of the dC N3 adduct (Supporting Information, Figure S9).29 Additional NMR experiments including 13C, 1H-13C HSQC, and 1H-13C HMBC confirmed the structure of 7 (Figures S9 - S12). NMR signals (1H and 13C) corresponding to the purine and ribose moieties were assigned from literature values for dA32 and confirmed with 1H-13C HSQC and 1H-13C HMBC experiments. The two dimensional NMR experiments also established connectivities within the dienone 7 formed by oxidative cyclization of the former QM component (Figure 1). Previous characterization of the spiro product formed by BTI oxidation of MeQM-dC N3 (5) provided another guide for assigning signals from the common structural regions.29 For example, the assignment of C11 was confirmed through its connectivity to C10, and its chemical shift (73.7 ppm) is consistent with the sp3 hybridization of a spiro carbon in the dC analog (73.1 ppm).29 These chemical shifts differ greatly from the corresponding sp2 hybridized carbon found in a para-quinol model compound, 4-hydroxy-2,4dimethyl-2,5-cyclohexadien-1-one (18) (ca. 133 ppm).33 Additionally, 7 exhibits the same

14


Page 15 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


conformational restriction about the former benzylic carbon (C10) that was observed with the dC analog 5. This restriction leads to a diastereotopic relationship between the attached protons (H10A and H10B) due to their distance from the carbonyl oxygen of C12 that extends either in front or in back of C10. These configurations create a pair of doublets in the 1H NMR spectra. However, these signals are further complicated by formation of a diastereomeric pair of products evident from reverse-phase HPLC (Figure S2) and their overlapping pairs of doublets (H10A’ and H10B’) that appear as a pair of unusual quartets (Figure 1). Identification of the stable MeQM-dA N6 adduct (8). The product of alkylation formed after extended incubation exhibited the expected mass for a MeQM adduct of dA (m/z 372 (M + H)+). The site of MeQM linkage was determined by NMR analysis. In particular, the 1H and 13C signals for position 2 of the adenine ring and the benzylic position derived from MeQM were most consistent with an equivalent adduct formed by a QM lacking the methyl substituent and distinct from the data for its alternative N1 adduct (Scheme 2, Table 1). This assignment was further supported by further characterization of its subsequent derivative formed after oxidation by BTI. Characterization of the oxidized adduct formed by MeQM-dA N6 (9). Oxidation of the MeQM-dA N6 adduct with BTI generated its para-quinol derivative 9 by intermolecular addition of water rather than its spiro-derivative by intramolecular addition of dA N6 (Scheme 2). Especially diagnostic of the intermolecular process is the product mass (M + H)+ of m/z 388 that corresponds to the para-quinol 9 (calculated m/z 388 (M + H)+) and not the alternative spiro compound (calculated m/z 370 (M + H)+). Support for the para-quinol structure also derives from similarities between the splitting patterns of the 1H and 13C NMR spectra and those for a model, 4-hydroxy-2,4-dimethyl-2,5cyclohexadien-1-one (18).33 Additionally, chemical shifts of their corresponding 1H and 13C signals differ by less than 0.15 ppm and 2 ppm, respectively.

15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 39

The 1H-13C HSQC spectrum identified a proton-carbon pair that was assigned to position 10 from the expected chemical shifts and number of attached protons (Figure S15). Subsequent 1H-13C HMBC analysis was unable to establish a connectivity between the dA and para-quinol components (Figure S16). Rotation around the C10 position in the timeframe of the NMR experiment could lead to a loss of signal amplitude from incomplete coalescence of the proton signal. However, all other characteristics of the 1H and 13C signals at position 2 and 10 support the structural assignment (Table 1). Resonances of protons H2 and carbon C2 experienced an upfield shift for both the adduct 8 and its oxidized derivative 9. Additionally, chemical shifts of the protons and carbon at position 10 within 9 vary by only 0.42 ppm and 4.8 ppm respectively from those of the parent adduct 8. In both cases, the signals of 9 are slightly more upfield than those of 8 due to the loss of aromaticity after oxidation of the phenol moiety to its para-quinol derivative. The lack of intramolecular cyclization to form the oxidized spiro derivative for the dA N6 adduct was initially surprising since the adjacent nitrogen (N1) is strongly nucleophilic and could have yielded a close analog of 7 (Scheme 2). Only the former benzylic group within the resulting dihydroimidazole ring would have shifted from a connection with the N1 to the N6 position. Perhaps the predominant conformation of the initial N6 adduct formed with MeQM disfavors intramolecular cyclization during the oxidation.

Formation, oxidation and general characterization of the MeQM-dG adducts (10 - 13). Attempts to generate and oxidize the MeQM-dG adducts in a one-pot reaction under conditions used successfully for the dC N3 (5) and dA N1 (7) adducts yielded a series of complex mixtures. Consequently, the adducts formed by alkylation at dG N1 (10), N2 (11) and N7 (12, 13) were isolated prior to their oxidation as described for the dA N6 (8) adduct above (Scheme 3, Figure S17). Reaction temperature was increased from room temperature to 37 °C and reaction time was extended from 1 to 5

16


Page 17 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


h to shift between formation of the kinetic products (12, 13) and the thermodynamic products (10, 11). Prior to oxidation, each dG adduct was confirmed by its characteristic chromatographic retention time (tr), UV-vis spectrum, and 1H NMR data in comparison to the corresponding adduct formed by the unsubstituted QM (Table 2)34 The structural assignments were further supported by extensive analysis of their derivatives generated by oxidation with BTI. Adducts formed at the dG N7 position (12 and 13) were collected together for treatment with BTI (5 min, room temperature) since they ultimately yield the same derivative after deglycosylation (15, Scheme 3) (Figure S18). A mixture of the N1 and N2 adducts (10 and 11) were also isolated from the reaction mixture and oxidized together (Figures S21). Product separation after oxidization to adducts 16 and 17 was more expedient since their retention times differed more than those of their initial alkylation products 10 and 11 (Figures S23). Proton NMR of the isolated mixtures confirmed full oxidation of the alkylated products by BTI (Figures S19 and S22). High resolution mass spectral characterization of the adducts indicated formation of the corresponding para-quinol rather than spiro derivatives after oxidation. The guanine N7 adduct (15) as proxy for both the glycosylated and deglycosylated adduct generated a signal (M + H)+ of m/z 288.1097 equivalent to the calculated (M + H)+ of m/z 288.1097. Similarly, the N1 and N2 derivatives (16, 17) generated signals for (M + H)+ of m/z 404.1564 and 404.1570 differing by no more than 11 ppm from the calculated (M + H)+) m/z of 404.1525 for their para-quinol derivatives. NMR signals (1H and 13C) corresponding to the purine and ribose moieties were identified from the literature values for dG32 and the adducts formed by the parent ortho-QM lacking the methyl substituent.34 Assignment of the purine 13

C NMR signals for 15 was also supported by prior characterization of 7-methyl guanine.35 The 1H

and 13C chemical shifts of the para-quinol moieties in each product varied by no more than 0.47 ppm and 2.6 ppm, respectively, from those of the model compound 18 and the proton splitting pattern

17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 39

patterns were equivalent as well.33 Connectivities between the quinol and guanine were further identified by 1H-13C HSQC and 1H-13C HMBC data as detailed for each species below (Supporting Information). Characterization of the oxidized adduct formed by MeQM-guanine N7 (15). Spontaneous deglycosylation of 14 to form 15 within 6 h (50% aq. DMSO, 37 oC) ensured that all of the N7 adducts would be identified as 15 after enzymatic digestion of DNA as described below. The diastereotopic protons H10A and H10B exhibit geminal coupling (J = 15.7 Hz) to yield a pair of doublets (Figure 2). Sufficient rotation of the adduct with respect to the nucleobase prevented the additional multiplicity that is evident for the derivatives 7 and 16. The specific connectivity between the quinol and guanine components in 15 was confirmed by an 1H-13C HMBC experiment that detected correlations between H10 and carbons C5, C8, C11, C12, and C16 (Figure 2). These same correlations were previously observed for the unsubstituted ortho-QM adduct attached to the N7 of guanine.34 Additionally, the signal for C11 was identified by its connectivity to protons H10 and H13. Carbon C15 was likewise identified by its proximity to protons H13 and H17 (Figure S31). The chemical shifts of C11 (131.3 ppm) and C15 (66.3 ppm) were also consistent with their respective sp2 and sp3 hybridization and signals of the corresponding carbons in the model para-quinol 18.33 Characterization of the oxidized adduct formed by MeQM-dG N1 (16). The site of alkylation and oxidation for 16 was also established by NMR spectroscopy using 1H-13C HSQC and 1

H-13C HMBC experiments (Figures S34 - S35). Diagnostic correlations were observed between the

methylene protons (H10) and carbons C2, C6, C11, and C16 (Figure 3). Only an adduct attached to the N1 position of dG would satisfy these correlations. Diasterotopic protons (H10A and H10B as well as H10A’ and H10B’) generate pairs of doublets consistent with a characteristically large germinal coupling (J = 15.7 Hz). However, these pairs form apparent triplets due to the overlay of H10 protons

18


Page 19 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


from the two diastereomers and limited rotation after BTI oxidation. This multiplicity is reminiscent of those observed for the oxidized adducts of dC N329 and dA N1 above. Characterization of the oxidized adduct formed by MeQM-dG N2 (17). Again, 1H-13C HSQC and 1H-13C HMBC were essential for assigning the 1H and 13C signals and the structural connectivities of 17 (Figures S38 – S39). The key attachment between the quinol component and the N2 position of dG was confirmed by correlations between the H10 protons and carbons C2, C11, C12, and C16 (Figure 4). Geminal coupling of the diastereotopic protons at position 10 is not evident for this derivative perhaps due to the relatively unencumbered rotation around the C10-N2 bond. The unresolved doublet of these protons likely reflects the diastereomeric mixture formed after oxidation and evident from the HPLC analysis (Figure S23). Chromatographic separation and detection (LC/MS) of the MeQM adducts after oxidative trapping with BTI. Chromatographic separation of the oxidized MeQM adducts was optimized using a C-18 reverse-phase column with ammonium acetate (pH 5.5) and a gradient of acetonitrile. This allowed full resolution of each nucleoside derivative except for those formed by reaction at dA N1 (7) and dG N2 (17). Still, their unique presence could be detected by selective ion monitoring based on their respective masses of m/z 370 and 404 (Figure 5). Under these solvent conditions, unreacted nucleosides elute with the void volume and are followed sequentially by the oxidized adducts formed by guanine N7 (15), dG N1 (16), dA N1 (7), dG N2 (17), dC N3 (5) and dA N6 (9). The chromatographic conditions were also capable of separating most of the diastereomeric pairs generated by oxidation. Retention times of the analytical standards along with their signature m/z were used below to determine the reaction profile of single- and double-stranded DNA under kinetic rather than thermodynamic control for the first time. Distribution of kinetic products formed by reversible alkyation of DNA. Initial model

19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 39

studies designed for characterizing the intrinsic selectivity of DNA alkylation by simple QMs identified a number of adducts that persisted after extensive incubation (24 h) and subsequent analysis (another 24 h).21 However, a variety of adducts formed by a QM intermediate derived from 2,6-di-tert-butyl-4methylphenol appeared to decompose within hours.19 This suggested that transient adducts might have also formed in reaction of the model QM but then decomposed during the many hours of reaction and enzymatic digestion needed for detection. Complementary studies based on nucleosides avoided the extensive time needed for digestion and allowed for rapid analysis. This alternative system was first to reveal the dominance of adducts formed by the nucleophilic dA N1 and dC N3 under initial conditions of reaction.26,27 Such adducts dissipated during the period required for their detection in DNA. Consequently, the low to non-existent levels of certain adducts could have resulted from their lability during assay rather than their suppression from the steric constraints of the Watson-Crick duplex structure as suggested previously.21 Oxidative trapping of these adducts by BTI provides sufficient stabilization for their detection by standard enzymatic digestion and LC/MS analysis (Scheme 4) in order to determine if the labile adducts are formed during initial reaction with DNA. Oxidative trapping and detection of MeQM-DNA adducts formed in single-stranded DNA. The trapping assay was initially applied to alkylation of ssDNA to confirm detection of the transient adducts without influence of Watson-Crick base pairing. The model MeQM 2 was generated in situ as described above and incubated with an oligonucleotide OD1 (5′-d[CAGTACACCATCACCATC ACCATTAGGCGGCCGCTATCA]) under neutral conditions for one hour before treatment with BTI for 5 min. The DNA was then washed with ether, precipitated, and resuspended for digestion as described in the experimental section. After a final solid-phase extraction, the mixture was analyzed by LC/MS. Products were identified by retention time and m/z and compared to the analytical standards (Figure 6A). Only the two kinetic products 5 and 7 formed by reaction at dA N1 and dC N3

20


Page 21 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


respectively were observed after limited exposure to MeQM 2. As predicted, these transient adducts do indeed dominate the product profile under initial reaction times and had been obscured previously by their lability during standard analysis. When incubations with MeQM 2 were extended for 24 h before quenching with BTI, the kinetic products were not detected as consistent with their transient nature (Figure S41). Prolonged incubation of the adducts eventually allows for accumulation of the competing adduct formed by irreversible addition of water to the ortho-QM intermediate.26 The minor adducts (9, 16, 17) were likely formed in quantities insufficient for detection under these conditions as anticipated from their low yields determined previously with reaction of ortho-QM lacking the paramethyl substituent.21 The N7 of dG is a very strong nucleophilic within DNA and consequently a common target of many biologically relevant electrophiles.36 ,37 However, no product from alkylation at this site was evident after exposure of DNA to MeQM 2. This result is actually quite consistent with earlier experimental and theoretical studies on another simple ortho-QM. Adducts formed at the N7 position as indicated by their dG and deglycosylated derivatives were observed in yields of 6- to 10-fold less than those of the corresponding adducts formed by dC N3 and dA N1 after reaction between nucleosides and the QM under kinetic (< 10 h).26 DFT calculations also anticipated these results by suggesting that alkylation occurs more readily at the N3 of the model 1-MeC with a ∆G‡ of 14.2 kcal mol-1 and the N1 of 9-MeA with a ∆G‡ of 14.5 kcal mol-1 than at the N7 of 9-MeG with a ∆G‡ of 17.7 kcal mol-1.38,39 The N7 of dG, unlike its competing nucleophiles, is not significantly hindered sterically by formation of duplex DNA. Consequently, reaction at the N7 of dG still had the potential to act competitively in reaction of duplex DNA, but this was not observed as described below. Oxidative trapping and detection of MeQM-DNA adducts formed in double-stranded DNA. The trapping strategy for detecting kinetic products of QM reaction was extended to analysis of

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 39

dsDNA under conditions comparable to those described above for ssDNA. A complementary oligonucleotide OD2 (5′-d[TGATAGCGGCCGCCTAATGGTGATGGTGATGGTGTACTGT]) was combined with stoichiometric quantities of OD1, annealed under standard conditions and then incubated with MeQM 2. Reaction was quenched as before with BTI. The resulting DNA was isolated from the mixture, digested and analyzed by LC/MS (Figure 6B). Once again, the dA N1 (7) and dC N3 (5) adducts were the only products observed after initial exposure to MeQM 2 (1 h) and, as expected, these products did not persist after extended incubations (24 h) prior to trapping by BTI (Figure S41). No evidence for alkylation of dG N7 in dsDNA was observed even though Watson-Crick base pairing might have inhibited competing reactions at dC N3 and dA N1. Formation of the dC and dA adducts might have also been anticipated to be less competitive in OD1/OD2 relative to OD1 due to their lower fractional abundance within the duplex sequence (26% and 24% respectively) versus within the single strand sequence (38% and 30% respectively), yet these adducts remained dominate. This selectivity in dsDNA is contrary to the significant, but not exclusive, role of dG N7 previously described for alkylation and cross-linking of dsDNA using bifunctional QMs alternatively conjugated to acridine and an oligonucleotide.8,9,40,41 The unexpected similarity of product profiles generated from ssDNA and dsDNA initially cast suspicion on the presence of duplex DNA in the OD1/OD2 mixture. Even the ratios of diastereomers generated by BTI oxidation of the adducts appeared similar when formed in ssDNA (OD1) and dsDNA (OD1/OD2) despite the asymmetric surface established by the double helix. However, the presence of dsDNA was verified by its characteristic thermal denaturation. Even after diluting dsDNA to 80 µM of nucleotides in the reaction conditions of 500 mM KF, 25 mM potassium phosphate (pH 7) and 30% acetonitrile, the melting of OD1/OD2 still required a temperature of 66.5 °C, well above the reaction temperature (37 oC) (Figure S40). Additionally, the absorbance of each oligonucleotide was measured

22


Page 23 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


carefully to avoid an excess of any one strand. While selectivity for dC N3 and dA N1 may not have been anticipated for duplex DNA, no data to the contrary was previously available due to the lability of these products. In the current experiments, regeneration and release of MeQM 2 was blocked by oxidative trapping. Precedence for reaction at these sites in dsDNA has also been reported by others. Perhaps not surprisingly, dC-dC mismatches lacking Watson-Crick base pairing are cross-linked through their N3 positions with the N-mustard mechlorethamine.42 Alkylation at the N3 of dC was also detected after dsDNA was treated with 1-(2-chloroethyl)-1-nitrosourea.43 Similarly, alkylation at the N1 position of dA was observed after exposing dsDNA to an aniline half mustard,44 and dG N7-dA N1 crosslinks were even isolated from animals exposed to butadiene.45

Conclusion The necessity for quenching and trapping reversible adducts formed by QMs became apparent when initial reaction of nucleosides revealed a majority of labile products formed by alkylation of the highly nucleophilic N1 of dA and N3 of dC.26,31 These products were originally observed only if HPLC analysis could be performed without delay by using nucleosides as targets of reaction. The labile derivatives had remained unnoticed in studies with DNA due to the extended times required for hydrolysis prior to product detection. Consequently, investigations based on calf thymus DNA primarily reported the adducts favored by thermodynamics such as that formed at the N2 of dG rather than those formed at dA N1 and dC N3 that are favored by kinetics.21 Future application of the quenching strategy to cellular studies may also reveal the dominance of kinetic adducts formed by QMs. Stabilizing the QM-DNA adducts by oxidative trapping extended the time available for identifying the initial products of reaction. Application of this approach has now demonstrated that the

23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 39

same kinetic products formed by alkylation of nucleosides also dominate the initial reaction of duplex DNA. Without this information, the biological response to QMs could be mistakenly correlated to the products most easily detected rather than those most prevalent at the start of DNA repair. The ability to detect reversible DNA adducts will now ensure the most comprehensive description of potential products formed in biology and contribute a new level of accuracy when attempting to trace the source of a metabolite’s genotoxicity.

ASSOCIATED CONTENT Supporting Information HPLC separation and analysis of the dA and dG adducts, NMR characterization of these adducts, thermal melting of OD1/OD2 and LC/MS analysis of extended reaction between MeQM 2 and DNA. This material is available free of charge via the Internet at http://pubs.acs.org

AUTHOR INFORMATION Corresponding Author Steven E. Rokita, Department of Chemistry, Johns Hopkins University, 3400 N. Charles St., Baltimore, MD 21218 (USA). Tel.: 410-516-5793. Fax: 410-516-8420. E-mail: [email protected] Funding This research was funded in part by a grant (CHE-0517498) from the National Science Foundation. Notes The authors declare no competing financial interest.

24


Page 25 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ACKNOWLEDGMENTS We thank Drs. Gene Mazzola, Yiu-fai Lam and Cathy Moore for help with the NMR experiments and Dr. Phil Mortimer for help with LC/MS analysis.

ABBREVIATIONS BTI, bis[(trifluoroacetoxy)iodo]benzene; HPLC, high performance liquid chromatography; LC/MS, tandem liquid chromatography-mass spectrometry; MeQM, ortho-quinone methide containing a methyl group at the 4-position; ortho-QM, the parent ortho-quinone methide lacking a para-methyl substituent; QM-DNA, DNA adducts formed by alkylation with a quinone methide; rt, room temperature; TBDMS, tert-butyldimethylsilyl; TEAA, triethylammonium acetate.

Reference (1) (2) (3) (4)

(5)

(6)

(7)

(8) (9)

Farmer, P. (2004) DNA and protein adducts as markers of genotoxicity. Toxicol. Lett. 149, 3-9. Banoub, J. H. and Limbach, P. A., Eds. (2010) Mass Spectrometry of Nucleosides and Nucleic Acids, Vol., CRC Press, New York. Tretyakova, N., Villalta, P. W. and Kotapati, S. (2013) Mass spectrometry of structurally modified DNA. Chem. Rev. 113, 2395-2436. McNeill, D. R., Paramasivam, M., Baldwin, J., Huang, J., Vyjayanti, V. N., Seidman, M. M. and Wilson, D. M. (2013) NEIL1 responds and binds to psoralen-induced DNA interstrand crosslinks. J. Biol. Chem. 288, 12426-12436. Suhasini, A. N., Sommers, J. A., Muniandy, P. A., Coulombe, Y., Cantor, S. B., Masson, J.-Y., Seidman, M. M. and Brosh, R. M. (2013) Fanconi anemia group J helicase and MRE11 nuclease interact to facilitate the DNA damage response. Mol. Cell. Biol. 33, 2212–2227. Dedon, P. C., Plastaras, J. P., Rouzer, C. A. and Marnett, L. J. (1998) Indirect mutagenesis by oxidative DNA damage: formation of the pyrimidopurinone adduct of deoxyguanosine by base propenal. Proc. Natl. Acad. Sci. USA 95, 11113-11116. Plastaras, J. P., Riggins, J. N., Otteneder, M. and Marnett, L. J. (2000) Reactivity and mutagenicity of endogenous DNA oxopropenylating agents: base propenals, malondialdehyde, and Nε-oxopropenyllysine. Chem. Res. Toxicol. 13, 1235-1242. Wang, H., Wahi, M. S. and Rokita, S. E. (2008) Immortalizing a transient electrophile for DNA cross-linking. Angew. Chem. Int. Ed. 47, 1291-1293. Wang, H. and Rokita, S. E. (2010) Dynamic cross-linking is retained in duplex DNA after multiple exchange of strands. Angew. Chem. Int. Ed. 49, 5957-5960.

25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(10) (11)

(12)

(13)

(14)

(15)

(16)

(17) (18) (19)

(20)

(21) (22)

(23)

(24)

(25)

Page 26 of 39

Asai, A., Nagamura, S., Saito, H., Takahashi, I. and Nakano, H. (1994) The reversible DNAalkylating activity of duocarmycin and its analogue. Nucleic Acids Res. 22, 88-93. Pommier, Y., Kohlhagen, G., Bailly, C., Waring, M., Mazumder, A. and Kohn, K. W. (1996) DNA sequence- and structure-selective alkylation of guanine N2 in the DNA minor groove by ecteinascidin 743, a potent antitumor compound from the Caribbean tunicate Ecteinascidia turbinata. Biochemistry 35, 13303-13309. Zewail-Foote, M. and Hurley, L. H. (2001) Differential rates of reversibility of ecteinascidin 743-DNA covalent adducts from different sequences lead to migration to favored bonding sites. J. Am. Chem. Soc. 123, 6485-6495. Basu, A. K., O'Hara, S. M., Valladier, P., Stone, K., Mols, O. and Marnett, L. J. (1988) Identification of adducts formed by reaction of guanine nucleosides with malondialdehyde and structurally related aldehydes. Chem. Res. Toxicol. 1, 53-59. Kozekov, I. D., Nechev, L. V., Sanchez, A., Harris, C. M., Lloyd, R. S. and Harris, T. M. (2001) Interchain cross-linking of DNA mediated by the principal adduct of acrolein. Chem. Res. Toxicol. 14, 1482-1485. Kozekov, I. D., Turesky, R. J., Alas, G. R., Harris, C. M., Harris, T. M. and Rizzo, C. J. (2010) Formation of deoxyguanosine cross-links from calf thymus DNA treated with acrolein and 4hydroxy-2-nonenal. Chem. Res. Toxicol. 23, 1701-1713. Bolton, J. L., Thompson. J. A. (2009) Formation and reaction of xenobiotic quinone methides in biology, In Reactive Intermediates in Chemistry and Biology: Quinone Methides (Rokita, S. E., Ed.) pp 329-356, Wiley, Hoboken, NJ. Bolton, J. L. (2014) Quinone methide bioactivation pathway: contribution to toxicity and/or cytoprotection? Curr. Org. Chem. 18, 61-69. Cao, S. and Peng, X. (2014) Exploiting endogenous cellular process to generate quinone methides in vivo. Curr. Org. Chem. 18, 70-85. Lewis, M. A., Yoerg, D. G., Bolton, J. L. and Thompson, J. A. (1996) Alkylation of 2'deoxynucleosides and DNA by quinone methides derived from 2,6-di-tert-butyl-4methylphenol. Chem. Res. Toxicol. 9, 1368-1374. Bolton, J. L., Turnipseed, S. B. and Thompson, J. A. (1997) Influence of quinone methide reactivity on the alkylation of thiol and amino groups in proteins: studies utilizing amino acid and peptide models. Chem.-Biol. Interact. 107, 185-200. Pande, P., Shearer, J., Yang, J., Greenberg, W. A. and Rokita, S. E. (1999) Alkylation of nucleic acids by a model quinone methide. J. Am. Chem. Soc. 121, 6773-6779. Modica, E., Zanaletti, R., Freccero, M. and Mella, M. (2001) Alkylation of amino acids and glutathione in water by ortho-quinone methides. reactivity and selectivity. J. Org. Chem. 66, 41-52. Umemoto, A., Monden, Y., Lin, C.-X., Momen, M. A., Ueyama, Y., Komaki, K., Laxmi, Y. R. S. and Shibutani, S. (2004) Determination of tamoxifen-DNA adducts in leukocytes from breast cancer patients treated with tamoxifen. Chem. Res. Toxicol. 17, 1577-1583. Meier, B. W., Gomez, J. D., Zhou, A. and Thompson, J. A. (2005) Immunochemical and proteomic analysis of covalent adducts formed by quinone methide tumor promoters in mouse lung epithelial cell lines. Chem. Res. Toxicol. 18, 1575-1585. Walle, T., Vincent, T. S. and Walle, U. K. (2003) Evidence of covalent binding of the dietary flavonoid quercetin to DNA and protein in human intestinal and hepatic cells. Biochem. Pharmacol. 65, 1603-1610.

26


Page 27 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(26)

(27)

(28) (29)

(30) (31)

(32) (33)

(34) (35) (36) (37) (38)

(39) (40) (41) (42)

(43) (44)


Weinert, E. E., Frankenfield, K. N. and Rokita, S. E. (2005) Time-dependent evolution of adducts formed between deoxynucleosides and a model quinone methide. Chem. Res. Toxicol. 18, 1364-1370. Weinert, E. E., Dondi, R., Colloredo-Mels, S., Frankenfield, K. N., Mitchell, C. H., Freccero, M. and Rokita, S. E. (2006) Substituents on quinone methides strongly modulate formation and stability of their nucleophilic adducts. J. Am. Chem. Soc. 128, 11940-11947. Liebler, D. C. and Guengerich, F. P. (2005) Elucidating mechanisms of drug-induced toxicity. Nat. Rev. Drug Discov. 4, 410-420. McCrane, M. P., Weinert, E. E., Lin, Y., Mazzola, E. P., Lam, Y.-F., Scholl, P. F. and Rokita, S. E. (2011) Trapping a labile adduct formed between an ortho-quinone methide and 2'deoxycytidine. Org. Lett. 13, 1186-1189. Rokita, S. E., Yang, J. H., Pande, P. and Greenberg, W. A. (1997) Quinone methide alkylation of deoxycytidine. J. Org. Chem. 62, 3010-3012. Veldhuyzen, W. F., Shallop, A. J., Jones, R. A. and Rokita, S. E. (2001) Thermodynamic versus kinetic products of DNA alkylation as modeled by reaction of deoxyadenosine. J. Am. Chem. Soc. 123, 11126-11132. Pretsch, E., Bühlmann, P. and Affolter, C. (2000) Structure Determination of Organic Compounds: Tables of Spectral Data, 3rd ed., Springer, Berlin ; New York. Carreño, M. C., Gonzalez-Lopez, M. and Urbano, A. (2006) Oxidative de-aromatization of para-alkyl phenols into para-peroxyquinols and para-quinols mediated by oxone as a source of singlet oxygen. Angew. Chem. Int. Ed. 45, 2737-2741. Veldhuyzen, W., Lam, Y.-f. and Rokita, S. E. (2001) 2-Deoxyguanosine reacts with a model quinone methide at multiple sites. Chem. Res. Toxicol. 14, 1345-1351. Ali, M. S., Fang, J. J., Burton, C., Glenn, B. and Khokhar, A. R. (2007) 1-Methyl-4(methylamino)piperidine-platinum(II) adducts with DNA bases. J. Coord. Chem. 60, 691-698. Gates, K. S., Nooner, T. and Dutta, S. (2004) Biologically relevant chemical reactions of N7alkylguanine residues in DNA. Chem. Res. Toxicol. 17, 839-856. Pullman, A. and Pullman, B. (1981) Molecular electrostatic potential of the nucleic acids. Quart. Rev. Biophys. 14, 289-380. Freccero, M., Di Valentin, C. and Sarzi-Amadè, M. (2003) Modeling H-bonding and solvent effects in the alkylation of pyrimidine bases by prototype quinone methide. A DFT study. J. Am. Chem. Soc. 125, 3544-3553. Freccero, M., Gandolfi, R. and Sarzi-Amadè, M. (2003) Selectivity of purine alkylation by a quinone methide. Kinetic or thermodynamic control? J. Org. Chem. 68, 6411-6423. Zhou, Q., Pande, P., Johnson, A. E. and Rokita, S. E. (2001) Sequence-specific delivery of a quinone methide intermediate to the major groove of DNA. Bioorg. Med. Chem. 9, 2347-2354. Veldhuyzen, W. F., Pande, P. and Rokita, S. E. (2003) A transient product of DNA alkylation can be stabilized by binding localization. J. Am. Chem. Soc. 125, 14005-14013. Romero, R. M., Mitas, M. and Haworth, I. S. (1999) Anomolous cross-linking by mechlorethamine of DNA duplexes containing C-C mismatch pairs. Biochemistry 38, 36413648. Bodell, W. J. (1999) Effect of cations on the formation of DNA alkylation products in DNA reacted with 1-(2-chloroethyl)-1-nitrosourea. Chem. Res. Toxicol. 12, 965-970. Boritzki, T. J., Palmer, B. D., Coddington, J. M. and Denny, W. A. (1994) Identification of the major lesion from the reaction of an acridine-targeted aniline mustard with DNA as an adenine N1 adduct. Chem. Res. Toxicol. 7, 41-46.

27



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(45)

Page 28 of 39

Goggin, M., Anderson, C., Park, S., Swenberg, J., Walker, V. and Tretyakova, N. (2008) Quantitative high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry analysis of the adenine-guanine cross-links of 1,2,3,4-diepoxybutane in tissues of butadiene-exposed B6C3F1 mice. Chem. Res. Toxicol. 21, 1163-1170.

28


Page 29 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Select 1H and 13C Chemical Shifts of Alkylated dA Derivatives.

2'-deoxyadenosine (dA)

H2 (ppm) 8.34a

C2 (ppm) 153.0b

H10 (ppm) n/a

C10 (ppm) n/a

MeQM-dA N1 (6)a

8.58

147.8

5.06

47.0

this work

QM-dA N1c

8.73

148.5

5.26

48.2

21

Ox. MeQM-dA N1 (7)a

8.11

144.2

4.07, 4.30

53.7

this work

MeQM-dA N6 (8)a

8.21

152.1

4.57

39.2

this work

QM-dA N6 d

8.34

151.5

4.64

42.6

23

Compound

Source 28

Ox. MeQM-dA N6 (9)a 8.19 152.2 4.34 37.8 this work a b c d In DMSO-d6. In D2O. In DMF-d7. In 95% CDCl3 and 5% methanol-d4, 229 K

Table 2. Spectral Characteristics of dG Adducts Formed by MeQM (2) and the Parent ortho-QM. compound (by order of elution) MeQM-dG N7 (12)a

259, 279

H10 (ppm) 5.51

H8 (ppm) 9.18

MeQM-guanine N7 (13)a

283

5.30

7.84

MeQM-dG N1 (10)a

255, 271

5.06

7.96

MeQM-dG N2 (11)a

247, 275

4.36

7.90

QM-dG N7b

260

n/a

n/a

QM-guanine N7b

280

5.39

7.64

c

257, 275

5.28

8.05

QM-dG N2 c

256, 280

4.58

7.99

QM-dG N1

a

λmax (nm)

In DMSO-d6. bIn 0.2 M NaOD in D2O. 34 cIn DMF-d7.34

29



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 39

Figure legends

Figure 1. 1H-13C HMBC of the oxidized product of MeQM-dA N1 (7) in DMSO-d6. Figure 2. 1H-13C HMBC of oxidized MeQM-guanine N7 adduct (15) in DMSO-d6.

Figure 3. 1H-13C HMBC of oxidized MeQM-dG N1 adduct (16) in DMSO-d6.

Figure 4. 1H-13C HMBC of the oxidized MeQM-dG N2 adduct (17) in DMSO-d6.

Figure 5. Analytic separation of standards for determining reversible MeQM alkylation of DNA. Elution of the oxidized nucleoside adducts is monitored by (A) UV absorption and (B) mass detection at the indicated m/z. Separation by reverse-phase chromatography is described in the experimental section.

Figure 6. Selected ion monitoring of chromatograms to detect the oxidized adducts formed by alkylation of single- and double-stranded DNA with MeQM 2. Reactions of (A) OD1 and (B) OD1/OD2 were quenched after one h with BTI. The presence and absence of the oxidized adducts are indicated by comparison to the retention times of the standards formed by reaction at guanine N7 (15), dG N1 (16), dA N1 (7), dG N2 (17), dC N3 (5), and dA N6 (9).

30


Page 31 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Figure 1)

31



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Figure 2)

32


Page 32 of 39

Page 33 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Figure 3)

33



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Figure 4)

34


Page 34 of 39

Page 35 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Figure 5)

35



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Figure 6)

36


Page 36 of 39

Page 37 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme legends

Scheme 1. In situ generation of a reactive quinone methide (MeQM 2), alkylation of dC and subsequent oxidation by BTI to form a stable spiro derivative (5) by intramolecular cyclization.

Scheme 2. Formation and oxidative trapping of the dA adducts, MeQM-dA N1 (6) and MeQM-dA N6 (8). Scheme 3. Formation and oxidative trapping of the dG adducts (dG N1 (10), dG N2 (11), and dG N7 (12). Upon alkylation, the dG N7 product deglycosylates to form the guanine N7 product (15).

Scheme 4. LC/MS based assay for detecting labile products of DNA alkylation by MeQM 2 utilizing an oxidative trap.

37



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Scheme 1)

(Scheme 2)

38


Page 38 of 39

Page 39 of 39

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Scheme 3)

(Scheme 4)

39


Oxidative Quenching of Quinone Methide Adducts Reveals Transient

Recommend Documents