PDF (9 MB) - American Chemical Society

Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Boiled Abalone Byproduct Peptide Exhibits Anti-Tumor Activity in HT1080 Cells and HUVECs by Suppressing the Metastasis and Angiogenesis in Vitro Fang Gong,† Mei-Fang Chen,† Jiali Chen,† ChengYong Li,‡,§ ChunXia Zhou,† PengZhi Hong,† ShengLi Sun,‡ and Zhong-Ji Qian*,‡,§ †

College of Food Science and Technology, Guangdong Ocean University, Zhanjiang, Guangdong 524088, China School of Chemistry and Environment, Guangdong Ocean University, Zhanjiang, Guangdong 524088, China § Shenzhen Institute of Guangdong Ocean University, Shenzhen, Guangdong 518114, China

Downloaded via NOTTINGHAM TRENT UNIV on July 26, 2019 at 06:34:44 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

ABSTRACT: Abalone (Haliotis discus hannai) is a precious seafood in the market. It has been reported that biological active substances derived from abalone have anti-oxidative, anti-inflammatory, anti-bacterial, and anti-thrombosis potential. However, there were few studies to assess whether they have anti-cancer potential. In this study, we evaluated the anti-metastasis and antipro-angiogenic factors and mechanism of action of boiled abalone byproduct peptide (BABP, EMDEAQDPSEW) in human fibrosarcoma (HT1080) cells and human umbilical vein endothelial cells (HUVECs). The results demonstrated that BABP treatment significantly lowers migration and the invasion of HT1080 cells and HUVECs. BABP inhibits phorbol 12-myristate 13-acetate (PMA)-induced matrix metalloproteinase (MMP) expression and activity by blocking mitogen-activated protein kinases (MAPKs) and NF-κB signaling and hypoxia-induced vascular endothelial growth factor (VEGF) secretion and hypoxia inducible factor (HIF)-1α accumulation through suppressing the AKT/mTOR signal pathway. BABP treatment inhibits VEGFinduced VEGFR-2 expression and tube formation in HUVECs. The effect of BABP on anti-metastatic and anti-vascular activity in HT1080 cells and HUVECs revealed that BABP may be a potential pharmacophore for tumor therapy in the future. KEYWORDS: Haliotis discus hannai, boiled abalone byproduct peptide, anti-metastasis, anti-angiogenesis, HT1080 cells, HUVECs

■

type IV collagen, which is a major ingredient of ECM.9 Secreted from human macrophages and polymorphonuclear leukocytes, MMP-9 is generally overexpressed in many pathological processes such as cancer, inflammation, and cardiovascular diseases.10−12 Angiogenesis, a normal process in embryogenesis and development, is the growth of new blood vessels from preexisting vessels. Inversely, pathological angiogenesis mediates various diseases, like rheumatoid arthritis and atherosclerosis. In addition, angiogenesis is implicated with the transition of premalignant lesions to the malignant tumor growth and metastasis.13,14 The tumor cells collect the nutrients and oxygen from a complex network of tumor blood microvessels to nourish their survival, growth, and metastasis.15 Angiogenesis is controlled by the balance between pro-antiangiogenic and anti-angiogenic factors in the solid tumor microenvironment where pro-angiogenesis factors, including vascular endothelial growth factor (VEGF), MMPs, basic fibroblast growth factor (bFGF), and angiogenin, are commonly overexpressed.16,17 Oncogene-involved protein expression and several cellular stress factors, like hypoxia, low pH, and nutrient deprivation, are key stimuli of angiogenic

INTRODUCTION A tumor is a mass or lump caused by a group of cells that possess an unregulated growth property.1 Being one of the culprits of human death in the world, a tumor threatens human health and life. It was reported that the number of new cancer cases worldwide have reached 18.1 million in 2018, and the mortality was over 50%.2 Metastasis of tumor cells have a direct influence on other tissues and finally can lead to the death of the cancer patient. Meanwhile, angiogenesis produced by tumor cells and endothelial cells plays a crucial part in the tumor microenvironment in which the blood vessels can provide tumor cells with nutrition and oxygen as well as take away metabolites in the process of tumorigenesis but also transfer tumor cells to other tissues and organs.3 Therefore, the inhibitions of metastasis and angiogenesis are significantly important for clinical tumor treatment. The metastasis of tumor cells began with the rapid growth of tumor cells and detachment from the primary site, followed by degradation of the basement membrane and extracellular matrix (ECM) by secreted protein hydrolysates and finally permeation into the vessels to achieve metastasis and form a second tumor in the new tissue.4,5 Numerous studies have demonstrated that matrix metalloproteinases (MMPs) play an essential role in the metastatic process because they are responsible for degrading the ECM and basement membrane that are the first defensive line for cell metastasis, and their overexpression contributes to tumor metastasis and angiogenesis.6−8 To date, there are 26 members in the MMP family. Specially, MMP-9 is a key enzyme initiating the degradation of © XXXX American Chemical Society

Special Issue: Food Bioactives and Health Received: May 13, 2019 Revised: July 17, 2019 Accepted: July 18, 2019

A

DOI: 10.1021/acs.jafc.9b03005 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry signaling.16 Therefore, inhibition of angiogenesis-induction factors is an important approach for anti-angiogenic therapy. Chemoprevention has been considered as an effective approach for tumor treatment. It can kill tumor cells,; however, simultaneously, it also damages normal cells. Chemopreventive agents are expected to be safe, inexpensive, and abundant.18 Peptides possess these potentials and are considered to be safer because they appear in people’s diets.19 In addition, advances in analytical techniques have facilitated the acquisition of pure peptides from natural resources. It has been reported that extracted peptides have possible therapeutic potential in a wide spectrum of diseases, like anti-bacterial, anti-diabetic, and anti-cancer activity and cardiovascular disease.20 With the development of marine resources, marine organisms have been increasingly regarded as a source of bioactive molecules possessing therapeutic applications as nutraceuticals and drugs. Abalone (Haliotis discus hannai), a marine gastropod, generally serves as a precious seafood in the market. Numerous studies have proved that abalone contains various bioactive substances that exert anti-oxidant, anti-inflammatory, and anti-tumor functions.21 Although several studies have investigated the therapeutic importance of abalone, the potential effect and related mechanism of abalone on anti-cancer is still not fully clarified. Abalone boiled dry is one of the commonly used abalone processing and preservation methods. A large amount of boiled liquid during the processing is usually discarded as waste, and there are salts and rich proteins, carbohydrates, minerals, and lipid in the boiled liquid. Therefore, in the current study, we investigated the anti-tumor effect of a peptide derived from boiled abalone byproducts (BABs), an abalone processing waste, on tumor metastasis and angiogenesis. Our results showed that expression and proteolytic activity of MMPs, hypoxia-induced VEGF secretion, and hypoxia inducible factor (HIF)-1α accumulation were inhibited by treatment with the peptide in human fibrosarcoma (HT1080) cells. In addition, the peptide treatment lowers tube formation and VEGFinduced VGEGFR-2 expression in human umbilical vein endothelial cells (HUVECs). Thus, our data suggest that boiled abalone byproduct peptide (BABP) may be a promising therapeutic agent against metastasis and angiogenesis of tumor cells in the future.

■

Determination of the Amino Acid Sequence of BABP. The purified BABPs from previous studies22 (fraction 4 of RP-HPLC) were determined with a Q-TOF mass spectrometer (Micromass, Altrincham, UK) and electrospray ionization (ESI). BABP was separately infused into the electrospray source following dissolution in methanol/water (1:1, v/v), and molecular mass was determined by a doubly charged (M + 2H)+2 state in the mass spectrum. After molecular mass determination, the peptide was automatically selected for fragmentation, and sequence information was obtained using tandem mass spectroscopy (MS) analysis. Cell Viability and Colony Formation Assay. HT1080 cells and HUVECs seeded in the 96-well plates were exposed to different concentrations (10, 20, 50, and 100 μM) of BABP for 24 h. The MTT work solution (1 mg/mL, 100 μL) was added to the cells. After incubation for 3 h, the formazan crystals were dissolved using DMSO (100 μL). Then, the absorbance of each well was measured by a microplate reader at 490 nm, and the effect of BABP on the anchorage-dependent colony formation of the cells was also studied. Cells were seeded in 6-well plates at a density of 1 × 103 cells per well. After 24 h, the cells were exposed to stated concentrations of BABP for a week and then stained with 0.2% crystal violet/methanol (w/v) reagent to visualize the colonies for counting. Cell Migration by the Wound Healing Assay. To examine the effect of BABP on cell migration, we conduct a wound healing assay. Briefly, HT1080 cells and HUVECs seeded in 24-well plates were mechanically scratched using a sterile 200 μL pipet tip, and the cell debris was removed with sterilized PBS. Subsequently, cells were incubated with various concentrations of BABP (10, 20, 50, and 100 μM). Next, the pictures of cells migrating to the edge of the wound were recorded with a microscope (JiDi, GD30 China) at 0, 12, and 24 h, respectively. Cell Invasion in 3D Sitting. The effects of BABP on the invasion ability of HT1080 cells and HUVECs were conducted as described.23 Briefly, a single-cell suspension (1 × 105 cells/mL) of HT1080 cells as well as HUVECs was seeded in the lid of a 10 cm culture dish for 72 h to pool the spheroids, and then, 80 μL of the cell spheroids was added in the mixture of Matrigel and type I collagen at 4 °C; the cells were seeded in 48-well plates coated with a thin layer of Matrigel and incubated at 37 °C for 30 min to form a 3D sitting. Then, warm media with various concentrations of BABP were added. The ability of cell invasion was observed using a microscope and recorded at 0 and 48 h. Quantitative RT-PCR. The RNA levels of MMPs (MMP-1/2/3/ 9/13) in HT1080 cells were detected by quantitative RT-PCR. The cells incubated in BABP for 1 h were treated with PMA (10 ng/mL) for 24 h, and then, extraction and purification of the RNA were performed with the nucleic acid purification kit (DSBIO, Guangzhou, China). The processes of reverse and quantitative PCR were conducted according to the manufacturer’s protocol of the HiScript II first Strand cDNA Synthesis Kit (+gDNA wiper) and ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China) by the CFX96 Real-Time System (BIO-RAD, Hercules, CA, USA), respectively. The primers used for SYBR Green real-time PCR were as follows (5−3′): AGCCATCACTTACCTTGCACTGAG and RCCACATCAGGCACTCCACATCTG for MMP-1; AGCCAAGCGGTCTAAGTCCAGAG and GGAATGAAGCACAGCAGGTCTCAG for MMP-2; ACGCACAGCAACAGTAGGATTGG, GAGGCAGGCAAGACAGCAAGG for MMP-3; TCCTGGTGCTCCTGGTGCTG and CTGCCTGTCGGTGAGATTGGTTC for MMP-9; AGTCATGGAGCTTGCTGCATTCTC and TCCTGGCTGCCTTCCTCTTCTTG for MMP-13; CCTGGCACCCAGCACAAT and GGGCCGGACTCGTCATAC for β-actin. Gelatinolytic Activity. The activities of MMP-2 and MMP-9 in HT1080 cells were revealed using the gelatin zymography assay. Cells in 24-well plates were treated with BABP (20, 50, and 100 μM) for 1 h and then exposed to PMA (10 ng/mL) for 72 h. The cell medium was used for gel electrophoresis. Next, the gel by Coomassie Blue staining was observed and photographed using BIO-RAD (Hercules, CA, USA).

MATERIALS AND METHODS

Materials. Human fibrosarcoma (HT1080) cells and human umbilical vein endothelial cells (HUVECs) were purchased from Guangzhou Cellcook Biotech Co., Ltd. (Guangzhou, China). Dulbecco’s modified Eagle’s minimal essential medium (DMEM) and penicillin/streptomycin were purchased from Gibco (Grand Island, NY). Fetal bovine serum (FBS) was provided by Vigonob (UY). 3-(4,5-Dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was from Shanghai Aladdin Bio-Chem Technology Co., Ltd. (Shanghai, China). Antibodies against p65, p-p65, IκB, p-IκB, ERK, pERK, p-38, p-p38, JNK, p-JNK, β-actin, MMP2, and MMP9 were obtained by Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against HIF-1α, AKT, p-AKT, p-mTOR, mTOR, pp70S6K, p70S6K, VEGFR-2, p-VEGFR-2, vascular endothelial growth factor (VEGF), and horse antimouse IgG were provided by Cell Signaling Technology (Boston, MA, USA). Matrigel was from BD Biosciences (San Jose, CA, USA). Phorbol 12-myristate 13-acetate (PMA) and CoCl2 were provided by Sigma-Aldrich (St. Louis, MO, USA). A nuclear protein extraction kit and DNA probe (5′-AGT TGA GGC GAC TTT CCC AGG C-3′, 3′-TCA ACT CCG CTG AAA GGG TCC G-5′) were provided by Beyotime (Shanghai, China). B


Article

Journal of Agricultural and Food Chemistry

Figure 1. continued

C


Article


Figure 1. Effect of BABP on migration and invasion of HT1080 cells and HUVECs. (A) Identification of the molecular mass and amino acid sequence of BABP (EMDEAQDGDPK). (B) Cytotoxicity of BABP on HT1080 cells and HUVECs, respectively. The MTT assay was used to assess the viability of cells under different concentrations of BABP (10, 20, 50, and 100 μM). (C) Colony formation of HT1080 cells stained with crystal violet solution (n = 3 per group). (D) The inhibitory effect of BABP on the migration of HT1080 cells and HUVECs. Scratch wounds were created by scraping the confluent cell monolayer, and the migration was pictured at 12 and 24 h, respectively. Wound migration was measured in five selected fields and compared with the width at 0 h. (E) The inhibitory effect of BABP on HT1080 cell and HUVEC invasion in the 3D model. The mixture of cell spheroid, type I collagen, and Matrigel was added in precoated Matrigel 48-well plates for 30 min and treated with medium including 50 and 100 μM BABP. An inverted microscope was used to take photos of the tumor cell invasion at 48 h, and it was analyzed with ImageJ. Grouped data are expressed as mean ± SD (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001 vs untreated control. Western Blotting. Total protein from the treated HT1080 cells and HUVECs was isolated using RIPA buffer, and protein concentration was measured by the Bradford protein assay (Thermo Scientific, Waltham, MA, USA). The protein level of the target gene was determined using Western blot analysis. Immunofluorescence Staining. Fixed cells were permeabilized with 0.2% Triton X-100 in PBS and blocked with 5% BSA at room

temperature for 1 h. Subsequently, cells were exposed to anti-p65 antibody overnight at 4 °C. Next, cells were treated with secondary antibodies for 2 h, and DAPI was used to stain the nucleus. Fluorescence signals were acquired on a fluorescence microscope (Olympus Opticals, Tokyo, Japan). Electrophoretic Mobility Shift Assays (EMSA). The nuclear protein of HT1080 cells was extracted using a nuclear protein D


Article


Figure 2. continued

E


Article


Figure 2. Inhibitory effect of BABP on MMP expression. (A) HT1080 cells were incubated with BABP for 1 h and then were stimulated with PMA (10 ng/mL). After 24 h, MMP RNA level in the cells was detected using qPCR, and β-actin was used as a loading control. (B) Gelatin zymography was applied to measure the activities of MMP-2/9 in HT1080 cells. Cells were incubated with BABP (20, 50, and 100 μM) for 1 h and then induced by PMA (10 ng/mL) for another 72 h. The conditioned media were harvested and detected by gelatin zymography. The untreated control served as a loading control. (C) The protein level of MMP-2 and MMP-9 in cell lysates was measured by Western blot analysis. β-Actin was the loading control. HT1080 cells were treated with BABP (20, 50, and 100 μM) for 1 h and were stimulated by PMA (10 ng/mL) for another 24 h. The relative expressions of MMP-2 and MMP-9 were quantified by ImageJ. Grouped data are expressed as mean ± SD (n = 3). #p < 0.001 vs untreated control, *p < 0.05, **p < 0.01, and ***p < 0.001 vs PMA stimulation.

■

extraction kit, and concentration was measured by the Bradford protein assay. According to the manufacturer’s instruction, the complexes of NF-κB and DNA probes were separated by 6% nondenaturing polyacrylamide gel electrophoresis and transferred to nylon membranes. The membrane was cross-linked for 15 min under UV light and subsequently blocked with blocking buffer. Then, the membrane was exposed to an equilibration solution for 5 min and visualized with an enhanced chemiluminescence (ECL) detection system to photograph. Enzyme-Linked Immunosorbent Assay (ELISA). The level of VEGF in the supernatant was determined by an ELISA Kit (Neobioscience, Shanghai, China). HT1080 cells were treated with BABP (20, 50, and 100 μM) for 1 h and then stimulated by 100 μM CoCl2 for 1 day. Conditional media were harvested in sterile tubes and centrifuged (2000 rpm, 4 °C) for 15 min to get the supernatants. The concentration of VEGF was analyzed according to the manufacturer’s protocol. Tube Formation Assay in HUVECs. The angiogenesis effect of BABP on HUVECs was detected using the tube formation assay. The cells containing the indicated concentrations of BABP were seeded in 96-well plates pretreated with Matrigel (at 4 °C, 30 min) and incubated at 37 °C. After 3 h, the level of tube formation was observed and photographed with an inverted microscope (JiDi, GD30, Guangzhou, China). Molecular Docking Analysis. The structures of HIF-1 in complex with the HIF-1α fragment peptide (PDB ID: 1H2L) and the VEGFR-2 kinase domain in complex with motesanib (PDB ID: 3EFL) were retrieved from the Protein Data Bank. The structures of BABP, HIF-1α, and VEGFR-2 were prepared by Discovery Studio 2016 software. Docking simulation studies of HIF-1α and VEGFR-2 in complex with BABP were carried out using the CDOCKER protocol of DS 2016. The small molecule conformations were determined by the high temperature dynamics method, and they were optimized in the active site areas of the acceptor by simulated annealing. Statistical Analysis. Grouped data are expressed as mean ± SD (n = 3). Statistical differences between groups were calculated by oneway analysis of variance using GraphPad Prism 5.0. p values < 0.05 were considered statistically significant.

RESULTS BABP Attenuates the Metastatic Potential of HT1080 Cells and HUVECs at Noncytotoxic Concentrations. The amino acid sequence of the purified BABP was detected to be Glu-Met-Asp-Glu-Ala-Gln-Asp-Gly-Asp-Pro-Lys (EMDEAQDPSEW, 1234.41 Da) (Figure 1A). At beginning of the study, we first determined the cytotoxicity of BABP on HT1080 cells and HUVECs by the MTT assay. As depicted in Figure 1B, there were no significant decreases between BABP-treated cells and control cells, which indicated that BABP is nontoxic to HT1080 cells and HUVECs. Thus, the employed concentrations (10, 20, 50, and 100 μM) of BABP were used in all the subsequent experiments. The ability to form sizable colonies by HT1080 cells and HUVECs from a single cell was dramatically inhibited by BABP treatment in a dose-dependent manner, and this effect was not relevant to cytotoxicity (Figure 1C). In the migration assay, untreated HT1080 cells and HUVECs apace migrated to the position of wound. On the contrary, BABP treatment observably inhibited cell migration. For HT1080 cells, the inhibitory capacity is approximately 32.5−59.8% at 12 h and 23.6−52.9% inhibition at 24 h compared with control cells; BABP also effectively inhibits HUVECs migration, and the inhibitory rate is approximately 17.4−74.4% at 12 h and 18.7−73.8% at 24 h compared with untreated cells (Figure 1D). In addition, as showed in Figure. 1E, the invasive ability of HT1080 cells and HUVECs treated with BABP (50 and 100 μM) was weakened in a dose-dependent manner, leading to reduction of approximately 32.2−76.7% in HT1080 cells and 48−85% in HUVECs. These dates indicated that BABP can inhibit metastasis and invasion in HT1080 cells and HUVECs, which is not dependent on cytotoxicity. BABP Downregulates PMA-Stimulated MMP Expression and Proteolytic Activities in HT1080 Cells. MMPs can regulate the metastasis of tumor cells due to its degradation ability of the tissue surrounding tumor cells, F


Article


Figure 3. continued

G


Article


Figure 3. BABP blocked PMA-induced ERK, p-38MAPK, and NF-κB phosphorylation in HT1080 cells. The cells were pretreated with BABP (20, 50, and 100 μM) for 1 h, followed by stimulation with PMA (10 ng/mL) for 24 h. (A, B) Total cell lysates were prepared to evaluate the expression for MAPKs and NF-κB by Western blotting analysis. Band intensities were quantified by ImageJ and normalized to β-actin expression, and the relative ratios of phosphorylated form/total form were also measured. (C) Nuclear translocation of NF-κBp65 was observed by immunofluorescence through an overlay of blue DAPI staining with green p65 staining. Untreated control was used as a loading control. (D) NF-κB-DNA binding activity was demonstrated by EMSA. Band intensities were normalized to untreated control. Grouped data are expressed as mean ± SD (n = 3). #p < 0.001 vs untreated control, *p < 0.05, **p < 0.01, and ***p < 0.001 vs PMA stimulation.

concentration of VEGF secreted from cancer cells into the culture medium was measured using an ELISA kit. As shown in Figure 4A, BABP treatment suppresses the VEGF release of cancer cells in a concentration-dependent manner. VEGF is the downstream target of HIF-1α, which is connected with angiogenesis by controlling VEGF expression. Thus, we studied the expressions of HIF-1α and the AKT/mTOR signal pathway by Western blotting analysis. The results showed that BABP effectively downregulated the expression of HIF-1α via blocking the AKT/mTOR/p70S6K signal pathway in a dosedependent manner, revealing that BABP treatment could inhibit the activation of the pro-angiogenesis factor by suppressing the HIF-1α signal pathway (Figure 4B,C). BABP Inhibits the Tube Formation and Prevents VEGF-Induced VEGFR-2 Expression in HUVECs. The rapid development and metastasis of tumor cells lead to a shortage of oxygen and nutrients in the tumor microenvironment. Therefore, blood vessels are necessary for tumor cell survival, invasion, and metastasis. The anti-angiogenesis effect of BABP was determined by tube formation analysis. The result showed that the pro-angiogenic factors in Matrigel increase angiogenesis formed by HUVECs, whereas BABP treatment decreases the numbers of tube formation compared with untreated cells in Figure 5A. Since combination of VEGF and VEGFR-2 in the surface of endothelial cells promote angiogenesis, the effect of BABP on VEGFR-2 expression in VEGF-induced HUVECs was determined by Western blotting, and the result showed that BABP treatment inhibited VEGFR2 phosphorylation in a concentration-dependent manner (Figure 5B). BABP Inhibits the Activity of HIF-1α and VEGFR-2 by Docking. Overexpression of HIF-1α and VEGFR-2 in the solid tumor microenvironment, which stimulates angiogenesis, plays a crucial role during the tumor metastasis. Thus, we identified the potential of BABP against HIF-1α (PDB: 1H2L) and VEGFR-2 (PDB: 3EFL) as well as binding affinity via molecular docking analysis. As depicted in Figure 6, BABP can bind tightly to ASP104, GLN174, GLN181, LEU182, THR183, ASN185, GLN203, ARG238, and LYS324 by a

which facilitate the formation of tumor blood vessels. Therefore, we determined the level of MMP (MMP-1/2/3/ 9/13) mRNA expression using real-time quantitative reverse transcription PCR (qPCR) and protein expression as well as proteolytic activities of MMP-2 and MMP-9 by Western blotting and gelatin zymography. As presented in Figure 2A, PMA induction sharply promoted MMP expression, but BABP treatment dramatically inhibited the levels of MMP-1/3/9/13 except MMP-2. In zymography analysis and Western blotting analysis, BABP treatment suppressed the proteolytic activities and protein expression of MMP9 in HT1080 cells in a dosedependent manner; however, the level of MMP-2 was barely reduced (Figure 2B,C). BABP Regulates PMA-Induced Mitogen-Activated Protein Kinase (MAPK) Phosphorylation and Inhibits NF-κB Activation in HT1080 Cells. MAPKs and NF-κB signal pathways have a relationship with the expression of numerous genes that manage the promotion, angiogenesis, metastasis, and MMP expression of the tumor cell. The Western blotting analysis, p65 translocation, and EMSA assay were carried out to assess the influence of BABP on MAPKs and NF-κB signal pathways in HT1080 cells. As illustrated in Figure 3A,B, Western blotting analysis results showed that PMA stimulation obviously elevated phosphorylation of p38 and ERK as well as NF-κB (p65 and IκB) phosphorylation activation. BABP treatment effectively suppressed PMAinduced ERK and p38 phosphorylation activation and p65 and IκB in a concentration dependent manner. Also, the results of p65 translocation and EMSA analysis showed that BABP incubation clearly inhibited p65 nuclear translocation and weakened the binding of p65 and DNA (Figure 3C,D). All the results revealed that the treatment of BABP can effectively suppress ERK, p38, and NF-κB signaling. BABP Inhibits the VEGF Release and Blocks Hypoxia Inducible Factor (HIF)-1α Signal Pathway under Hypoxic Conditions in HT1080 Cells. To assess BABP capacity in angiogenesis, first, we detected the level of VEGF expression. VEGF can promote tumor angiogenesis by stimulating vascular endothelial cells and tumor cells. The H


Article


Figure 4. BABP suppresses VEGF secretion and the AKT/mTOR/p-70S6K signaling pathway in HT1080 cells. (A) The cells pretreated with BABP (20, 50, and 100 μM) were incubated in 100 μM CoCl2 for 24 h. The level of VEGF secretion in condition media was detected using an ELISA kit. (B, C) The expressions of HIF-1α, p-AKT/AKT, p-mTOR/mTOR, and p-p70S6K/p70S6K were measured via Western blotting, and βactin was the loading control. Grouped data are expressed as mean ± SD (n = 3). #p < 0.001 vs untreated control, **p < 0.01 and ***p < 0.001 vs CoCl2 stimulation.

hydrogen bond in the active site of HIF-1α, and its docking energy was −100.67 kcal/mol; simultaneously, BABP can combine with amino acid residues GLN847, ASP852, THR864, and GLU917 of VEGFR-2 of HIF-1α and can form a strong interaction supported the hydrogen bond, and its docking energy was −152.93 kcal/mol. Binding mode analyses and docking simulations further supported an angiogenic

inhibition mechanism of BABP by inhibiting the activity of HIF-1α and VEGFR-2.

■

DISCUSSION Tumor metastasis is a lethal factor for patients with cancer.24 Thus, metastatic inhibition of tumor cells is of significant importance for tumor therapies. In addition, in the process of tumor metastasis, blood vessels can supply adequate nutrition I


Article


Figure 5. BABP inhibits tube formation and VEGFR-2 expression. (A) Cells were added in Matrigel-coated 96-well plates and treated with BABP (50 and 100 μM) for 3 h. Then, the pictures of the tube formation were taken by an inverted microscope and quantified by image J. HUVECs were incubated with BABP (20, 50, and 100 μM) for 1 h and stimulated with VEGF (100 μM) for another 24 h. (B) VEGFR-2 expression in HUVEC was determined by Western blotting. Grouped data are expressed as mean ± SD (n = 3). #p < 0.001 vs untreated control, **p < 0.01 and ***p < 0.001 vs VEGF stimulation.

inhibition of the Akt-MAPK pathway and NF-κB DNA-binding activity. Kim et al.’s and Cho et al.’s studies also showed that the inhibition of p38, JNK of MAPK, and NF-κB phosphorylation were able to prevent metastasis, proteolysis, and the activity of MMP-9 of cells.31,32 Momordin exerts an inhibitory potential in HepG2 cell migration and invasion through downregulating MMP-9 and the adhesion of molecules by blockading p38 and JNK signaling.33 Our data showed that BABP can inhibit the proliferation, migration, and invasion of HT1080 cells and invasion of endothelial HUVECs. Further, BABP prevented PMA-induced the transcriptional level of MMP-1/3/MMP-9/MMP-13 and the activity and protein expression of MMP-9 via downregulating ERK, p38, and NF-κB activity. Both normal cells and tumor cells generate pro-angiogenic factor, such as VEGF, MMPs, EGF, bFGF, and PDGF, which facilitate angiogenesis. Angiogenesis, as is well-known, plays a crucial role in the physiology and pathology condition, such as embryonic development, wound healing, and the transition of tumors.34 Angiogenesis promotes the process of tumor formation and metastasis, leading to the application of angiogenesis inhibitors in the treatment of cancer. Thus, inhibition of pro-angiogenic factors is responsible for antiangiogenesis. Specially, VEGF has been proved to be a primary promotor to angiogenesis, stimulating capillary formation from a pre-existing network.35 Numerous studies have showed that VEGF was involved in the poor prognosis of cancer. Overexpression of VEGF may be an early step in the process

and oxygen for tumor cell survival, growth, and metastasis, indicating that angiogenic suppression plays a crucial role for metastatic inhibition.3 Bioactive peptides are attracting more and more attention of researchers because of their specificity and strong affinity for targeting proteins. The present study, in vitro, demonstrates the anti-metastatic and anti-angiogenic effect of peptide BABP isolated from abalone (Haliotis discus hannai). We have shown that BABP prevents PMA-induced tumor cell metastasis by inhibiting expressions and activities of MMPs and hypoxia-induced VEGF secretion of tumor cells as well as attenuates capillary-like tube formation. Tumor cells secrete excess MMPs that facilitate ECM degradation, which is responsible for tumor metastasis and angiogenesis.25 Previous researchers have showed that MAPKs and NF-κB signaling are closely related to tumor metastasis. MAPKs, an important pathway that transfer signals from the cell surface to the nucleus, comprise extracellular signal regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, which are crucial in regulating cell proliferation, differentiation, mitosis, cell survival, gene expression, and apoptosis.11,26 NF-κB, a nuclear transcription factor, can regulate the expression of cytokines and adhesion factors, which are important for cell differentiation, growth, adhesion, and apoptosis.27 NF-κB plays an essential role in the expression of many genes that are involved in tumor promotion, angiogenesis, MMP expression, and metastasis.28,29 Lin et al.30 found that melatonin effectively suppresses MMP-9 transactivation and metastasis in renal cell carcinoma by J


Article


of metastasis, which is associated with the “angiogenesis switch”. VEGF commonly is overexpressed in the tumor microenvironment where rapid growth of tumor cells causes oxygen deficiency,36 qnd when a cell is under hypoxia, it generates hypoxia-inducible factor (HIF), a transcription factor, which stimulates the secretion of VEGF. Further, VEGF can activate cellular responses via combining with tyrosine kinase receptors (VEGFRs) on the cell surface to be a dimer and becoming activated by phosphorylation. VEGFR consists of three main subtypes, including VEGFR-1, -2, and -3.37 VEGF majorly binds to VEGFR-2, which facilitates the formation of blood vessels by endothelial cells. Therefore, several pro-angiogenic inhibitors, such as lenvatinib and motesanib, are under investigation and possess an important significance for multifarious cancer treatment. This study showed that the BABP inhibited HIF-1α accumulation and the AKT/mTOR signaling pathway that was implicated with angiogenesis in the hypoxia condition. Also, the level of VEGF secretion was effectively decreased, as it was downstream of HIF-1α. In addition, BABP treatment attenuated VEGFinduced VEGFR-2 expression and suppressed tube formation in HUVECs. The main effect of BABP on HT1080 cells and HUVECs is shown in the signal pathway in Figure 7.

Figure 7. Main signal pathway of BABP inhibiting metastasis and angiogenesis in HT1080 cells and HUVECs.

With the application of targeted drugs, peptides, owing to its high affinity with receptors, have attracted more and more attention from researchers. Nature provides various peptides that were extracted from marine and terrestrial organisms, including plants, animals, fungi, and bacteria. These peptides have very favorable chemical space for exploitation as a result of evolutionary influences and natural selection. Thus, there is a lot of investigation concerned with the extraction of bioactive peptides, and numerous studies have found that bioactive peptides exerted anti-oxidant, anti-hypertensive, anti-inflammation, and anti-cancer capacity.18 Marine sources provide a vast amount of bioactive peptides and natural small molecules, which account for half of the total global biodiversity. In addition, due to the different and competitive environments between marine and terrestrial environments, peptide products from marine sources have more abundant chemical space structures because its structures may be modified in the backbone or side chain, which is very interesting for the exploitation of the pharmacophore. The best example is calcitonin, a peptide which was first derived from mammals and later isolated from salmon. Clinical studies have shown that fish calcitonin activity is 20−40 times stronger than

Figure 6. Interaction of the BABP with HIF-1α and VEGFR-2. (A) Interaction between BABP and HIF-1α active sites. The hydrogen bonding between ligand−1H2L in a three dimensional structure and a two dimensional structure. (B) Interaction between BABP and VEGFR-2 active sites. The hydrogen bonding between ligand−3EFL in a three dimensional structure and a two dimensional structure. K


Article

Journal of Agricultural and Food Chemistry human calcitonin for the treatment of osteoporosis.38 Abalone, a good source of proteins, contributes to the extraction of peptides. This provides a rich resource for the production of BABP, and some chemicals from abalone have shown an inhibitory effect on oxidant, thrombosis, microbes, and cancer.21 In molecular docking, BABP can tightly combine with ASP104, GLN174, GLN181, LEU182, THR183, ASN185, GLN203, ARG238, and LYS324 of HIF-1α and bind to amino acid residues GLN847, AGP852, THR864, and GLU917 of VEGFR-2 by a hydrogen bond, leading to the active suppression of HIF-1α and VEGFR-2. These results are consistent with the results of Western blotting, indicating that the structure of BABP may be suitable for further exploitation leading to a compound with anti-metastatic and antiangiogenic potential. In summary, we investigated that 11-amino acid peptide (BABP) isolated from boiled abalone byproduct inhibited metastasis of highly malignant HT1080 cells by attenuating MMPs and VEGF. BABP treatment effectively suppressed VEGFR-2 expression and tube formation in HUVECs. Moreover, the results of molecular docking also showed that BABP can closely combine with HIF-1α and VEGFR-2 via a hydrogen bond, leading to active suppression of HIF-1α and VEGFR-2. Thus, these results demonstrated that BABP may be a potential drug-like peptide for treating malignant cancers, which provides the basis for its application of BABP in vivo. However, it is necessary to design different therapeutic strategies for BABP due to its limitations, such as delivery, short half-life, oral availability, and elimination from kidneys after intravenous administration.

■

(2) Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R. L.; Torre, L. A.; Jemal, A. Global Cancer Statistics 2018: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. Ca-Cancer J. Clin. 2018, 68 (6), 394−424. (3) Baker, A.-M.; Bird, D.; Welti, J. C.; Gourlaouen, M.; Lang, G.; Murray, G. I.; Reynolds, A. R.; Cox, T. R.; Erler, J. T. Lysyl Oxidase Plays a Critical Role in Endothelial Cell Stimulation to Drive Tumor Angiogenesis. Cancer Res. 2013, 73 (2), 583−594. (4) Sahai, E. Mechanisms of Cancer Cell Invasion. Curr. Opin. Genet. Dev. 2005, 15 (1), 87−96. (5) Maheswaran, S.; Haber, D. A. Circulating Tumor Cells: A Window into Cancer Biology and Metastasis. Curr. Opin. Genet. Dev. 2010, 20 (1), 96−99. (6) Khamis, Z. I.; Iczkowski, K. A.; Man, Y.-G.; Bou-Dargham, M. J.; Sang, Q.-X. A. Evidence for a Proapoptotic Role of Matrix Metalloproteinase-26 in Human Prostate Cancer Cells and Tissues. J. Cancer 2016, 7 (1), 80−87. (7) Zucker, S.; Vacirca, J. Role of Matrix Metalloproteinases (MMPs) in Colorectal Cancer. Cancer Metastasis Rev. 2004, 23 (1/ 2), 101−117. (8) Singh, D.; Srivastava, S. K.; Chaudhuri, T. K.; Upadhyay, G. Multifaceted Role of Matrix Metalloproteinases (MMPs). Frontiers in Molecular Biosciences 2015, 2, 19. (9) Lin, C.-W.; Shen, S.-C.; Chien, C.-C.; Yang, L.-Y.; Shia, L.-T.; Chen, Y.-C. 12-O-Tetradecanoylphorbol-13-Acetate-Induced Invasion/Migration of Glioblastoma Cells through Activating PKCα/ ERK/NF-KB-Dependent MMP-9 Expression. J. Cell. Physiol. 2010, 225 (2), 472−481. (10) Wang, F.; Chen, H.; Yan, Y.; Liu, Y.; Zhang, S.; Liu, D. Baicalein Protects against the Development of Angiotensin II-Induced Abdominal Aortic Aneurysms by Blocking JNK and P38 MAPK Signaling. Sci. China: Life Sci. 2016, 59 (9), 940−949. (11) Huang, P.; Han, J.; Hui, L. MAPK Signaling in InflammationAssociated Cancer Development. Protein Cell 2010, 1 (3), 218−226. (12) Sun, Y.; Liu, W.-Z.; Liu, T.; Feng, X.; Yang, N.; Zhou, H.-F. Signaling Pathway of MAPK/ERK in Cell Proliferation, Differentiation, Migration, Senescence and Apoptosis. J. Recept. Signal Transduction Res. 2015, 35 (6), 600−604. (13) Carmeliet, P.; Jain, R. K. Angiogenesis in Cancer and Other Diseases. Nature 2000, 407 (6801), 249−257. (14) Risau, W. Mechanisms of Angiogenesis. Nature 1997, 386 (6626), 671−674. (15) Eichhorn, M. E.; Kleespies, A.; Angele, M. K.; Jauch, K.-W.; Bruns, C. J. Angiogenesis in Cancer: Molecular Mechanisms, Clinical Impact. Langenbeck’s Archives of Surgery 2007, 392 (3), 371−379. (16) Bergers, G.; Benjamin, L. E. Tumorigenesis and the Angiogenic Switch. Nat. Rev. Cancer 2003, 3, 401. (17) Chi, A. S.; Sorensen, A. G.; Jain, R. K.; Batchelor, T. T. Angiogenesis as a Therapeutic Target in Malignant Gliomas. Oncologist 2009, 14 (6), 621−636. (18) Díaz-Gómez, J. L.; Castorena-Torres, F.; Preciado-Ortiz, R. E.; García-Lara, S. Anti-Cancer Activity of Maize Bioactive Peptides. Front. Chem. 2017, 5, 44. (19) Li, Y. L.; Dai, X. R.; Yue, X.; Gao, X.-Q.; Zhang, X. S. Identification of Small Secreted Peptides (SSPs) in Maize and Expression Analysis of Partial SSP Genes in Reproductive Tissues. Planta 2014, 240 (4), 713−728. (20) Sable, R.; Parajuli, P.; Jois, S. Peptides, Peptidomimetics, and Polypeptides from Marine Sources: A Wealth of Natural Sources for Pharmaceutical Applications. Mar. Drugs 2017, 15 (4), 124. (21) Suleria, H. A. R.; Masci, P. P.; Gobe, G. C.; Osborne, S. A. Therapeutic Potential of Abalone and Status of Bioactive Molecules: A Comprehensive Review. Crit. Rev. Food Sci. Nutr. 2017, 57 (8), 1742−1748. (22) Qian, Z.-J.; Zhang, Y. Y.; Oh, G.-W.; Heo, S.-Y.; Park, W. S.; Choi, I.-W.; Jung, W.-K. Antioxidant and Angiotensin I Converting Enzyme Inhibition Effects and Antihypertensive Effect in Spontaneously Hyertensive Rats of Peptide Isolated from Boiled Abalone By-

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel: 18607596590. ORCID

Zhong-Ji Qian: 0000-0001-9220-2600 Author Contributions

F.G. designed the experiments and wrote the original draft of the manuscript. Z.-J.Q. and S.-L.S. conceived and designed the research and edited the manuscript. M.-F.C. and J.C. analyzed the data. C.-Y.L., C.-X.Z., and P.-Z.H. contributed materials and analysis tools. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The research was funded by the Yangfan Scarce Top Talent Project of Guangdong Province (201433009) and the Program for Postgraduate Courses and Education Reform and Scientific Research Start-Up Funds of Guangdong Ocean University (to Z.-J.Q.). Additional support was provided by Guangdong Tongde Pharmaceutical Co., Ltd. and the National Engineering Research Center for Modernization of Traditional Chinese Medicine (Lingnan Medicinal Plant Oil Branch) and by the Development Project about Marine Economy Demonstration of Zhanjiang City (2017C8B1).

■

REFERENCES

(1) Kohandel, M.; Kardar, M.; Milosevic, M.; Sivaloganathan, S. Dynamics of Tumor Growth and Combination of Anti-Angiogenic and Cytotoxic Therapies. Phys. Med. Biol. 2007, 52 (13), 3665−3677. L


Article

Journal of Agricultural and Food Chemistry Products, Hallotis Discus Hannai. J. Aquat. Food Prod. Technol. 2018, 27 (9), 946−960. (23) Berens, E. B.; Holy, J. M.; Riegel, A. T.; Wellstein, A. A Cancer Cell Spheroid Assay to Assess Invasion in a 3D Setting. J. Visualized Exp. 2015, No. 105, e53409. (24) Kumar, S.; Weaver, V. M. Mechanics, Malignancy, and Metastasis: The Force Journey of a Tumor Cell. Cancer Metastasis Rev. 2009, 28 (1−2), 113−127. (25) Tonini, T.; Rossi, F.; Claudio, P. P. Molecular Basis of Angiogenesis and Cancer. Oncogene 2003, 22 (42), 6549−6556. (26) Chao, W.; Deng, J.-S.; Li, P.-Y.; Liang, Y.-C.; Huang, G.-J. 3,4Dihydroxybenzalactone Suppresses Human Non-Small Cell Lung Carcinoma Cells Metastasis via Suppression of Epithelial to Mesenchymal Transition, ROS-Mediated PI3K/AKT/MAPK/MMP and NFκB Signaling Pathways. Molecules 2017, 22 (4), 537. (27) Garg, A.; Aggarwal, B. Nuclear Transcription Factor-κB as a Target for Cancer Drug Development. Leukemia 2002, 16 (1), 1053− 1068. (28) Yan, M.; Xu, Q.; Zhang, P.; Zhou, X.; Zhang, Z.; Chen, W. Correlation of NF-κB Signal Pathway with Tumor Metastasis of Human Head and Neck Squamous Cell Carcinoma. BMC Cancer 2010, 10 (1), 437−449. (29) Chen, Y.; Li, H. H.; Fu, J.; Wang, X. F.; Ren, Y. B.; Dong, L. W.; Tang, S. H.; Liu, S. Q.; Wu, M. C.; Wang, H. Y. Oncoprotein P28GANK Binds to RelA and Retains NF-KB in the Cytoplasm through Nuclear Export. Cell Res. 2007, 17 (12), 1020−1029. (30) Lin, Y.-W.; Lee, L.-M.; Lee, W.-J.; Chu, C.-Y.; Tan, P.; Yang, Y.C.; Chen, W.-Y.; Yang, S.-F.; Hsiao, M.; Chien, M.-H. Melatonin Inhibits MMP-9 Transactivation and Renal Cell Carcinoma Metastasis by Suppressing Akt-MAPKs Pathway and NF- κB DNA-Binding Activity. J. Pineal Res. 2016, 60 (3), 277−290. (31) Kim, A.; Im, M.; Gu, M. J.; Ma, J. Y. Ethanol Extract of Lophatheri Herba Exhibits Anti-Cancer Activity in Human Cancer Cells by Suppression of Metastatic and Angiogenic Potential. Sci. Rep. 2016, 6 (1), 36277. (32) Cho, H.-J.; Jeong, Y.-J.; Park, K.-K.; Park, Y.-Y.; Chung, I.-K.; Lee, K.-G.; Yeo, J.-H.; Han, S.-M.; Bae, Y.-S.; Chang, Y.-C. Bee Venom Suppresses PMA-Mediated MMP-9 Gene Activation via JNK/P38 and NF-KB-Dependent Mechanisms. J. Ethnopharmacol. 2010, 127 (3), 662−668. (33) Wang, J.; Liu, Q.; Xiao, H.; Luo, X.; Liu, X. Suppressive Effects of Momordin Ic on HepG2 Cell Migration and Invasion by Regulating MMP-9 and Adhesion Molecules: Involvement of P38 and JNK Pathways. Toxicol. In Vitro 2019, 56, 75−83. (34) Ucuzian, A. A.; Gassman, A. A.; East, A. T.; Greisler, H. P. Molecular Mediators of Angiogenesis. Journal of Burn Care & Research 2010, 31 (1), 158−175. (35) Claesson-Welsh, L.; Welsh, M. VEGFA and Tumour Angiogenesis. J. Intern. Med. 2013, 273 (2), 114−127. (36) Ali, I.; Chouhan, V. S.; Dangi, S. S.; Gupta, M.; Tandiya, U.; Hyder, I.; Yadav, V. P.; Panda, R. P.; Babitha, V.; Nagar, V.; et al. Expression and Localization of Locally Produced Growth Factors Regulating Lymphangiogenesis during Different Stages of the Estrous Cycle in Corpus Luteum of Buffalo (Bubalus Bubalis). Theriogenology 2014, 81 (3), 428−436. (37) Lamalice, L.; Le Boeuf, F.; Huot, J. Endothelial Cell Migration During Angiogenesis. Circ. Res. 2007, 100 (6), 782−794. (38) Mazzuoli, G. F.; Passeri, M.; Gennari, C.; Minisola, S.; Antonelli, R.; Valtorta, C.; Palummeri, E.; Cervellin, G. F.; Gonnelli, S.; Francini, G. Effects of Salmon Calcitonin in Postmenopausal Osteoporosis: A Controlled Double-Blind Clinical Study. Calcif. Tissue Int. 1986, 38 (1), 3−8.

M


PDF (9 MB) - American Chemical Society

Recommend Documents