Research Article www.acsami.org
Cite This: ACS Appl. Mater. Interfaces 2019, 11, 23870−23879
Peptide and Aptamer Decorated Delivery System for Targeting Delivery of Cas9/sgRNA Plasmid To Mediate Antitumor Genome Editing Bo-Ya Liu, Xiao-Yan He, Chang Xu, Xiao-He Ren, Ren-Xi Zhuo, and Si-Xue Cheng* Key Laboratory of Biomedical Polymers of Ministry of Education, Department of Chemistry, Wuhan University, Wuhan 430072, People’s Republic of China Downloaded via IDAHO STATE UNIV on July 17, 2019 at 06:54:40 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
S Supporting Information *
ABSTRACT: A multiple-functionalized targeting delivery system was prepared by self-assembly for efficient delivery of Cas9/sgRNA plasmids to targeted tumor cell nuclei. The Cas9/sgRNA plasmids were compacted by protamine in the presence of calcium ions to form nanosized cores, which were further decorated by peptide and aptamer conjugated alginate derivatives. With the help of the nuclear location signal peptide and AS1411 aptamer with specific affinity for nucleolin in the tumor cell membrane and nuclei, the delivery vector can specifically deliver the plasmid to the nuclei of tumorous cells for knocking out the protein tyrosine kinase 2 (PTK2) gene to down-regulate focal adhesion kinase (FAK). The tumor cell apoptosis induced by genome editing is mitochondrial-dependent. In addition, FAK knockout results in negative regulation on the PI3K/AKT signaling pathway. Meanwhile, favorable modulation on various proteins involved in tumor progression can be realized by genome editing. The enhanced E-cadherin and decreased MMPs, vimentin, and VEGF imply the desirable effects of genome editing on suppression of tumor development. Wound healing and transwell assays confirm that the genome editing system can suppress tumor invasion and metastasis in edited cells efficiently. The investigation provides a facile and effective strategy to fabricate multiple-functionalized delivery vectors for genome editing. KEYWORDS: gene delivery systems, genome editing, self-assembly, functional polymers, tumor targeting
■
INTRODUCTION Through precisely editing gene sequences encoding particular proteins, genome editing technology provides promising solutions to various diseases. As a raising genome editing technology, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated 9 (Cas9) technology can realize genome editing in diverse cell types and organisms.1,2 Due to its high specificity and simplicity, CRISPR/Cas9 has been adopted as a powerful tool in many fields ranging from basic research to biomedical applications.3−7 As we know, the efficient delivery of the CRISPR-based genome editing systems is still a barrier to block their extensive applications.8 The majority of gene vectors for genome editing systems are viral vectors.9−11 However, viral vectors suffer from shortcomings including unsatisfactory safety performance and difficulty in scale-up production.1,12 Nonviral vectors, such as lipids, polymers, and hybrid materials, possess a higher safety than viral vectors and could deliver diverse cargos including Cas9/sgRNA plasmids, Cas9 protein/sgRNA complexes, and Cas9 mRNA/sgRNA complexes into cells.13−23 However, nonviral vectors still suffer from their relatively low delivery efficiency,8,24 which limits in vivo applications. © 2019 American Chemical Society
Among the diverse CRISPR-based genome editing systems, Cas9/sgRNA plasmids (plasmid-based CRISPR-Cas9 systems) combining the targeting sgRNA with the gene encoding Cas9 protein exhibit greater stability than other systems containing Cas9 protein or Cas9 mRNA24 and enjoy more convenience in practical genome editing applications. So far, the gene vectors reported for Cas9/sgRNA plasmids include biomacromolecules, polymers, lipids, and hybrids.14,19−23 Compared with extensively investigated delivery vectors for other therapeutic nucleic acids, the functional vectors for Cas9/sgRNA plasmids are still rare. In the current research, we constructed a multiple-functionalized gene delivery vector to achieve efficient genome editing in targeted cancer cells. In the delivery system, the core composed of plasmid/protamine/CaCO3 was produced by complexation of the Cas9/sgRNA plasmid with protamine (PS) in the presence of calcium cations and carbonate anions. Protamine, a natural cationic protein, has membrane translocating and nuclear-localizing activities. Besides, the presence Received: April 2, 2019 Accepted: June 19, 2019 Published: June 19, 2019 23870
DOI: 10.1021/acsami.9b05772 ACS Appl. Mater. Interfaces 2019, 11, 23870−23879
Research Article
ACS Applied Materials & Interfaces of protamine can enhance the plasmid loading capability via electrostatic interaction with the negatively charged plasmid. To realize tumor specific delivery with enhanced delivery efficiency, the core was decorated by nuclear location sequence (NLS) peptide conjugated alginate (Nalg) and AS1411 aptamer conjugated alginate (Aalg) through self-assembly based on electrostatic interactions. The NLS peptide with a sequence of CPKKKRKV can enhance the nuclear transport via the classical nuclear import pathway mediated by importin α/β.25,26 AS1411, a 26-nucleotide DNA aptamer, can specifically interact with nucleolin, which is abundantly expressed on cell membranes and nuclei of diverse cancer cells.22,23,27,28 In addition, the nanoparticles were constructed by the components (alginate and protamine) with good biocompatibility and biodegradability. Calcium and carbonate ions as physiologically presented ions also have ideal biocompatibility. To knock out protein tyrosine kinase 2 (PTK2) gene encoding focal adhesion kinase (FAK), the CRISPR/Cas9 plasmid with an sgRNA sequence of TGATAGAAGAAATTCAAAGT was constructed. FAK, also called PTK2, is involved in various cellular functions such as adhesion, migration, invasion, survival, and proliferation.29−34 FAK is overexpressed in diverse types of cancers, such as lung, hepatocellular, pancreatic, esophageal, gastric, colorectal, thyroid, breast, cervical, ovarian, and prostate cancers. With the aid of the NLS peptide and AS1411, efficient genome editing could be achieved in targeted tumor cells. The down-regulated FAK protein results in cell apoptosis via the mitochondrialdependent pathway. More importantly, the genome editing favorably regulates the expression of the proteins involved in tumor progression and prevents cancer invasion and metastasis in genome-edited cells.
■
Scheme 1. Preparation of the Peptide and Aptamer Functionalized Gene Delivery System and the Tumor Targeting Delivery of Genome Editing Plasmid
Nalg” and plasmid FAK@PS/CaCO3/Aalg/alg coded as “DSAalg”) were also produced. As shown in Figure 1 and Table S1, the size of diverse delivery systems ranges from 200 to 250 nm with PDI < 0.3. The multiple-functionalized gene delivery system (DS-ANalg) has the largest size due to the presence of the AS1411 aptamer and NLS peptide on the particle surface. TEM observation demonstrates that DS-ANalg is spherically shaped. The nanoparticles with functional components (Nalg and Aalg) possess larger sizes than their counterparts without functional components. In addition, the ζ potentials of nanoparticles range from −8 to −12 mV owing to the negative charges of alginate chains on the particle surface. Besides, DS-Nalg with the positively charged NLS peptide exhibits a higher ζ potential than DS-ANalg with negatively charged AS1411. The size and ζ potential of the delivery systems entrapped with the negative control plasmid (plasmid NC) were also measured. No notable differences in the sizes and ζ potentials between plasmid FAK loaded nanoparticles and plasmid NC loaded nanoparticles could be observed. All nanoparticles exhibit a satisfactory plasmid load efficiency (>90%). To evaluate the immunogenicity of blank delivery vectors, the immune-related cytokines including tumor necrosis factorα (TNF-α) and interleukin-6 (IL-6) secreted by RAW264.7 cells coincubated with diverse blank vectors were evaluated. The result indicates that the blank delivery vectors do not lead to obvious changes in the secretion of immune-related cytokines after the coincubation (Table S2). Cellular Uptake Study and Determination of Intracellular Plasmids. The cellular uptake of various delivery systems loaded with plasmid FAK labeled by YOYO-1 was examined by confocal laser scanning microscopy (CLSM) and flow cytometry (Figure 2). Plasmid delivery systems with functional components (Nalg and/or Aalg) show enhanced cellular uptake in cancerous HeLa cells as compared with Lipo and nonfunctional DS-alg. Among these delivery systems, multiple-functionalized DS-ANalg shows the highest delivery efficiency with the strongest fluorescence in nuclei and cytoplasm, which is attributed to the presence of both AS1411 aptamer with tumor targeting capability and NLS peptide with nuclear translocation ability. As expected, DSNalg decorated by the NLS peptide and DS-Aalg decorated by the AS1411 aptamer result in higher cellular uptakes than DS-
RESULTS AND DISCUSSION
Preparation and Characterizations of Plasmid Delivery Systems. In this investigation, both the Cas9/sgRNA plasmid with sgRNA targeting PTK2 gene encoding FAK (plasmid FAK) and the negative control plasmid without sgRNA targeting PTK2 (plasmid NC) were constructed (see Figure S1 for the detailed plasmid structures). The synthesis and characterization of the functional components in delivery vectors, namely, Aalg and Nalg, are detailed in Figures S2 and S3. As depicted in Scheme 1, a multiple-functionalized delivery system to deliver plasmid FAK was designed and fabricated. First, plasmid FAK@PS/CaCO3 as the nanosized core of the delivery system was formed by coprecipitation via electrostatic forces between the components (protamine and calcium ions) bearing positive charges and the components (plasmid FAK and carbonate ions) bearing negative charges. After that, the core was coated with NLS peptide conjugated alginate (Nalg) and AS1411 conjugated alginate (Aalg) via electrostatic-force-induced selfassembly to form the multiple-functionalized delivery system of plasmid FAK@PS/CaCO3/Aalg/Nalg (delivery system with Aalg and Nalg, coded as “DS-ANalg”). Based on our experiments, almost all Nalg and Aalg fed can be assembled into the delivery system. The content of Aalg in DS-ANalg is about 1.58 wt %, and the content of Nalg in DS-ANalg is about 1.64 wt %. For comparison, a nonfunctional delivery system (plasmid FAK@PS/CaCO3/alg) and monofunctional delivery systems (plasmid FAK@PS/CaCO3/Nalg/alg coded as “DS23871
DOI: 10.1021/acsami.9b05772 ACS Appl. Mater. Interfaces 2019, 11, 23870−23879
Research Article
ACS Applied Materials & Interfaces
Figure 1. Characterization of plasmid delivery systems. (A) Sizes and ζ potentials of diverse plasmid delivery systems. (B) Distribution of size and ζ potential of the peptide and aptamer functionalized plasmid delivery system. (C) TEM image of the peptide and aptamer functionalized plasmid delivery system. (D) Plasmid encapsulation efficiencies of diverse plasmid delivery systems.
Figure 2. Cell uptake of YOYO-1-labeled plasmid FAK in HeLa cells after coincubation with plasmid delivery systems for 4 h. (A) Confocal microscopy observation (scale bar: 50 μm). (B) Flow cytometry analysis.
Nalg and DS-ANalg lead to higher cellular uptake than other delivery systems without NLS. To further study the plasmid delivery capability of these vectors, the transfection of plasmid GFP mediated by these gene delivery systems was carried out (Figures S5 and S6). #DS-ANalg with both AS1411 and NLS moieties has the most effective GFP expression in tumorous HeLa cells. Meanwhile, #DS-Aalg and #DS-Nalg also have better performance and result in much higher expression levels in HeLa cells than #DSalg. In contrast, no apparent enhanced fluorescence intensity of GFP could be observed in noncancerous HEK 293T cells after being transfected by the delivery systems with AS1411 ligands
alg without aptamer or peptide decoration. It should be noted that, due to the presence of the positively charged peptide, DSNalg also leads to enhanced cell uptake. Our result is consistent with previous studies on the peptide (CPKKKRKV)-decorated nanoparticles. The quantitative cellular uptake determined by flow cytometry is well consistent with CLSM visualization. In addition, the intracellular concentrations of the plasmids delivered by DS-alg and DS-Aalg in noncancerous HEK 293T cells are similar due to the absence of overexpressed receptors of AS1411 in HEK 293T cells (Figure S4). Meanwhile, DS23872
DOI: 10.1021/acsami.9b05772 ACS Appl. Mater. Interfaces 2019, 11, 23870−23879
Research Article
ACS Applied Materials & Interfaces
most effective down-regulation of FAK protein, demonstrating the highest gene editing efficiency of the multiple-functionalized delivery system. As expected, the free plasmid cannot lead to FAK knockout effectively due to the difficulty of cellular internalization of the free plasmid (Figure S8). Clearly, the suppression of FAK expression is monotonically related with the plasmid delivery efficiency of vectors. Furthermore, PCR confirms the dramatically decreased mRNA of FAK (
