Peptide-Mediated Specific Immobilization of Catalytically Active

Subscriber access provided by UNIV OF CALIFORNIA SAN DIEGO LIBRARIES

Article

Peptide-mediated specific immobilization of catalytically active cytochrome P450 BM3 variant Sarah Zernia, Florian Ott, Kathrin Bellmann-Sickert, Ronny Frank, Marcus Klenner, HeinzGeorg Jahnke, Andrea Prager, Bernd Abel, Andrea A Robitzki, and Annette G. Beck-Sickinger Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.6b00074 • Publication Date (Web): 11 Mar 2016 Downloaded from http://pubs.acs.org on March 17, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Peptide-mediated specific immobilization of catalytically active cytochrome P450 BM3 variant. Sarah Zernia†, Florian Ott†, Kathrin Bellmann-Sickert†, Ronny Frank†,‡, Marcus Klenner†,‡, Heinz-Georg Jahnke†,‡, Andrea Prager§, Bernd Abel§, Andrea Robitzki†,‡, Annette G. Beck-Sickinger†,*. †

Institute of Biochemistry, Leipzig University, Brüderstraße 34, 04103 Leipzig, Germany. Centre for Biotechnology and Biomedicine, Leipzig University, Deutscher Platz 5, 04103 Leipzig, Germany. § Leibniz-Institute of Surface Modification (IOM), Permoserstraße 15, 04318 Leipzig, Germany. ‡

ABSTRACT: Cytochrome P450 BM3 (CYP102A1) from Bacillus megaterium is an interesting target for biotechnological applications, because of its vast substrate variety combined with high P450 monooxygenase activity. The low stability in vitro could be overcome by immobilization on surfaces. Here we describe a novel method for immobilization on metal surfaces by using selectively binding peptides. A P450 BM3 triple mutant (3M-P450BM3: A74G, F87V, L188Q) was purified as protein thioester and ligated to indium tin oxide or gold binding peptides (BP) named HighSP-BP and Cys-BP, respectively. The ligation products were characterized by Western Blot and tryptic digestion combined with mass spectrometry, and displayed high affinity binding on the depicted surfaces. Next, we could demonstrate by benzyloxyresorufin O-dealkylation assay (BROD assay) that the activity of immobilized ligation products is higher than for the soluble form. The study provides a new tool for selective modification and immobilization of P450 variants.

Keywords: enzyme immobilization, enzyme activity, metal binding peptides, expressed protein ligation

INTRODUCTION Enzymes gain more and more importance in chemical industry and for biotechnological applications as they can perform complex chemical reactions without high temperature, high pressure or rare and expensive catalysts1. Especially cytochrome P450 enzymes (CYP) are of great interest, because they are able to catalyze stereo- and regioselective oxidations on nonactivated hydrocarbons2. P450 BM3 serves as model CYP as it unifies properties of pro- and eukaryotic P450s. It consists of a heme dependent monooxygenase domain and an FAD/FMNcontaining reductase domain similar to eukaryotic P450 enzymes as described by Narhi and Fulco in 19873. These domains are connected by a linker sequence resulting in a single polypeptide strand of a self-sufficient enzyme of 119 kDa4. P450 BM3 is not membrane-bound but soluble like all prokaryotic P450 and hence easier to express recombinantly in E. coli and to purify5. It was found to be the fastest P450 enzyme with a kcat of about 5000 min-1 as fatty-acid monooxygenase6 for arachidonic acid as substrate 7. 1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Only few CYPs are known to be used in industrial applications so far because of their low stability, their dependency on cofactors and their low activity on industrially relevant substrates8. Some of these problems can be tackled by immobilization that leads to stabilization of the protein, easy separation of enzyme and product as well as the possibility of a long-time operation9–11. P450 BM3 has been immobilized in several ways, for example in whole-cell approaches where it is expressed on E. coli cell surfaces12. Major drawbacks of this method are low substrate uptake, product toxicity and difficult product purification13. Simple adsorption on bare electrodes has been shown for several P450 enzymes14 but this approach leads to more problems than advantages. The immobilized proteins lack correct orientation and often convert the enzyme into the inactive P420 variant because of bond weakening between thiolate and heme15. A promising method is to embed the enzyme in sol-gel matrizes16 or in surfactantfilms17. This provides immobilized enzymes, which are correctly orientated, active for several days and can be electrochemically characterized. It is also possible to directly immobilize P450 BM3 by intrinsic cysteine residues on maleimide moieties or other self-assembled monolayers on gold 18,19. The immobilization of P450 BM3 by binding peptides opens up the possibility of directed and flexible protein immobilization without embedding the protein in polymers or mutating the entire protein itself. Peptides are easy to synthesize and modify and enable the protein to bind to different surfaces. The distance between protein and surface can be varied, which is important for their orientation or to avoid denaturation by the protein-metal contact. Here we used the variant A74G, F87V, L188Q of P450 BM3 (3M-P450BM3)20, which is a combination of mutants shown to provide a good activity on several fluorescence assays based on indoles21, coumarins22 or resorufins23. This P450 BM3 triple mutant was immobilized on metal surfaces by ligation with two different peptides consisting of a specific binding sequence and a flexible linker. In our approach both 3M-P450BM3 ligation products displayed high activity on benzyloxyresorufin in solution and after immobilization on gold and indium tin oxide surfaces. RESULTS AND DISCUSSION Synthesis and Characterization of Binding Peptides. Two peptides named HighSP-binding peptide (HighSP-BP) and Cys-binding peptide (Cys-BP) were synthesized for ligation to 3MP450BM3 thioester (sequences shown in Table 1). Both peptides consist of an artificial sequence of the amino acids CKPKELPEKLPELKP that serves as unstructured linker between peptide and protein and an N-terminal cysteine for expressed protein ligation (EPL). The C-termini of both peptides possess a binding sequence for either indium tin oxide (ITO) or gold, and a biotin to easily detect peptide or ligation products with streptavidin-coupled detection reagents. Table 1. Binding peptide sequences. Dotted line: linker peptide, full line: binding peptide.

peptide sequence HighSP-BP

CKPKELPEKLPELKP[RTHRK]3RTHRK(Ahx-Ahx-Biotin)-NH2

Cys-BP

CKPKELPEKLPELKPK(Ahx-Ahx-Biotin)C-NH2 2 ACS Paragon Plus Environment

Page 2 of 17

Page 3 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


There are several interactions known between metal surfaces and amino acids. Cysteine-gold interaction, which is thought to be a covalent binding24, has been characterized thoroughly. Recently Pakiari et al. found that this interaction is more likely partially electrostatic and partially covalent25, but nonetheless this bond is very strong in contrast to other amino acid-metal interactions. HighSP-BP is a peptide consisting of the amino acid pentamer RTHRK in four replicates which is known to bind to oxidized metal surfaces through ionic interactions26 with its basic amino acids. Because of this rather unspecific interplay, HigSP-BP is able to bind to various oxidized metal surfaces like SiO2 and indium tin oxide (ITO). Solid phase peptide synthesis was performed with the orthogonal Fmoc/tBu strategy on a TGR R resin resulting in Cterminally amidated peptides. Both peptides were modified with biotin at the C-terminal lysine side chain. Identity and purity was confirmed by MALDI-ToF mass spectrometry and RP-HPLC are shown in Figure 1A-B and Table 2. Table 2. Binding peptide masses and binding affinities. Calculated and measured peptide masses. EC50 values from ELISA calculated as row means totals. HighSP-BP was tested on ITO and Cys-BP on gold surfaces. Highest values of each experiment (n = 3) were set 100 %. Difference between affinities of HighSP-BP and Cys-BP were validated as very significant (p < 0.01) according to student’s t-test.

HighSP-BP Cys-BP

calculated mass [Da]

experimental mass [m/z]

EC50 [nM]

pEC50 (SEM)

5040.95 2430.36

5041.8 2431.2

25 112

7.61 ± 0.07 6.95 ± 0.14

For analyzing the binding properties of the two binding peptides a biotin-ELISA was performed. HighSP-BP was incubated with indium tin oxide (ITO) and Cys-BP with gold surfaces, respectively, in concentrations ranging from 10-11 to 10-5 M. For detection of bound peptides the streptavidin-biotin interaction was used. Streptavidin fused to a peroxidase binds to the biotin on the peptide, which allows the quantification on the surface by a colored peroxidase substrate. Figure 1C and Table 2 demonstrates that HighSP-BP displays higher affinity to ITO than CysBP to gold in the range of one order of magnitude, which is rather surprising and could be due to the smaller contact area between one cysteine and the gold surface in contrast to twelve amino acids interacting with ITO in HighSP-BP. Thus, HigSP-BP is a promising novel peptide for immobilization on metal surfaces because of its strong binding on substrates.

3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Characterization of binding peptides. MALDI-ToF-MS spectra and RP-HPLC chromatograms of HighSP-BP (A) and Cys-BP (B). (C) Binding of HighSP-BP on ITO and Cys-BP on gold is demonstrated by biotin-ELISA. For analysis highest values of each experiment (n = 3) were set 100 %.

Purification, Ligation and Characterization of 3M-P450BM3. Isolation of pure protein after recombinant expression is of high importance in protein chemistry. Several affinity tags like Flag tag27, polyhistidine tag28 or glutathione S-transferase tag29 have been developed for affinitychromatography based purification. However, all tags remain on the purified protein and have to be cleaved by specific proteases, which have to be removed from the sample afterwards30. The intein-mediated purification via an affinity chitin-binding tag (IMPACT system) allows a onestep purification resulting in a functionalized protein thioester without any additional purification tag. Moreover, it is a rather flexible and robust method suitable for very different proteins like epidermal growth factor31, maltose binding protein32 or cre recombinase33. These proteins vary in size and function, but none of these is larger than 80 kDa. Here we present for the first time a protocol using the IMPACT system for a 119-kDa protein enlarging the properties of this purification method. 3M-P450BM3 was expressed as fusion protein with a C-terminal intein chitin-binding domain (intein-CBD) in E. coli BL21(DE3). After cell lysis, the protein was obtained in the soluble fraction. In Figure 2A the SDS-PAGE of the purification is presented. This demonstrates that after loading and washing only the pure fusion protein is present on the column, which is then cleaved between target protein and intein-CBD and eluted as pure 3MP450BM3-thioester. All washing and elution steps were performed with buffer containing FAD and FMN to preserve decoloring of the protein on the column. It is known that especially the reductase domain of P450 BM3 is unstable34, thus keeping high amounts of cofactor in all buffers prevents the cofactors from diffusing out of the protein and reducing enzyme activity. The ligation of 3M-P450BM3-thioester and the peptides was performed in equimolar concentrations at 4°C. The ligation products 3M-P450BM3-HigSP-BP and 3M-P450BM3-CysBP were efficiently characterized by Western blot (Figure 2B) demonstrating that both ligation reactions led to the expected band of about 125 kDa. The ligation reaction was finished after 1 h 4 ACS Paragon Plus Environment

Page 4 of 17

Page 5 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


at 4°C as displayed in Figure 2C. Both ligation products were characterized by CO difference spectra displaying the identity as P450 enzyme with a heme unit inside the intact monooxygenase domain (Figure 3A). The characteristic Soret peak at 450 nm appeared after saturating the heme iron with carbon monoxide (CO). The correct sequence was demonstrated by tryptic digestion and MALDI-MS (Figure 3B-C). Ligation efficiency was quantified by separating the bands of unligated and ligated variants by SDS-PAGE (Figure 2D), which demonstrated an efficiency of 70 % for the High-SP variant and 40 % for the Cys variant. This is less than the 90 % efficiency known from literature35, because partial hydrolysis of the 3M-P450BM3 thioester may have occurred. The low ligation rate of the Cys variant may be due to the presence of two cysteines in the peptide, one at the N-terminus for ligation and the other at the very C-terminus for binding to gold surfaces. Only the N-terminal cysteine can react completely, since its free N-terminus can undergo the final irreversible S-N acyl shift leading to the native peptide bond. However, as also the C-terminal cysteine can reversibly bind to the protein thioester without performing the final S-N acyl shift, it competes with the N-terminal cysteine for binding and therefore lowers the probability of it to react by 50%. Thus, we demonstrate that 3M-P450BM3 can be ligated to different peptides leading to a functional and active enzyme. The purification by the IMPACT system is a highly effective and flexible method to simply modify proteins at one terminus36,37. Even non-natural amino acids38, isotopic labels39, biotinylation40 or other agents like palmitic acid41 and UV-cleavable moieties42 can be introduced by ligation resulting in a modular protein toolbox.

Figure 2. Expression, purification and ligation of 3M-P450BM3 thioester. (A) SDS-PAGE of IMPACT purification illustrating the single steps of the protocol and a pure thioester in lane 5 (arrow). Protein standard PageRulerTM prestained, all values in kDa, staining: Naphtol Blue Black. (B-C) Western Blot against biotinylated binding peptides with 1:4000 Streptavidin-POD. (B) Successful ligation of both peptides with the 3M-P450BM3 thioester. (C) Time-dependent ligation of 3M-P450BM3 and HighSP-BP at 4°C. (D) Determination of ligation efficiency by band intensity quantification in SDS-PAGE. Difference between 7 and 8 is significant (p < 0.05) according to student’s t-test. 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Characterization of ligation products. (A) CO difference spectrum of 3M-P450BM3 thioester and the ligation products 3M-P450BM3-HighSP-BP and 3M-P450BM3-Cys-BP. (B-C) Tryptic digestion and MALDI-ToF-MS analysis demonstrate successful ligation with HighSP-BP (B) and Cys-BP (C). Underlined black fragments were identified by MALDI-MS.

Binding assay and protein quantification on metal surfaces. Binding studies by ELISA of the ligated 3M-P450BM3-HighSP-BP were performed on ITO and 3M-P450BM3-Cys-BP on gold. Both proteins bound equally well to the surfaces with higher affinities compared to binding peptides itself (Figure 4A, Table 3). This is rather surprising as the small peptides should have more space on surface and should therefore address more binding sites than the huge proteins with an additional hydration shell43. For control, a 3M-P450BM3-thioester construct was produced that carries an N-terminal Flag-tag, expressed and purified like the first construct. This Flag-3M-P450BM3 thioester without any binding peptide was investigated in a Flag-ELISA and displayed neither binding on ITO nor on gold surface, thus demonstrating the specific binding of the constructs mediated by the binding peptides. Binding of the ligation constructs on surfaces was further characterized by scanning electron microscopy, which provided a good tool for visualization of immobilized proteins besides atomic force microscopy19,44. The advantage of scanning electron microscopy is that by this method it is possible to distinguish between surface inhomogeneity and immobilized protein. The drawback is that only SiO2 is suitable in order to obtain sufficient contrast between surface and protein. In Figure 4B single spots of protein bound to the surface with strong contrast to the surroundings were observable. The spot size of about 20 nm corresponds well with the presence of a dimer of 3M-P450BM3 as described before45. Besides the visualization of protein binding, scanning electron microscopy was furthermore used for quantification. Protein quantification on surfaces is difficult because of the low protein amounts, which handicaps the application of absorption-based methods like Bradford or BCA assay46. Fluorescence-based assays would provide a lower detection limit, but the introduction of such labels often leads to changes in conformation or surface binding because of the hydrophobicity of the fluorophore47. Additionally, quenching effects can occur on conductive 6 ACS Paragon Plus Environment

Page 6 of 17

Page 7 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


surfaces like gold or ITO. An average of 80 spots per µm2 was counted on the surface for 3MP450BM3-HigSP-BP yielding in 5 fmol of protein in one well in 96-well format (38 mm2). This provides a good estimation of how much protein is present on a surface and allowed a comparison of different proteins and their activity. As silica had to be used for scanning electron microscopy, the amount of protein on ITO and gold surfaces had to be extrapolated from the ELISA. By calculating the ratio between Emax values of 3M-P450BM3-HigSP-BP on SiO2, ITO or gold the protein amount was calculated on every surface. In Figure 4A and Table 3 it is demonstrated that three to four times more protein binds to gold or ITO surfaces compared to silica, probably because these surfaces are rougher and hence in total bigger than the silica surface48. Additionally, the affinity is one order of magnitude higher on ITO and gold than on silica. As concentrations were used with saturated protein binding, this however does not play a role for quantification by scanning electron microscopy. Combining ELISA and scanning electron microscopy quantification thus provides a good alternative to other established methods for surface quantification like ToF-SIMS49 or quartz crystal balances50.

Figure 4. Binding of 3M-P450BM3-HighSP-BP and 3M-P450BM3-Cys-BP on surfaces. (A) Streptavidin-ELISA, concentration response curves were performed with 3M-P450BM3-HigSP-BP on ITO or SiO2 and 3M-P450BM3-Cys-BP on gold. Unligated protein thioester was tested with anti-FlagELISA targeting N-terminally incorporated Flag-Tag, n = 3. (B) Scanning electron microscopy of 3MP450BM3-HighSP-BP on SiO2, magnification: 150,000, scale bar: 100 nm.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 17

Table 3. Binding affinities and activity of ligation products. Corresponding EC50 values from ELISA (Figure 4A, n = 3) for surface binding calculated as row means totals. Emax was calculated from nonlinear regression. From Emax ratio between SiO2 und the other surfaces the amount of protein on surface was calculated. Turn over number (kcat) and SEM of both protein constructs in solution (n = 3) and on surface (n = 3) from BROD assay. 3M-P450BM3-HighSP-BP on ITO and SiO2, 3M-P450BM3-Cys-BP on gold.

SiO2 ITO gold

EC50 [nM] 308 4.02 7.14

pEC50 (SEM) 6.42 ± 0.14 8.38 ± 0.05 8.15 ± 0.11

Emax [a.u.] 0.145 0.591 0.494

nprotein [fmol] on surface 5.0 20.4 17.0

kcat [min-1] in solution n.a. 0.117 ± 0.10 0.024 ± 0.01

kcat [min-1] on surface n.a. 0.439 ± 0.09 0.298 ± 0.09

Activity assay in solution and on surface. As protein concentration is low on surfaces the known absorption-based activity assays for P450 enzymes like measurement of NADPH consumption or reduction of cytochrome c in solution51 are not suitable. Furthermore, these activity assays are all just addressing the reductase domain and not the monooxygenase domain. This leads to an activity calculation, which is not taking into account side reactions like H2O2 production. There are substrate-based and more sensitive fluorescence activity assays that use the production of a fluorophore by the enzyme and address the monooxygenase domain of the CYP. A major drawback is that the activity of the wild type enzyme is much too low so that mutants like 3M-P450BM3 (A74G, F87V, L188Q) have to be applied. Here we used the BROD assay, where benzyloxyresorufin is transformed to resorufin resulting in a yellow fluorescence at 580 nm52. This fluorescence is not interfering with the fluorescence of NADPH at 340 nm in contrast to the emission of 7-ethoxycoumarin and results in a much better window for protein activity determination. In this study, the turnover number of the two ligated enzyme variants in solution is very low with about 0.1 min-1 (Table 3). This is in contrast to the data of Lussenburg et al.52 who showed a kcat of 1.44 min-1 for the double mutant F87V, L188Q, but could be due to the Cterminally fused peptide, which is positioned near the NADPH binding site and therefore likely to block NADPH entering by winding around the reductase domain of 3M-P450BM3. Another possibility is that the linker peptide is disturbing the formation of dimers, which is essential for bioactivity. A similar effect was observed previously for dimerization of aldose-6-phosphate reductase53. After immobilization on surfaces, however, both 3M-P450BM3-HighSP und 3MP450BM3-Cys gain activity, which was rather surprising because of the different kinetics of immobilized and free enzyme54. One explanation could be that, the immobilized peptide is now fixed and not able to block NADPH binding site, which leads to a higher activity at all. On the different surfaces, there is no significant difference between 3M-P450BM3-HigSP-BP and 3MP450BM3-Cys-BP. In conclusion HighSP-BP was identified as a potent peptide to bind to metal surfaces without disturbing the activity of the ligated 3M-P450BM3 after immobilization on ITO.


Page 9 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CONCLUSIONS A novel method is presented to immobilize 3M-P450BM3 in a directed and effective manner by binding peptides on ITO and gold surfaces. The ligation of P450 thioester with different peptides is a simple, highly flexible and directed method to immobilize proteins on surfaces. The use of a binding peptide that can be easily exchanged, offers the possibility to immobilize one protein on several different surfaces by just ligating it to another suitable peptide. Additionally the linker peptide can be varied in all possible manners to change the protein orientation and distance to the surface. This can be interesting to stabilize the protein and prevent denaturation, which may be promoted in close proximity to the metal. It is likely that the linker peptide structure is not influencing the protein activity or integrity, because a highly flexible structure was chosen that contains four prolines, which did not disturb the protein at all after immobilization. The presented approach can be applied to enzyme arrays and biosensors based on cytochrome P450 BM3. Furthermore, there is much progress on P450 engineering in order to use its ability to conduct complex stereo- and regioselective hydroxylation on various substrates.55,56 In this case P450 immobilization would lead to a better stability and a facilitated handling. However, cofactor regeneration is still a challenge and could be overcome by co-immobilization of a glucose dehydrogenase or by applying an electric potential to the protein. The directed application of reduction equivalents to the monooxygenase is important and has to be further investigated to guide this approach to the gold standard for enzyme use in chemical industry. EXPERIMENTAL PROCEDURES Cloning of 3M-P450BM3. 3M-P450BM3 cDNA was cut out from the present pRSF1b vector and transformed to a pTXB1 vector (NEB) carrying a C-terminal intein chitin-binding domain (Intein-CBD) by using the restriction enzymes XbaI and SpeI (Thermo Scientific). Forward primer: GGCGCGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG GCTACAATTAAAGAAATGC, reverse primer: AATAATACTAGTGCATCTCCCGTGA TGCAACCCCCAGCCCACACG. The point mutations for A74G, F87V and L188Q were inserted by site-directed mutagenesis using the following codons: A74G: [gcg] to [ggg]; F87V: [ttt] to [gtt]; L188Q: [ctg] to [cag]. For the Flag-Tag construct of 3M-P450BM3-Intein-CBD the Flag-Tag was inserted by primers (forward: GGCGGCTCTAGAAATAATTTTGTTTAAC TTTAAGAAGGAGATATACATATGGATTACAAGGATGACGATGACAAGGCTACAATT AAAGAAATGCC, reverse: the same as for 3M-P450BM3) and the whole Flag-Tag-3MP450BM3 cDNA was cloned again into pTXB1 vector by using XbaI and SpeI. All mutations were verified by DNA sequencing. Expression and Purification. 3M-P450BM3-InteinCBD was overexpressed in Escherichia coli BL21(DE3). The cells were grown in LB medium at 37 °C and induced with 1 mM IPTG at OD600 (optical density at 600 nm) of 0.6. 120 µM β-aminolevulinic acid (Sigma), 50 µM FeCl3 (Fluka) and 1 µM riboflavin (Sigma) were added to the medium and the cells were grown at 37 °C for 5 h. After harvesting and resuspending in 20 mM Hepes buffer pH 8.0, the cells were lysed by FastPrep (MP Biomedicals) for 30 s at 6 m/s and ultra-centrifuged at 45000 x g for 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 17

35 min. The 3M-P450BM3 fusion protein was mostly present in the soluble fraction. For purification of the protein the intein-mediated purification with an affinity chitin-binding tag (IMPACT system, NEB) was used. After double loading the lysis on a chitin column, the column was washed with washing buffer (20 mM Hepes, 0.2 % Tween 20, 10 µM hemin, 10 µM FMN, 2 µM FAD, pH 8.0). The first cleavage was performed at room temperature for 1 h with elution buffer (20 mM Hepes, 0.2 M MesNa, 0.1 % Tween 20, 10 µM FMN, 2 µM FAD, pH 8.0), whereas the second cleavage was done at 4 °C for 20 h. After elution of the protein thioester, the sample was adjusted to pH 6.8 and concentrated via Amicon filters (MWCO 3000, Merck Millipore). The purification was analyzed with an 8% SDS-PAGE stained with naphtol blue black (Sigma). The protein thioester was stored in 20 mM Hepes, pH 7.4 at 4 °C. Solid Phase Peptide Synthesis of HighSP-BP and Cys-BP. The peptides were prepared using solid phase peptide synthesis with Fmoc/tBu strategy in 15-µmol scale on TGR R resin (Merck). Side chain protecting groups imply Boc (Lys, Trp), tBu (Glu, Tyr), Trt (His, Cys) and Pbf (Arg). To introduce the modification one Lys was protected with Dde on the side chain. The couplings were performed either manually for the first amino acid and the modifications or via robot synthesis (Syro II peptide synthesizer, MultiSynTech) for the remaining amino acids. For manual coupling Fmoc cleavage was performed two times for 10 min with 30 % piperidine in DMF. Amino acids were coupled using 5 eq. amino acid, HOBt and DIC. During robot synthesis Fmoc cleavage was performed with 40 % piperidine in DMF for 3 min and 20 % piperidine for 10 min and amino acids were coupled with 10 eq. amino acid, oxyma and DIC. Dde cleavage was performed with 2 % hydrazine in DMF. 1 ml was added to the resin and incubated for 10 min. This was repeated 10-15 times until Dde cleavage was completed. Biotin was introduced on a double Ahx spacer and was coupled using HOBt and DIC in 3 eq. Cleavage from resin was performed using a mixture of 85:5:5:5 TFA/TA/TIS/H2O and subsequent precipitation with Et2O. The purification of the peptides was achieved by preparative RP-HPLC on a Kinetex 5u XB-C18 AXIA packed column (250 mm x 21.2 mm, Phenomenex) with 0.1 % TFA/H2O (eluent A) and 0.08 % TFA/ACN (eluent B). Identity was verified by MALDI-ToF-MS (Ultraflex III, Bruker Daltonics) using SDHB matrix. The purity of the peptides was reviewed by analytical RP-HPLC on Aeris XB-C18 (250 mm x 4.6 mm, Phenomenex) and Kinetex XB-C18 (250 mm x 4.6 mm, Phenomenex) column with a linear gradient system (10-60 % of eluent B) at 40 °C. Expressed Protein Ligation. Equimolar concentrations of protein and peptide (10 to 50 µM) were used for ligation. The concentration was dependent on the yield of protein purification. The peptide, dissolved in 20 mM Hepes pH 7.4, was incubated with 20 fold excess of tris-(2carboxyethyl)phosphine (TCEP, Sigma) at 37 °C for 30 min. Protein buffer (20 mM Hepes, 10 µM FMN, 2 µM FAD, pH 7.4) was added followed by protein from stock and the mixture was incubated at 4 °C for 1 h with gentle shaking. The unligated peptide was removed with the help of Vivaspin filters (MWCO 35,000, Sartorius GmbH). The ligation products were stored in 20 mM Hepes, pH 7.4. Characterization was done by Western Blotting using 1:4000 StreptavidinPOD (Roche) in 0.1 % BSA/TBST and with the help of tryptic digestion accompanied by MALDI-ToF mass spectrometry (Ultraflex III, MALDI-ToF/ToF, Bruker Daltonics). Quantification of the ligation efficiency was performed with 10 % SDS-PAGE to separate ligated 10 ACS Paragon Plus Environment

Page 11 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and unligated samples and GeneTools software (SynGene). The total protein amount in gel was illustrated by the sum of both bands. The identity of the ligation products was verified spectroscopically. Absorption spectrum from 400 - 500 nm was recorded after reducing the protein sample with small amounts of sodium dithionite (Merck Millipore) and additional bubbling with carbon monoxide (CO) for 30 s. The difference spectrum was calculated from the difference of CO and reduced absorption curve. ITO and Gold Surface Production in 96-well Format. Borosilicate substrate (113.5 x 75 mm) was consecutively sonicated in acetone and propanol for 2 min and rinsed with ultrapure water (resistance >18 MΩ) for cleaning. Substrate was further cleaned in piranha solution (H2O2 (35 %): H2SO4 (96 %), 1:2 v/v) for 10 s, in hydrogen fluoride (68 %) for 60 s and thoroughly rinsed with ultrapure water before dried at 200 °C for 10 min. Sputtering of indium tin oxide (EVOCHEM Advanced Materials GmbH) and gold (Kurt J. Lesker Company) was executed in a CREAMET 500 (CREAVAC-Creative Vakuumbeschichtung GmbH). ITO was deposited by RF/DC sputtering with 85/350 W for 20 min resulting in a desired ITO film thickness of 500 nm. For gold deposition 50 nm ITO were predeposited as adhesion promoter. Subsequently, gold was deposited via DC sputtering at 350 W for 3 min, resulting in a desired gold thickness of 350 nm. Black 96-well polypropylene plates were purchased from Thermo Fisher (Nunc™ MicroWell™ 249945). The bottom was milled off 3 mm (CNC-Frässtation HIGH-Z, CNC-Technik). The sputtered glass substrate and prepared 96-well plate were glued together with epoxy resin (EPOTEK 302-3M, Epoxy Technology). For this purpose, the bottom site of the 96-well plate was coated with epoxy resin by imprinting, and connected with the substrate under pressure for 24 h until hardening was completed. ELISA. Protein or peptide sample was dissolved in protein buffer in a concentration ranging from 10-11 to 10-5 M and was incubated on 96-well plates covered with indium tin oxide (ITO), silica or gold for 20 h at room temperature. Then ELISA was performed as described elsewhere26. For antibodies 1:4000 Streptavidin-POD (Merck Millipore, Germany) in 1 % BSA/TBS and 1:4000 anti-Flag-POD (Abcam, United Kingdom) in 1 % BSA/TBS were used. 100 µl/well were applied for all solutions. Bare surfaces served as negative control. The data was analyzed with GraphPad Prism 5 software as row means totals and the shown EC50 represents the mean EC50 ± SEM of at least three experiments. Emax was calculated as range between minimum and maximum in absorption. Scanning Electron Microscopy and Protein Quantification. 1 µM of protein sample was incubated with SiO2 wafer (25 mm2) for 20 h at room temperature, washed afterwards with TBST and Millipore water and dried with nitrogen. Scanning electron microscopy (ULTRA 55, Carl Zeiss SMT, Oberkochen) was performed using a secondary electron detector, at an acceleration voltage of 2 kV and a magnification of 150,000. For protein quantification the spots on the microscopic images were counted in a square of 500 x 500 nm in order to calculate the amount of protein in one well of 96-well format (38 mm2). The amount of protein on ITO and gold was calculated by using the Emax ratio between SiO2 and ITO or gold respectively, which was multiplied by the protein amount on silica. 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 17

BROD Activity Assay in Solution. The reaction mixture consisting of 1 µM protein sample, 0.3 mM glucose (Sigma), 0.01 mM benzyloxyresorufin (Sigma) and 0.4 U/ml glucose dehydrogenase (GDH, Sigma) in protein buffer was pipetted in a black 96-well plate and fluorescence was measured in a microplate reader at λex = 530 nm and λem = 580 nm. The activity assay was started with adding 0.1 mM NADPH (VWR) to each well and measure fluorescence after 15, 30, 60, 90 and 120 min. Reaction solutions without protein served as negative control which was subtracted from the protein samples. Activity was calculated by using a calibration curve of resorufin resulting in the concentration of produced resorufin in nM/min that can be transformed to a turnover number in min-1 by including the protein concentration. The data was analyzed with GraphPad Prism showing means ± SEM of three independent experiments. BROD Activity Assay on Surface. 1 µM of protein sample in protein buffer was incubated in 96-well plates covered with ITO or gold for 1 h at 4 °C. After washing the surfaces with protein buffer five times the reaction solution consisting of 0.1 mM NADPH, 0.3 mM glucose, 0.01 mM benzyloxyresorufin in protein buffer was placed on the immobilized proteins in 96-well plate. After incubation for 2-4 h at room temperature with gentle shaking, the reaction solution was transferred to a black 96-well plate with 0.5 µl GDH (100 U/ml) per well to regenerate NADPH. The fluorescence was measured with a microplate reader at λex = 530 nm and λem = 580 nm. Bare surfaces without protein served as negative control that was subtracted from the protein samples. Activity was calculated by using a calibration curve of resorufin resulting in the concentration of produced resorufin in nmol/min. Turnover numbers were calculated by including the amount of protein obtained in scanning electron microscopy quantification studies. The data was analyzed with GraphPad Prism showing means ± SEM of three independent experiments. AUTHOR INFORMATION Corresponding author: * Telephone: +49 341 97-36900, Telefax: +49 341 97-36909, E-mail: [email protected] ACKNOWLEDGEMENT This project was funded by the Federal Ministry of Education and Research of Germany (project 031A181A). We gratefully thank Regina Reppich-Sacher for technical assistance in mass spectrometry and Ronny Müller for peptide synthesis. Furthermore, we thank c-LEcta GmbH, Leipzig for providing the P450 BM3 plasmid. REFERENCES (1) Loughlin, W. A. (2000) Biotransformations in organic synthesis. Bioresour. Technol. 74, 49– 62. (2) Urlacher, V. B., and Girhard, M. (2012) Cytochrome P450 monooxygenases: an update on perspectives for synthetic application. Trends Biotechnol. 30, 26–36. (3) Narhi, L. O., and Fulco, A. J. (1986) Characterization of a Catalytically Self-sufficient 119,000-Dalton Cytochrome P-450 Monooxygenase Induced by Barbituratesi n Bacillus megaterium. J. Biol. Chem. 261, 7160–7169. 12 ACS Paragon Plus Environment

Page 13 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(4) Ruettinger, R. T., Wen, L. P., and Fulco, A. J. (1989) Coding nucleotide, 5’ regulatory, and deduced amino acid sequences of P-450BM-3, a single peptide cytochrome P-450:NADPH-P450 reductase from Bacillus megaterium. J. Biol. Chem. 264, 10987–10995. (5) Li, H, Darwish, K, and Poulos, T. (1991) Characterization of recombinant Bacillus megaterium cytochrome P-450 BM-3 and its two functional domains. J. Biol. Chem. 266, 11909– 11914. (6) Boddupalli, S. S., Estabrook, R. W., and Peterson, J. A. (1990) Fatty acid monooxygenation by cytochrome P-450BM-3. J. Biol. Chem. 265, 4233–4239. (7) Noble, M. A., Miles, C. S., Chapman, S. K., Lysek, D. A., Mackay, A. C., Reid, G. A., Hanzlik, R. P., and Munro, A. W. (1999) Roles of key active-site residues in flavocytochrome P450 BM3. Biochem. J. 339, 371–379. (8) Chefson, A., and Auclair, K. (2006) Progress towards the easier use of P450 enzymes. Mol. Biosyst. 2, 462. (9) Lamb, S. B., Lamb, D. C., Kelly, S. L., and Stuckey, D. C. (1998) Cytochrome P450 immobilisation as a route to bioremediation/biocatalysis. FEBS Lett. 431, 343–346. (10) Lee, J. H., Nam, D. H., Lee, S. H., Park, J. H., Park, S. J., Lee, S. H., Park, C. B., and Jeong, K. J. (2014) New Platform for Cytochrome P450 Reaction Combining in Situ Immobilization on Biopolymer. Bioconjug. Chem. 25, 2101–2104. (11) Weber, E., Sirim, D., Schreiber, T., Thomas, B., Pleiss, J., Hunger, M., Gläser, R., and Urlacher, V. B. (2010) Immobilization of P450 BM-3 monooxygenase on mesoporous molecular sieves with different pore diameters. J. Mol. Catal. B 64, 29–37. (12) Yim, S.-K., Kim, D.-H., Jung, H.-C., Pan, J.-G., Kang, H.-S., Ahn, T., and Yun, C.-H. (2010) Surface Display of Heme- and Diflavin-Containing Cytochrome P450 BM3 in Escherichia coli: A Whole-Cell Biocatalyst for Oxidation. J. Microbiol. Biotechnol. 20, 712–717. (13) Eiben, S., Kaysser, L., Maurer, S., Kühnel, K., Urlacher, V. B., and Schmid, R. D. (2006) Preparative use of isolated CYP102 monooxygenases—A critical appraisal. J. Biotechnol. 124, 662–669. (14) Estabrook, R. W., Shet, M. S., Fisher, C. W., Jenkins, C. M., and Waterman, M. R. (1996) The Interaction of NADPH-P450 Reductase with P450: An Electrochemical Study of the Role of the Flavin Mononucleotide-Binding Domain. Arch. Biochem. Biophys. 333, 308–315. (15) Sadeghi, S. J., Fantuzzi, A., and Gilardi, G. (2011) Breakthrough in P450 bioelectrochemistry and future perspectives. Biochim. Biophys. Acta BBA - Proteins Proteomics 1814, 237–248. (16) Maurer, S. C., Schulze, H., Schmid, R. D., and Urlacher, V. (2003) Immobilisation of P450BM-3 and an NADP(+) cofactor recycling system: Towards a technical application of hemecontaining monooxygenases in fine chemical synthesis. Adv. Synth. Catal. 345, 802–810. (17) Fleming, B. D., Tian, Y., Bell, S. G., Wong, L.-L., Urlacher, V., and Hill, H. A. O. (2003) Redox properties of cytochrome P450BM3 measured by direct methods. Eur. J. Biochem. 270, 4082–4088. (18) Ferrero, V. E. V., Andolfi, L., Di Nardo, G., Sadeghi, S. J., Fantuzzi, A., Cannistraro, S., and Gilardi, G. (2008) Protein and Electrode Engineering for the Covalent Immobilization of P450 BMP on Gold. Anal. Chem. 80, 8438–8446. (19) Fantuzzi, A., Fairhead, M., and Gilardi, G. (2004) Direct Electrochemistry of Immobilized Human Cytochrome P450 2E1. J. Am. Chem. Soc. 126, 5040–5041. (20) Li, Q.-S., Ogawa, J., Schmid, R. D., and Shimizu, S. (2001) Engineering Cytochrome P450 BM-3 for Oxidation of Polycyclic Aromatic Hydrocarbons. Appl. Environ. Microbiol. 67, 5735– 5739. 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 17

(21) Li, H., Mei, L., Urlacher, V. B., and Schmid, R. D. (2008) Cytochrome P450 BM-3 Evolved by Random and Saturation Mutagenesis as an Effective Indole-Hydroxylating Catalyst. Appl. Biochem. Biotechnol. 144, 27–36. (22) Kim, K.-H., Isin, E. M., Yun, C.-H., Kim, D.-H., and Guengerich, F. (2006) Kinetic deuterium isotope effects for 7‐alkoxycoumarin O‐dealkylation reactions catalyzed by human cytochromes P450 and in liver microsomes. FEBS J. 273, 2223–2231. (23) Mayer, R. T., Netter, K. J., Heubel, F., Hahnemann, B., Buchheister, A., Mayer, G. K., and Burke, M. D. (1990) 7-alkoxyquinolines: New fluorescent substrates for cytochrome p450 monooxygenases. Biochem. Pharmacol. 40, 1645–1655. (24) Siriwardana, K., Wang, A., Vangala, K., Fitzkee, N., and Zhang, D. (2013) Probing the Effects of Cysteine Residues on Protein Adsorption onto Gold Nanoparticles Using Wild-Type and Mutated GB3 Proteins. Langmuir 29, 10990–10996. (25) Pakiari, A. H., and Jamshidi, Z. (2007) Interaction of Amino Acids with Gold and Silver Clusters. J. Phys. Chem. A 111, 4391–4396. (26) Hassert, R., Pagel, M., Ming, Z., Häupl, T., Abel, B., Braun, K., Wiessler, M., and BeckSickinger, A. G. (2012) Biocompatible Silicon Surfaces through Orthogonal Click Chemistries and a High Affinity Silicon Oxide Binding Peptide. Bioconjug. Chem. 23, 2129–2137. (27) Hopp, T. P., Prickett, K. S., Price, V. L., Libby, R. T., March, C. J., Cerretti, D. P., Urdal, D. L., and Conlon, P. J. (1988) A short polypeptide marker sequence useful for recombinant protein identification and purification. Nat. Biotechnol. 6, 1204–1210. (28) Crowe, J., Dobeli, H., Gentz, R. L., Hochuli, E., Stuber, D., and Henco, K. (1994) 6xHis-NiNTA chromatography as a superior technique in recombinant protein expression/purification. Methods Mol. Biol. Clifton NJ 31, 371–87. (29) Smith, D. B., and Johnson, K. S. (1988) Single step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferas. Gene 67, 31–40. (30) Mitchell, S. F., and Lorsch, J. R. (2015) Protein Affinity Purification using Intein/Chitin Binding Protein Tags, in Methods in Enzymology, pp 111–125. Elsevier. (31) Zhang, Y., Zhang, K., Wan, Y., Zi, J., Wang, Y., Wang, J., Wang, L., and Xue, X. (2015) A pH-induced, intein-mediated expression and purification of recombinant human epidermal growth factor in Escherichia coli. Biotechnol. Prog. 31, 758–764. (32) Wu, W.-Y., Miller, K. D., Coolbaugh, M., and Wood, D. W. (2011) Intein-mediated onestep purification of Escherichia coli secreted human antibody fragments. Protein Expr. Purif. 76, 221–228. (33) Sharma, S. S., Chong, S., and Harcum, S. W. (2006) Intein-mediated protein purification of fusion proteins expressed under high-cell density conditions in E. coli. J. Biotechnol. 125, 48–56. (34) Salazar, O., Cirino, P. C., and Arnold, F. H. (2003) Thermostabilization of a Cytochrome P450 Peroxygenase. ChemBioChem 4, 891–893. (35) Xu, M.-Q., and Evans Jr., T. C. (2001) Intein-Mediated Ligation and Cyclization of Expressed Proteins. Methods 24, 257–277. (36) David, R., Richter, M. P. O., and Beck-Sickinger, A. G. (2004) Expressed protein ligation: Method and applications. Eur. J. Biochem. 271, 663–677. (37) Baumann, L., Steinhagen, M., and Beck-Sickinger, A. G. (2013) Preparation of C-terminally Modified Chemokines by Expressed Protein Ligation, in Peptide Synthesis and Applications (Jensen, K. J., Tofteng Shelton, P., and Pedersen, S. L., Eds.), pp 103–118. Humana Press, Totowa, NJ. (38) Wang, D., and Cole, P. A. (2001) Protein Tyrosine Kinase Csk-Catalyzed Phosphorylation of Src Containing Unnatural Tyrosine Analogues. J. Am. Chem. Soc. 123, 8883–8886. 14 ACS Paragon Plus Environment

Page 15 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(39) Otomo, T., Ito, N., Kyogoku, Y., and Yamazaki, T. (1999) NMR Observation of Selected Segments in a Larger Protein: Central-Segment Isotope Labeling through Intein-Mediated Ligation. Biochemistry (Mosc.) 38, 16040–16044. (40) Richter, M. P. O., Holland-Nell, K., and Beck-Sickinger, A. G. (2004) Site specific biotinylation of the human aldo/keto reductase AKR1A1 for immobilization. Tetrahedron 60, 7507–7513. (41) Bellmann-Sickert, K., and Beck-Sickinger, A. G. (2011) Palmitoylated SDF1 α Shows Increased Resistance against Proteolytic Degradation in Liver Homogenates. ChemMedChem 6, 193–200. (42) Baumann, L., and Beck-Sickinger, A. G. (2013) Photoactivatable Chemokines - Controlling Protein Activity by Light. Angew. Chem. Int. Ed. 52, 9550–9553. (43) Zhang, L., Wang, L., Kao, Y.-T., Qiu, W., Yang, Y., Okobiah, O., and Zhong, D. (2007) Mapping hydration dynamics around a protein surface. Proc. Natl. Acad. Sci. U. S. A. 104, 18461–18466. (44) Schneider, E., and Clark, D. S. (2013) Cytochrome P450 (CYP) enzymes and the development of CYP biosensors. Biosens. Bioelectron. 39, 1–13. (45) Neeli, R., Girvan, H. M., Lawrence, A., Warren, M. J., Leys, D., Scrutton, N. S., and Munro, A. W. (2005) The dimeric form of flavocytochrome P450 BM3 is catalytically functional as a fatty acid hydroxylase. FEBS Lett. 579, 5582–5588. (46) Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85. (47) Roach, P., Shirtcliffe, N. J., Farrar, D., and Perry, C. C. (2006) Quantification of SurfaceBound Proteins by Fluorometric Assay: Comparison with Quartz Crystal Microbalance and Amido Black Assay. J. Phys. Chem. B 110, 20572–20579. (48) Kubiak, K., Adamczyk, Z., and Cieśla, M. (2016) Fibrinogen adsorption mechanisms at the gold substrate revealed by QCM-D measurements and RSA modeling. Colloids Surf. B Biointerfaces 139, 123–131. (49) Kim, Y.-P., Hong, M.-Y., Kim, J., Oh, E., Shon, H. K., Moon, D. W., Kim, H.-S., and Lee, T. G. (2007) Quantitative Analysis of Surface-Immobilized Protein by TOF-SIMS: Effects of Protein Orientation and Trehalose Additive. Anal. Chem. 79, 1377–1385. (50) Jalit, Y., Gutierrez, F. A., Dubacheva, G., Goyer, C., Coche-Guerente, L., Defrancq, E., Labbé, P., Rivas, G. A., and Rodríguez, M. C. (2013) Characterization of a modified goldplatform for the development of a label-free anti-thrombin aptasensor. Biosens. Bioelectron. 41, 424–429. (51) Guengerich, F. P., Martin, M. V., Sohl, C. D., and Cheng, Q. (2009) Measurement of cytochrome P450 and NADPH–cytochrome P450 reductase. Nat. Protoc. 4, 1245–1251. (52) Lussenburg, B. M., Babel, L. C., Vermeulen, Nico PE, and Commandeur, J. N. (2005) Evaluation of alkoxyresorufins as fluorescent substrates for cytochrome P450 BM3 and sitedirected mutants. Anal. Biochem. 341, 148–155. (53) Figueroa, C. M., and Iglesias, A. A. (2010) Aldose-6-phosphate reductase from apple leaves: Importance of the quaternary structure for enzyme activity. Biochimie 92, 81–88. (54) Steinhagen, M., Zunker, K., Nordsieck, K., and Beck-Sickinger, A. G. (2013) Large scale modification of biomolecules using immobilized sortase A from Staphylococcus aureus. Bioorg. Med. Chem. 21, 3504–3510.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(55) Roiban, G. D., Reetz, M.T. (2015) Expanding the toolbox of organic chemists: directed evolution of P450 monooxygenases as catalysts in regio- and stereoselective oxidative hydroxylation. Chem Commun (Camb). 51, 2208–2224. (56) Roiban, G. D., Agudo, R., Reetz, M.T. (2014) Cytochrome P450 catalyzed oxidative hydroxylation of achiral organic compounds with simultaneous creation of two chirality centers in a single C-H activation step. Angew Chem Int Ed Engl. 53, 8659–8663.


Page 16 of 17

Page 17 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC-Graphic:


Peptide-Mediated Specific Immobilization of Catalytically Active

Recommend Documents