Photocaged Nanoparticle Sensor for Sensitive MicroRNA Imaging in

Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE

Article

Photocaged Nanoparticle Sensor for Sensitive MicroRNA Imaging in Living Cancer Cells with Temporal Control Yi Shen, Zhi Li, Ganglin Wang, and Nan Ma ACS Sens., Just Accepted Manuscript • DOI: 10.1021/acssensors.7b00922 • Publication Date (Web): 25 Jan 2018 Downloaded from http://pubs.acs.org on January 25, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Sensors is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Photocaged Nanoparticle Sensor for Sensitive MicroRNA Imaging in Living Cancer Cells with Temporal Control Yi Shen, Zhi Li, Ganglin Wang, Nan Ma*

The Key Lab of Health Chemistry and Molecular Diagnosis of Suzhou, College of Chemistry, Chemical Engineering and Materials Science, Soochow University, Suzhou, 215123, P. R. China

Abstract Sensitive imaging of microRNA in living cells is of great value for disease diagnostics and prognostics. While signal amplification-based strategies have been developed for imaging lowabundant disease-relevant microRNA molecules, precise temporal control over sensor activity in living cells still remains a challenge, which limits their applications for sensing microRNA concentration dynamics. Herein, we report a class of photocaged nanoparticle sensors for highly-sensitive imaging of microRNA in living cells with temporal control. The sensor features a DNA-templated gold nanoparticle-quantum dot satellite nanostructure which is temporarily inactivated by a photocaged DNA mask. Upon UV light irradiation, the sensor restores its activity for catalytic sensing of microRNA in living cells via entropy-driven two-step toehold-mediated strand displacement reactions. We show that the sensor exhibits quick response to UV light, robust intracellular stability, and high specificity and sensitivity for the microRNA target. On the basis of this strategy, precise control over sensor activity is achieved using external light trigger, where on-demand sensing could be potentially performed with spatiotemporal control. Keywords: microRNA, quantum dot, sensor, photocaged, imaging, gold nanoparticle, DNA MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that act as crucial posttranscriptional regulators of gene expression.1-3 MiRNAs play major roles in different developmental processes including metabolism,4 cell proliferation,5 apoptosis,6 developmental timing7 et al. Aberrant levels of miRNA are found to be implicated in a variety human diseases such as cancer,8-10 cardiovascular disease,11 inflammatory disease,12 and Alzheimer’s disease.13 Sensitive detection of

ACS Paragon Plus Environment

ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 24

miRNA molecules in vitro and in living cells would provide a valuable means for not only fundamental research but also disease diagnostics and therapy evaluation.14-22 It has been revealed that miRNA levels are highly dynamic at different developmental stages or in response to therapy.23 Therefore, it is desirable for real-time sensing of microRNA molecules in living cells with precise temporal control. Recently our group and others have developed signal amplification-based approaches for catalytic imaging of miRNA molecules in living cells.24-28 These approaches take advantage of a DNA-based signal amplifier to detect low-abundant intracellular miRNA molecules within picomolar range. Despite these successes, catalytic sensing of miRNA in living cells with precise temporal control has not been previously demonstrated. Light represents an ideal external regulatory element because it is orthogonal to most of cellular components and could be manipulated with temporal and spatial control.29 Light has been utilized to modulate nucleic acids activities such as gene expression,30 logic gate operation,31 DNA hybridization,32 and DNAzyme activities.33 Typically, the functional nucleic acids are temporally masked and inactivated with one or more photo-labile groups, which could be cleaved upon UV light irradiation at certain time point to restore the activity of nucleic acids.34 This photochemical approach shed light on in situ analysis of biomolecules in respect to time and location. In this regard, photochemically controlled molecular beacons and DNAzymes have been developed for intracellular mRNA and metal ion sensing with temporal control.35,36 However, the sensitivity of conventional molecular beacon is limited because of one-to-one probe-target binding, which hampers their application for imaging low-abundant miRNA molecules. So far photocaged sensors for signal amplified sensing of intracellular nucleic acids still remains underdeveloped. Results and discussions Herein, we report a new class of photocaged nanoparticle sensor for catalytic molecular imaging of cancer-relevant miRNA molecules in living cells with temporal control. miRNA-21, a common oncogenic miRNA upregulated in many cancer types,37 is selected for the study. This sensor features a satellite nanostructure consisting of a gold nanoparticle (GNP) and multiple quantum dots (QDs) that are assembled through double-stranded DNA linkers (Scheme 1a). QDs possess superior optical properties such as high brightness and robust photostability, making them ideal probes for


Page 3 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Scheme 1. Schematic illustration of photocaged GQC sensor for miRNA detection. (a) DNA sequences for GNP-QDs assembly and chemical structure of the photolabile group (PC-linker). (b) Photo-activation and microRNA-catalyzed catalytic disassembly of QDs with GNP through two-step toehold-mediated DNA strand displacement reactions (SDR). (c) GQC sensor delivery and photocontrolled microRNA imaging in living cells.


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 24

bioimaging applications.38-43 Within the GNP-QDs complex (GQC) the QD photoluminescence (PL) is quenched by the nearby GNP via fluorescence resonance energy transfer (FRET). The microRNA target could specifically catalyze the disassembly of GNP and multiple QDs via two-step toeholdmediated strand displacement reactions (SDR) in the presence of fuel DNA molecules, yielding significantly amplified QD PL signals for miRNA sensing (Scheme 1b). In this design the toehold 1 is masked with a short photocaged single-stranded DNA (DNA3) containing an internal o-nitrobenzyl group as a photocleavable linker (PC-linker). Upon UV irradiation (302 nm), the PC-linker is quickly cleaved to release DNA3 from the toehold and thereby activate the nanoparticle sensor for miRNA detection. For intracellular miRNA sensing, the sensor and fuel DNA are co-delivered into cells using Lipofectamine as vectors. On-demand miRNA sensing is performed at specific time points using UV light as an external trigger (Scheme 1c).

Figure 1. Characterization of the GQC sensor. (a) Absorption and photoluminescence spectra of DNA2-QDs. (b) Absorption spectra of GNPs before and after conjugation with DNA1. (c) AGE of DNA1-GNP and GQC. (d) Low magnification and high-resolution TEM images of GQC.


Page 5 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

DNA2-QDs and GQC are prepared following previously reported protocols.24,43 The prepared monovalent DNA2-QDs have an emission peak at 631 nm and a quantum yield of 18.8% (Figure 1a and SI Figure S1). These QDs are near monodisperse with a mean diameter of 3.7 nm as revealed by transmission electron microscopy images (SI Figure S2). Conjugation of DNA1 to GNPs (mean diameter = 17.6 nm) leads to slight redshift of the absorption peak from 520 nm to 524 nm (Figure 1b and SI Figure S3). The GQC exhibits retarded mobility in agarose gel in comparison with DNA1-GNPs as a result of increased overall size (Figure 1c). The satellite nanostructures of GNP-QDs are visualized in high-resolution TEM image (Figure 1d). There are 17 QDs attached to each GNP on average as determined by ICP-AES analysis (see experimental section for more details). The GQC exhibit excellent stability under various pH (4-10), different ionic strength (0-1000 mM NaCl), and 50 U/L DNase I (SI Figure S4). Also, they do not affect cell viabilities at sensing conditions (SI Figure S5). The dependence of photocleavage reaction on UV irradiation time is investigated by native polyacrylamide gel electrophoresis (PAGE). As shown in Figure 2a, photocaged DNA3 is quickly cleaved in a few minutes, leading to majority of photocleaved fragments. 300 seconds irradiation is sufficient for photocleavage reaction with 91.7% yield (Figure 2b). The UV light has little effect on living cell morphology and cell viability after 20 minutes irradiation (SI Figure 6). We subsequently investigate the light-triggered catalytic reaction using agarose gel electrophoresis (AGE) (Figure 3). The stepwise assembly between DNA1-GNP, Linker DNA (L), DNA2, and DNA3 is confirmed by AGE (lane 1-4). In the absence of UV irradiation the fuel DNA (F) and catalyst DNA (C’) do not induce disassembly (lane 5). Upon UV irradiation apparent shift of GNP band is observed for the sample containing both F and C’ (lane 6, 9, 10), suggesting that UV light could efficiently activate the GQC sensor. In contrast, the disassembly does not proceed with only F or C’ (lane 7 and 8). A control sample lack of mask DNA3 undergoes disassembly in the presence of F and C’ without UV irradiation (lane 12). Next, we explore the dependence of catalytic disassembly of GQC on UV irradiation time. The product is centrifuged to collect the released QDs in the supernatant, and the pellet is redispersed and characterized by AGE. As shown in Figure 4a, the GNP band exhibits higher mobility with increasing irradiation time, which could be attributed to higher degree of disassembly promoted by enhanced photocleavage efficiencies. Because there are multiple QDs attached to each GNP, it is expected that the overall size of the dissembled product becomes smaller when a higher percentage of


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 24

QDs are released from each GNP. Meanwhile, QD PL intensity increases from 0 to 300 seconds irradiation. Decrease of QD PL is observed for prolonged irradiation (600 and 1200 seconds) which is likely due to partial photobleaching of QDs. Therefore, 300 seconds is selected for following miRNA sensing studies.

Figure 2. Characterization of photocleavage efficiency for photocaged DNA3 under UV irradiation (302 nm, 6 W). (a) Native PAGE of DNA3 with different UV irradiation time. (b) Fraction of photocleaved products with different UV irradiation time.

Figure 3. AGE characterization of sequential assembly of DNA1-GNP with Linker DNA (L), DNA2, and DNA3, and subsequent catalytic disassembly promoted by UV irradiation in the presence of catalyst DNA (C’) and fuel DNA (F).


Page 7 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Figure 4. Effects of UV irradiation time on sensor activity. (a) AGE characterization of disassembled products with different UV irradiation time. (b) Photoluminescence spectra of disassembled QDs with different UV irradiation time.

Next, we profiled the detection capacity of GQC sensor toward catalyst DNA (C’) under different C’/L molar ratio ranging from 0.001 to 1. GQC sensor is activated with 5 min UV irradiation in the presence of fuel DNA (1×). As shown in Figure 5a, the disassembly occurs in a C’ concentration-dependent manner. Disassembly is detectable with trace amount of C’ (0.001×) and becomes more pronounced with increasing C’/L molar ratio. The disassembled product becomes smaller when more QDs are released from each GNP, which is promoted by a higher concentration of catalyst DNA C’. Also, PL of released QDs increases with increasing C’/L molar ratio, which is in line with AGE characterization (Figure 5b). The GQC sensor is mostly responsive to low concentration ranges of C’ (between 0.001× and 0.1×) because of the catalytic turnover (Figure 5c), revealing its potential to detect low-abundant nucleic acids targets. A near-linear calibration curve is generated under C’/L molar ratio between 0 and 0.01 (Figure 5d). The limit of detection (LOD) of GQC sensor is determined to be 10.4 pM. The GQC sensor remains inactive without UV light (Figure 5e). The specificity of GQC sensor is evaluated with three catalyst DNA sequences containing one, two, and three mismatches (Figure 6a). AGE shows that all the mutation sequences (0.1×) do not induce GQC disassembly in the presence of fuel DNA and with UV irradiation (Figure 6a), which leads to little increase of QD PL intensities (Figure 6b). These results indicate that the GQC sensor possess high specificity toward miRNA-21 with single mutation discrimination capability. The effects of catalytic reaction time on detection signal generation are also investigated. Significant QD PL is detected after 0.5 hours and further enhanced with longer reaction time, where a plateau is reached after 8 hours


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 24

Figure 5. In vitro detection of catalyst DNA (C’) using photocaged GQC sensor. (a) AGE characterization of disassembled product with different C’/L molar ratios. (b) Photoluminescence spectra of released QDs with different C’/L molar ratios. (c) Detection curve of photo-activated GQC sensor for target DNA. (d) Calibration curve for photo-activated GQC sensor in the linear range. (e) Photoluminescence spectra of GQC sensor for C’ detection with or without UV irradiation.


Page 9 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Figure 6. Specificity evaluation of GQC sensor. (a) Sequences of catalyst DNA C’ and three mutation sequences (C’(mis-1), C’(mis-2), and C’(mis-3)) containing one, two, and three mismatches respectively. (The mutations are highlighted in red) (b) AGE of GQC treated with catalyst DNA C’, C’(mis-1), C’(mis-2), C’(mis-3) respectively. A sample without catalyst DNA is used as a negative control. All the samples are irradiated with UV light in the presence of fuel DNA. (c) Corresponding photoluminescence spectra of released QDs for each of the above-mentioned samples.


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 24

Figure 7. Effects of reaction time on GQC disassembly. (a) AGE characterization of GQC disassembly with different reaction time with our without UV irradiation. (b) Photoluminescence intensity of released QDs with different reaction time with our without UV irradiation.

(Figure 7). Subsequently, the GQC sensor is tested with fixed HeLa cells containing overexpressed miRNA-21. Pronounced QD PL is detected for the cells treated with GQC sensor and irradiated with UV light for 5 min whereas the same cells without UV irradiation do not exhibit detectable signals (SI Figure S7). These results suggest that the GQC sensor could be applied for in situ miRNA detection. On the basis of the above results, we applied the GQC sensor for photocontrolled miRNA-21 sensing in live HeLa cells. We explored the influence of UV irradiation on sensor activity in the cells. HEK-293 cells with minimum level of miRNA-21 expression are used as controls. The GQC sensor and fuel DNA are co-delivered into HeLa cells using Lipofectamine-2000 as vectors. As shown in Figure 8, QD PL is detected for HeLa cells transfected with GQC sensor and irradiated with UV light, confirming that the GQC sensor could be photochemically activated in living cells. The mean PL intensity of cells gradually increases with longer irradiation time as a result of enhanced sensor activities. In contrast, HEK-293 cells do not exhibit PL under the same treatment, revealing high specificity of GQC sensor with miRNA-21. Additionally, QD PL is not detected for HeLa cells without UV irradiation even after 12 hours incubation (SI Figure S8), suggesting that the GQC sensor remains intact in living cells without degradation. Conclusions Taken together, we developed a new type of photocontrolled nanoparticle sensor for catalytic sensing of low-abundant miRNA molecules in living cells with high sensitivity and specificity. The GQC sensor could be rapidly and efficiently activated with UV irradiation at desired time point, making it useful for real-time imaging of intracellular miRNA at specific stages with little perturbation to cells. Indeed, the separation between sensor delivery and sensing event is favorable because transfection is a less controllable process that can temporarily disrupt cellular functions. Another potential benefit is to transfer sensor-loaded cells to a complex environment with altered stress to study miRNA functions, where the miRNA level could be profiled with spatiotemporal resolution. Photocontrolled in vivo miRNA sensing is plausible if coupled to an upconversion modality.


Page 11 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Figure 8. Photocontrolled catalytic imaging of miRNA-21 in living cells. (a) Bright field and fluorescence images of live HeLa cells (upper panel) and HEK-293 cells (lower panel) transfected with GQC sensor/fuel DNA and irradiated with UV light for different period. (b) Mean PL intensity of HeLa and HEK-293 cells transfected with GQC sensor/fuel DNA and irradiated with UV light for different period.


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 24

Experimental Section Materials Cadmium chloride (CdCl2, 99.99%), tellurium powder (Te, 99.997%), L-glutathione (GSH, 98%), sodium borohydride (98.0%), hydrogen tetrachloroaurate trihydrate (HAuCl4·3H2O, 99.9%), 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 97.5%) were purchased from SigmaAldrich. Sodiumhydroxide (NaOH, AR), acetic acid (HAc, AR), nitric acid (HNO3, GR), hydrochloric acid (HCl, GR), N, N, N’, N’-tetramethylethylenediamine (TEMED, 98%), ammonium persulfate (APS, 98%) and boric acid (AR) were purchased from Sinopharm Chemical Reagent Co., Ltd. Dithiothreitol (DTT, 99%) and 6-mercapto-1-hexanol (MCH, 98.0%) were purchased from Aladdin. Tris(2-carboxyethyl) phosphine hydrochloride (TCEP, 98.0%) was purchased from TCI. Sodium citrate was purchased from J&K Scientific Ltd. Acrylamide/Bis solution (40% (w/v)) was purchased from Bio-Rad. Glycerol and Tris(hydroxymethyl)aminomethane (Tris) were purchased from Beijing Solarbio Science &Technology Co., Ltd. Agarose powder was purchased from Biowest. Lipofectamine-2000 was purchased from Invitrogen. Phosphate buffered saline (10× PBS) was purchased from Thermo Scientific (HyClone). HeLa cell line was purchased from China Center for Type Culture Collection (CCTCC). HEK-293 cell line was purchased from Cell Resource Center of Wuhan University. Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), and trypsin/EDTA (0.25%) were purchased from Hyclone. DNA1 and DNA3 were purchased from TAKARA Biotechnology (Dalian) Co., Ltd. Other DNA was purchased from Integrated DNA Technologies, Inc. All the DNA molecules were purified by HPLC. Water (18.2 MΩ) was purified by Milli-Q Direct-8 water purification system (Millipore). All other reagents and solvents are of analytical grade. DNA sequences (* stands for phosphorothioate linkage, // stands for photo-cleavable (PC) linker) DNA1 (thiolated): 5’-SH-AAAAAAAAAATCTCACTAACTTACGG-3’ DNA2 (ps-po DNA): 5’-G*G*G*G*G*G*G*G*G*G*G*G*G*G*AAAAAACCCTATAGCTTATCAGACT-3’ DNA3 (PC Linker): 5’-GATGTTGA//CTCGAGAC-3’ Linker DNA (L): 5’-GTCTCGAGTCAACATCAGTCTGATAAGCTATAGGGCCGTAAGTTAGTGAGA-3’ Fuel DNA (F): 5’-CTAACTTACGGCCCTATAGCTTATCAGACT-3’


Page 13 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

In vitro catalyst (miR-21) (C’): 5’-TAGCTTATCAGACTGATGTTGA-3’ (miRNA-21 catalyst (C): 5’-UAGCUUAUCAGACUGAUGUUGA-3’) FAM-DNA1: 5’-SH- AAAAAAAAAATCTCACTAACTTACGG -FAM-3’ Synthesis of DNA-functionalized CdTe QDs DNA-functionalized CdTe QDs with emission maximum at approximate 630 nm were synthesized following a previously reported protocol (Nat. Nanotechnol. 2009, 4, 121-125). Sodium hydrogen telluride (NaHTe) was freshly prepared by reacting 0.025 g sodium borohydride (NaBH4) with 0.040 g tellurium powder in 1 mL water at 60 °C for 40 minutes. CdCl2-GSH solution was made to include 1.06 mM GSH and 1.25 mM CdCl2 in water and pH was adjusted to 9.0 with 1 M NaOH solution. 1 µL freshly prepared NaHTe solution and DNA solution containing 120 nmol nucleotides were added to CdCl2-GSH solution and then heated at 100 °C for desired time. In order to remove free QDs and DNA, the DNA-functionalized CdTe QDs were purified twice with MicrosepTM Advance Centrifugal Devices (YM-30, Pall Corporation) via centrifugation at 12000 rpm for 3 min. The pellet were recovered in 200 µL water and stored at 4 °C. The concentration of CdTe QDs was calculated according to a reported method (Chem. Mater. 2003, 15, 2854-2860). The QY was calculated according to the following equation: Фx=Фst(IX/IST)(ηx/ηst)2( Ast/Ax) Where Ф is the quantum yield, I is the measured integrated emission intensity, η is the refractive index of the solvent, and A is the optical density. The subscript “st” refers to standard with known quantum yield and “x” refers to the QDs sample. Fluorescence spectra were measured under 405 nm excitation. Rhodamine 6G (QY=95% in ethanol) was chosen as the standard. Synthesis of DNA-functionalized GNPs Typically, 1 mL aqueous trisodium citrate (1%, w/v) was quickly added to a boiling aqueous solution of HAuCl4 (30 mL, 0.01%, w/v) under vigorous stirring. After several minutes, the solution color turned from pale yellow to colorless and finally to burgundy. After boiling for 30 min, the heating source was removed to allow the solution to cool to room temperature. The products were filtered through a 0.22 µm Millipore membrane filter and stored at 4 °C. The concentration of synthesized GNPs with λmax = 520 nm was calculated using an approximate extinction coefficient of 2.7×108 mol-1 cm-1 (J. Am. Chem. Soc. 2003, 125, 1643-1654).


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 24

The GNPs were functionalized with thiolated DNA according to previously reported protocol (J. Am. Chem. Soc. 2012, 134, 7266-7269). The disulfide bond of thiolated DNA was firstly reduced by TCEP (1:200 molar ratio) at room temperature for 2 hours. TCEP-treated DNA1 was mixed with 400 µL of GNPs at a molar ratio of 80:1. Subsequently, a small volume of 500 mM sodium citrate-HCl buffer (pH=3) (final concentration: 10 mM) was rapidly added to the DNA/GNPs mixture followed by vigorous stirring. After 30 min, the solution was centrifuged at 12500 rpm for 8 min to remove the free DNA in the supernatant, and the DNA1-GNPs were redispersed in 400 µL 1× PBS and stored at 4 °C. Preparation of GNP-QDs complex. 400 µL of DNA1-GNPs were treated with MCH (100 µM) at 1:2500 molar ratio for 1 hour at room temperature to remove non-specific absorption of DNA on GNPs. The resulting GNPs were purified via centrifugation at 12500 rpm for 8 min and recovered in 400 µL 1× PBS. The MCH-treated DNA1-GNPs were mixed with linker DNA L at 1:60 molar ratio in the presence of 50 mM NaCl and 2.5 mM MgCl2. The solution was incubated at 37 °C for 6 hours and then centrifuged twice at 12500 rpm for 8 min to remove free DNA. The obtained GNPs were recovered in 400 µL 1× PBS, then mixed with DNA2-QDs (1:60 molar ratio) and DNA3 (1:70 molar ratio) in the presence of 50 mM NaCl and 2.5 mM MgCl2.The solution was incubated at 37 °C for 6 hours and then slowly cooled to room temperature and left for 12 hours. The GNP-QDs complex was purified twice via centrifugation at 12500 rpm for 8 min and resuspended in 400 µL 1× PBS. Native PAGE analysis of the photocleavage reaction. DNA3 (10 µL, 1 µM) was irradiated with UV light (302 nm, 6 W) for 0, 30, 60, 90, 120, 300, 600 and 1200 s respectively, and the products were characterized by native PAGE. 0.5× TB was used as running buffer, the samples were loaded into 6.8% native polyacrylamide gel and run at 120 V constant voltage for 30 min and stained for 3 min using GelRed. Gel image was acquired with a gel imaging system (GelDoc-It 310, UVP) under 365 nm UV excitation. Band intensities were quantitated with ImageJ software to calculate the fraction of photocleavage. Optical characterization


Page 15 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Photoluminescence spectra were recorded using a fiber fluorescence spectrophotometer equipped with a 405 nm laser as excitation light source (AvaSpec-ULS2048-USB2). The integration time was set to 100 ms. Absorption spectra were recorded using a UV-Vis spectrophotometer (Agilent 8453). Determination of DNA1 number on GNP GNPs capped with FAM-labeled DNA1 were prepared and purified according to the above protocol. The resulting conjugates were treated with MCH as described above and purified. Then 100 µL FAM-DNA1-GNP (36.5 nM) was mixed with 80 µL DTT (10 mM). After shaking for 12 hours at room temperature, the sample was centrifuged at 12500 rpm for 8 min, and the supernatant was collected for fluorescence measurement using a TECAN Infinite M200 PRO plate reader (excitation wavelength = 480 nm, emission wavelength = 520 nm). A calibration curve was generated using a series of FAM-DNA1 solutions with known concentrations. Determination of DNA2 number on each QD 10 µL of DNA2-QD (0.1 µM) and DNA2-QD hybridized with Linker DNA (room temperature for 2 hours) was mixed with 2 µL of native loading buffer (6×) and loaded into 6.8% native polyacrylamide gel. 0.5× TB was used as running buffer, the gel was run at 120 V constant voltage for 30 min, and the image was acquired with a gel imaging system (GelDoc-It 310, UVP) under 365 nm UV excitation. Agarose gel electrophoresis and sample isolation 9 µL of each sample containing 40 nM GNPs was mixed with 1 µL of glycerol and then loaded onto 2% agarose gel. 1× TA buffer (Tris/acetic acid) was used as the running buffer. The gel was run at 120 V constant voltage for 50 min and the image was acquired with a digital camera. The desired bands were cut and the contents were extracted via centrifugation using a Spin-X centrifuge tube filter (0.22 µm nylon filter, Costar) at 13000 rpm for 10 min. The extracted sample was characterized by TEM. Determination of the average number of QDs on each GNP GNP-QDs complex were isolated by agarose gel electrophoresis and used for this experiments. 100 µL of DNA2-QDs and 100 µL of DNA1-GNPs with known concentrations, and 100 µL of purified GNP-QDs complex with unknown concentration were digested in 2 mL aqua regia by heating at 90 °C


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 24

for 4 hours, respectively. The digested solutions were diluted to 10 mL with H2O respectively. Quantitative analysis of gold and cadmium elements in each sample was performed on an inductively coupled plasma optical emission spectrometer (Varian 710-ES). A dilution series of hydrogen tetrachloroaurate and cadmium chloride solutions with known concentrations were made to generate standard curves. The concentrations of GNPs and QDs of the GNP-QDs complex were determined by comparing to the ICP data of DNA2-QDs and DNA1-GNPs with known concentrations. TEM characterization 20 µL of each sample was dispersed onto a 3 mm copper grid covered with a continuous carbon film and were dried at room temperature. TEM characterization was performed on a Tecnai G2 20 (FEI, United States) transmission electron microscope operated at 185 kV. HRTEM characterization was performed on a Tecnai G2 F20 (FEI, United States) transmission electron microscope operated at 200 kV. Stability of GNP-QDs complex To measure the colloidal stability under different pH, the pH of GNP-QDs solution (1× PBS, 5 nM GNPs) was adjusted to 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 respectively with 0.1 M HCl or 1 M NaOH. After incubation at 37 °C for 12 hours, the photoluminescence and absorption spectra of the samples were recorded. To measure the colloidal stability under different ionic strength, GNP-QDs solution (1× PBS, 5 nM GNPs) was mixed with 2 M NaCl and 1× PBS to reach the final NaCl concentrations of 0, 100, 250, 500, 750, and 1000 mM respectively. After incubation at 37°C for 12 hours, the photoluminescence and absorption spectra of the samples were recorded. To measure the stability against nuclease digestion, aliquots of GNP-QDs (1× PBS, 5 nM GNPs) were incubated with 50 U/L DNase I (final concentration) at 37°C for 12 hours. Control experiments were performed by treating GNP-QDs with 85 nM fuel DNA F and 85 nM target DNA C’ at 37°C for 12 hours (with or without UV). The photoluminescence and absorption spectra of the samples were recorded. Effects of UV exposure time on GNP-QDs disassembly


Page 17 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Aliquots of GNP-QDs in 1× PBS (5 nM GNPs) containing 85 nM fuel DNA F and 85 nM target DNA C’ were exposed to UV light (302 nm, 6 W) for 0, 25, 50, 75, 100, 125, 150, 300, 600 and 1200 s respectively, and then incubated at 37 °C for 8 hours. Samples were then diluted to 120 µL with 1× PBS and centrifuged once at 14000 rpm for 3 min. The photoluminescence spectra of the disassembled QDs in the supernatants were recorded. The pellets were redispersed and characterized by agarose gel electrophoresis. Catalytic disassembly of GNP-QDs complex GNP-QDs (5 nM GNPs) containing 85 nM fuel DNA F and different concentrations of target DNA C’ (85, 42.5, 17, 8.5, 1.7, 0.85, 0.34, 0.17, 0.085 and 0 nM, respectively) were exposed to UV light (302 nm, 6 W) for 300 s and then incubated at 37 °C for 8 hours. Samples were diluted to 120 µL with 1× PBS and centrifuged once at 14000 rpm for 3 min. The photoluminescence spectra of the disassembled QDs in the supernatants were recorded. The pellets were redispersed and characterized by agarose gel electrophoresis. Specificity test of GNP-QDs complex Aliquots of GNP-QDs in 1× PBS (5 nM GNPs) containing 85 nM fuel DNA F and 8.5 nM DNA catalyst (C’, C’(mis-1), C’(mis-2), and C’(mis-3)) were exposed to UV light (302 nm, 6 W) for 300 s and then incubated at 37 °C for 8 hours. The control sample without DNA catalyst was incubated under the same experimental conditions. Samples were then diluted to 120 µL with 1× PBS and centrifuged once at 14000 rpm for 3 min. The photoluminescence spectra of the disassembled QDs in the supernatants were recorded. The pellets were redispersed and characterized by agarose gel electrophoresis. Cell Culture HeLa cells and HEK-293 cells were cultured on 25 cm2 cell culture plates with vent caps (Corning) in DMEM supplemented with 10% fetal bovine serum and 1% antibiotics penicillin/streptomycin (100 U/mL). All the cells were grown in a humidified incubator at 37 °C containing CO2 (5%). Cells that had been grown to subconfluence were dissociated from the surface with a solution of 0.25% trypsin/EDTA. Then aliquots of cells were seeded into 48-well plate


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 24

(Corning) or 8-well chamber slide (Lab-Tek) and grown for required duration in FBS-containing cell medium before experiments. Cell viability measurements 1 × 104 HeLa cells were seeded into wells of a 96-well plate (Costar) and were incubated with various concentrations of DNA2-QDs in 100 µL of DMEM in a humidified incubator at 37 °C containing CO2 (5%). To explore the effects of UV irradiation on cell viability, the cells were exposed to UV light (302 nm, 6 W) for 0, 120, 300, 600 and 1200 s respectively and then placed at 37 °C for 2 hours. Cell images were captured on an Olympus IX 71 inverted fluorescence microscope with a 20× objective. Subsequently 20 µL of 5 mg/L MTT was added to each well and incubated for 4 hours. The solution was removed and 100 µL of DMSO was added to each well and the absorbance at 490 nm was measured using a TECAN Infinite M200 PRO plate reader. To study the cell viability under sensing conditions, a 100 µL mixture containing 0.3 µL Lipofectamine-2000, 0.5 µL fuel DNA (20 µM), and GNP−QDs (5 nM GNPs) in DMEM was added into each well and the cells were incubated at 37 °C for 6 hour and washed with 1× PBS. Then the cells were irradiated by UV light (302 nm, 6 W) for 300 s and incubated at 37 °C in a humidified incubator for 8 hours. The cells incubated with GNP−QDs and Lipofectamine-2000 in the absence of fuel DNA or UV irradiation were used as controls. Cells treated with DMEM alone and Triton X-100 were used as low- and high-cell death controls, respectively. Subsequently 20 µL of 5 mg/L MTT was added to each well and incubated for 4 hours. The solution was removed and 100 µL of DMSO was added to each well and the absorbance at 490 nm was measured using a TECAN Infinite M200 PRO plate reader. Fluorescence imaging of fixed cells with or without UV treatment 200 µL of HeLa cells (2×104 cells per well) were seeded into a 48-well plate (Corning). After incubation for 24 hours, the cells were washed once with 1× PBS and incubated with 200 µL of methanol for 30 min. Then the cells were washed once with 1× PBS. A 200 µL mixture containing 1 µL fuel DNA (20 µM) and GNP-QDs (5 nM GNPs) in DMEM was added into each well. The cells were incubated at 37 °C for 6 hours and washed with 1× PBS. Subsequently the cells were irradiated with UV light (302 nm, 6 W) for 300 s and incubated at 37 °C in a humidified incubator for 8 hours. Cells without UV treatment were used as controls. After washed twice with 1× PBS, the fluorescence images of the cells were captured on an Olympus IX 71 inverted fluorescence microscope with a 20×


Page 19 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

objective. QDs were excited with 330–385 nm mercury lamp and the emission signal was collected with a 420 nm long-pass filter. Fluorescence imaging of living cells with or without UV treatment 200 µL of HeLa or HEK-293 cells (2×104 cells per well) were seeded into a 48-well plate (Corning). After incubation for 24 hours, the cells were washed once with 1× PBS. To explore the effects of UV irradiation time on sensor activity, a 200 µL mixture containing 0.6 µL Lipofectamine2000, 1 µL fuel DNA (20 µM), and GNP-QDs (5 nM GNPs) in DMEM was added into each well, the cells were incubated at 37 °C for 6 hour and washed with 1× PBS. Then the cells were irradiated with UV light (302 nm, 6 W) for 0, 30, 60, 120, 300 and 600 s respectively and incubated at 37 °C in a humidified incubator for 8 hours. HEK-293 cells under the same treatments were used as controls. After washed twice with 1× PBS, the fluorescence images of the cells were captured on an Olympus IX 71 inverted fluorescence microscope with a 20× objective. QDs were excited with 330–385 nm mercury lamp and the emission signal was collected with a 420 nm long-pass filter. To explore the effects of catalytic reaction time on emission intensity, a 200 µL mixture containing 0.6 µL Lipofectamine-2000, 1 µL fuel DNA (20 µM), and GNP-QDs nanoassembly (5 nM GNPs) in DMEM was added into each well, the cells were incubated at 37 °C for 6 hour and washed with 1× PBS. Then the cells were irradiated with UV light (302 nm, 6 W) for 300 s and incubated at 37 °C in a humidified incubator for 0.5, 2, 4, 8 and 12 h respectively. Cells without UV treatment were used as controls. After washed twice with 1× PBS, the fluorescence images of HeLa cells were captured on an Olympus IX 71 inverted fluorescence microscope with a 20× objective. QDs were excited with 330–385 nm mercury lamp and the emission signal was collected with a 420 nm long-pass filter.

ASSOCIATED CONTENT Supporting Information. Native PAGE of DNA2-QD (Figure S1); TEM image of DNA2-QD (Figure S2); TEM image of DNA1-GNP (Figure S3); Stability of GQC (Figure S4); Cytotoxicity of GQC (Figure S5); Cytotoxicity of UV irradiation (Figure S6); miRNA imaging in fixed HeLa cells (Figure S7); Dependence of reaction time on miRNA imaging (Figure S8). AUTHOR INFORMATION


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 24

Corresponding Author *E-mail: [email protected] ACKNOWLEDGMENT This work was supported in part by the NSFC (21475093, 21522506), the National High-Tech R&D Program (2014AA020518), 1000-Young Talents Plan, PAPD, and startup funds from Soochow University. References 1.

Lin, H.; Hannon, G. J., Micro RNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet. 2004, 5, 522-531.

2.

Ambros, V., The functions of animal microRNAs. Nature 2004, 431, 350-355.

3.

Lim, L. P.; Lau, N. C.; Garrettengele, P.; Grimson, A.; Schelter, J. M.; Castle, J.; Bartel, D. P.; Linsley, P. S.; Johnson, J. M., Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 2005, 433, 769-773.

4.

Rottiers, V.; Näär, A. M., MicroRNAs in Metabolism and Metabolic Diseases. Nat. Rev. Mol. Cell Biol. 2012, 13, 239-250.

5.

Hwang, H. W.; Mendell, J. T., MicroRNAs in cell proliferation, cell death, and tumorigenesis. Br. J. Cancer 2006, 94, 776-780.

6.

Su, Z.; Yang, Z.; Xu, Y.; Chen, Y.; Yu, Q., MicroRNAs in apoptosis, autophagy and necroptosis. Oncotarget. 2015, 6, 8474-8490.

7.

Ambros, V., MicroRNAs and developmental timing. Curr. Opin. Genet. Dev. 2011, 21, 511-517.

8.

Esquelakerscher, A.; Slack, F. J., Oncomirs-microRNAs with a role in cancer. Nat. Rev. Cancer 2006, 6, 259-269.

9.

Calin, G. A.; Croce, C. M., MicroRNA signatures in human cancers. Nat. Rev. Cancer 2006, 6, 857-866.

10. Bartels, C. L.; Tsongalis, G. J., MicroRNAs: novel biomarkers for human cancer. Clin. Chem. 2009, 55, 623-631. 11. Ono, K.; Kuwabara, Y.; Han, J., MicroRNAs and cardiovascular diseases. FEBS J. 2011, 278, 1619-1633. 12. O'Connell, R. M.; Rao, D. S.; Chaudhuri, A. A.; Baltimore, D., Physiological and pathological roles for microRNAs in the immune system. Nat. Rev. Immunol. 2010, 10, 111-122.


Page 21 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

13. Femminella, G. D.; Ferrara, N.; Rengo, G., The emerging role of microRNAs in Alzheimer's disease. Front. Physiol. 2015, 6, 40. 14. Dong, H.; Lei, J.; Ding, L.; Wen, Y.; Ju, H.; Zhang, X., MicroRNA: function, detection, and bioanalysis. Chem. Rev. 2013, 113, 6207-6233. 15. Deng, R.; Zhang, K.; Li, J., Isothermal Amplification for MicroRNA Detection: From the Test Tube to the Cell. Acc. Chem. Res. 2017, 50, 1059-1068. 16. Tavallaie, R.; De Almeida, S. R.; Gooding, J. J., Toward biosensors for the detection of circulating microRNA as a cancer biomarker: an overview of the challenges and successes. Wiley Interdiscip. Rev.: Nanomed. Nanobiotechnol. 2015, 7, 580-592. 17. Zhang, Y.; Zhang, C., Sensitive detection of microRNA with isothermal amplification and a single-quantum-dot-based nanosensor. Anal. Chem. 2012, 84, 224-231. 18. Jia, H.; Li, Z.; Liu, C.; Cheng, Y., Ultrasensitive detection of microRNAs by exponential isothermal amplification. Angew. Chem. Int. Ed. 2010, 49, 5498-5501. 19. Yang, H.; Hui, A.; Pampalakis, G.; Soleymani, L.; Liu, F.; Sargent, E. H.; Kelley, S. O., Direct, Electronic MicroRNA Detection for the Rapid Determination of Differential Expression Profiles. Angew. Chem. Int. Ed. 2009, 48, 8461-8464. 20. Ge, Z.; Lin, M.; Wang, P.; Pei, H.; Yan, J.; Shi, J.; Huang, Q.; He, D.; Fan, C.; Zuo, X., Hybridization chain reaction amplification of microRNA detection with a tetrahedral DNA nanostructure-based electrochemical biosensor. Anal. Chem. 2014, 86, 2124-2130. 21. Ma, F.; Liu, W.-J., Zhang, Q.; Zhang, C.-Y. Sensitive detection of microRNAs by duplex specific nuclease-assisted target recycling and pyrene excimer switching. Chem. Commun. 2017, 53, 10596-10599. 22. Xu, Q.; Ma, F.; Hang, S.-Q., Tang, B.; Zhang, C.-Y. Nucleic Acid Amplification-Free Bioluminescent Detection of MicroRNAs with High Sensitivity and Accuracy Based on Controlled Target Degradation. Anal. Chem. 2017, 89, 7077-7083. 23. Neilson, J. R.; Zheng, G. X. Y.; Burge, C. B.; Sharp, P. A., Dynamic regulation of miRNA expression in ordered stages of cellular development. Genes Dev. 2007, 21, 578-589. 24. He, X.; Zeng, T.; Li, Z.; Wang, G.; Ma, N., Catalytic Molecular Imaging of MicroRNA in Living Cells by DNA‐Programmed Nanoparticle Disassembly. Angew. Chem. Int. Ed. 2016, 55, 30733076. 25. Peng, H.; Li, X.-F.; Zhang, H.; Le, X. C. A microRNA-initiated DNAzyme motor operating in


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 24

living cells. Nat. Commun. 2017, 8, 14378. 26. Wu, Y.; Huang, J.; Yang, X.; Yang, Y.; Quan, K.; Xie, N.; Li, J.; Ma, C.; Wang, K., Gold Nanoparticle Loaded Split-DNAzyme-Probe for Amplified miRNA Detection in Living Cells. Anal. Chem. 2017, 89, 8377–8383. 27. Li, D.; Zhou, W.; Yuan, R.; Xiang, Y., A DNA-Fueled and Catalytic Molecule Machine Lights Up Trace Under-Expressed MicroRNAs in Living Cells. Anal. Chem. 2017, 89, 9934-9940. 28. Liang, C.; Ma, P.; Liu, H.; Guo, X.; Yin, B.; Ye, B., Rational Engineering of a Dynamic, EntropyDriven DNA Nanomachine for Intracellular MicroRNA Imaging. Angew. Chem. Int. Ed. 2017, 56, 9077-9081. 29. Mayer, G.; Heckel, A., Biologically Active Molecules with a “Light Switch”. Angew. Chem. Int. Ed. 2006, 45, 4900-4921. 30. Jain, P. K.; Shah, S.; Friedman, S. H., Patterning of gene expression using new photolabile groups applied to light activated RNAi. J. Am. Chem. Soc. 2011, 133, 440-446. 31. Prokup, A.; Hemphill, J.; Deiters, A., DNA computation: a photochemically controlled AND gate. J. Am. Chem. Soc. 2012, 134, 3810–3815. 32. Yan, Y.; Samai, S.; Bischoff, K. L.; Zhang, J.; Ginger, D. S., Photocontrolled DNA Hybridization Stringency with Fluorescence Detection in Heterogeneous Assays. ACS Sens. 2016, 1, 566–571. 33. Ting, R.; Lermer, L.; Perrin, D. M., Triggering DNAzymes with light: a photoactive C8 thioetherlinked adenosine. J. Am. Chem. Soc. 2004, 126, 12720–12721. 34. Liu, Q.; Deiters, A., Optochemical control of deoxyoligonucleotide function via a nucleobasecaging approach. Acc. Chem. Res. 2014, 47, 45-55. 35. Qiu, L.; Wu, C.; You, M.; Han, D.; Chen, T.; Zhu, G.; Jiang, J.; Yu, R.; Tan, W., A Targeted, Selfdelivered and Photocontrolled Molecular Beacon for mRNA Detection in Living Cells. J. Am. Chem. Soc. 2013, 135, 12952-12955. 36. Hwang, K.; Wu, P.; Kim, T.; Lei, L.; Tian, S.; Wang, Y.; Lu, Y., Photocaged DNAzymes as a general method for sensing metal ions in living cells. Angew. Chem. Int. Ed. 2014, 53, 1379813802. 37. Zhu, S.; Wu, H.; Wu, F.; Nie, D.; Sheng, S.; Mo, Y., MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008, 18, 350-359. 38. Michalet, X.; Pinaud, F. F.; Bentolila, L. A.; Tsay, J. M.; Doose, S.; Li, J. J.; Sundaresan, G.; Wu, A. M.; Gambhir, S. S.; Weiss, S., Quantum Dots for Live Cells, In Vivo Imaging, and diagnostics.


Page 23 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Sensors

Science 2005, 307, 538-544. 39. Zhou, J.; Yang, Y.; Zhang, C., Toward Biocompatible Semiconductor Quantum Dots: From Biosynthesis and Bioconjugation to Biomedical Application. Chem. Rev. 2015, 115, 11669-11717. 40. Hildebrandt, N.; Spillmann, C. M.; Algar, W. R.; Pons, T.; Stewart, M. H.; Oh, E.; Susumu, K.; Díaz, S. A.; Delehanty, J. B.; Medintz, I. L., Energy Transfer with Semiconductor Quantum Dot Bioconjugates: A Versatile Platform for Biosensing, Energy Harvesting, and Other Developing Applications. Chem. Rev. 2017, 117, 536-711. 41. Zhang, L.; Jean, S. R.; Ahmed, S.; Aldridge, P. M.; Li, X.; Fan, F.; Sargent, E. H.; Kelley, S. O., Multifunctional quantum dot DNA hydrogels. Nat. Commun. 2017, 8, 381. 42. Li, Z.; He, X.; Luo, X.; Wang, L.; Ma, N., DNA-Programmed Quantum Dot Polymerization for Ultrasensitive Molecular Imaging of Cancer Cells. Anal. Chem. 2016, 88, 9355-9358. 43. Ma, N.; Sargent, E. H.; Kelley, S. O., One-step DNA-programmed growth of luminescent and biofunctionalized nanocrystals. Nat. Nanotechnol. 2009, 4, 121-125.


ACS Sensors 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

TOC Figure


Page 24 of 24

Photocaged Nanoparticle Sensor for Sensitive MicroRNA Imaging in

Recommend Documents