Poly(vinyl alcohol) - American

Research Article www.acsami.org

Chitosan-Intercalated Montmorillonite/Poly(vinyl alcohol) Nanofibers as a Platform to Guide Neuronlike Differentiation of Human Dental Pulp Stem Cells Hatef Ghasemi Hamidabadi,†,‡ Zahra Rezvani,∥ Maryam Nazm Bojnordi,†,§ Haji Shirinzadeh,• Alexander M. Seifalian,⊥ Mohammad Taghi Joghataei,# Mojgan Razaghpour,∇ Abbas Alibakhshi,◆ Abolfazl Yazdanpanah,+ Maryam Salimi,¶ Masoud Mozafari,*,∥,#,⊗ Aleksandra M. Urbanska,□ Rui. L. Reis,▲ Subhas C. Kundu,▲ and Mazaher Gholipourmalekabadi*,#,⊗,◆ †

Department of Anatomy & Cell Biology, Faculty of Medicine, ‡Immunogenetic Research Center, Department of Anatomy & Cell Biology, Faculty of Medicine, §Molecular and Cell Biology Research Center, Department of Anatomy & Cell Biology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran ∥ Bioengineering Research Group, Nanotechnology and Advanced Materials Department, Materials and Energy Research Center (MERC), P.O. Box 14155-4777, Tehran, Iran • Semiconductor Department, Materials and Energy Research Center (MERC), P.O. Box 14155-4777, Tehran, Iran ⊥ Nanotechnology and Regenerative Medicine Commercialisation centre (Ltd) The London BioScience Innovation Centre, London, NW1 0NH, United Kingdom # Cellular and Molecular Research Center, Iran University of Medical Sciences (IUMS), Tehran, Iran ∇ Amirkabir University of Technology, Textile Department, No. 424, Tehran, Iran ◆ Biotechnology Department, School of Advanced Technologies in Medicine, and ¶Department of Biology and Anatomical Sciences, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran + Biomaterials Group, Faculty of Biomedical Engineering (Center of Excellence), Amirkabir University of Technology, P.O. Box 15875-4413, Tehran, Iran ⊗ Department of Tissue Engineering & Regenerative Medicine, Faculty of Advanced Technologies in Medicine, Iran University of Medical Sciences, Tehran, Iran □ Division of Digestive and Liver Disease, Department of Medicine and Herbert Irving Comprehensive Cancer Center, Columbia University, New York, New York 10032, United States ▲ 3Bs Research Group, Headquarters of the European Institute of Excellence on Tissue Engineering and Regenerative Medicine, University of Minho, AvePark 4805-017 Barco, Guimaraes, Portugal ABSTRACT: In this study, we present a novel chitosanintercalated montmorillonite/poly(vinyl alcohol) (OMMT/PVA) nanofibrous mesh as a microenvironment for guiding differentiation of human dental pulp stem cells (hDPSCs) toward neuronlike cells. The OMMT was prepared through ion exchange reaction between the montmorillonite (MMT) and chitosan. The PVA solutions containing various concentrations of OMMT were electrospun to form 3D OMMT-PVA nanofibrous meshes. The biomechanical and biological characteristics of the nanofibrous meshes were evaluated by ATR-FTIR, XRD, SEM, MTT, and LDH specific activity, contact angle, and DAPI staining. They were carried out for mechanical properties, overall viability, and toxicity of the cells. The hDPSCs were seeded on the prepared scaffolds and induced with neuronal specific differentiation media at two differentiation stages (2 days at preinduction stage and 6 days at induction stage). The neural differentiation of the cells cultured on the meshes was evaluated by determining the expression of Oct-4, Nestin, NF-M, NF-H, MAP2, and βIII-tubulin in the cells after preinduction, at induction stages by real-time PCR (RT-PCR) and immunostaining. All the synthesized nanofibers exhibited a homogeneous morphology with a favorable mechanical behavior. continued...

Received: November 8, 2016 Accepted: January 24, 2017 Published: January 24, 2017 © 2017 American Chemical Society

11392

DOI: 10.1021/acsami.6b14283 ACS Appl. Mater. Interfaces 2017, 9, 11392−11404

Research Article

ACS Applied Materials & Interfaces

The population of the cells differentiated into neuronlike cells in all the experimental groups was significantly higher than that in control group. The expression level of the neuronal specific markers in the cells cultured on 5% OMMT/PVA meshes was significantly higher than the other groups. This study demonstrates the feasibility of the OMMT/PVA artificial nerve graft cultured with hDPSCs for regeneration of damaged neural tissues. These fabricated matrices may have a potential in neural tissue engineering applications. KEYWORDS: nanofibrous scaffolds, human dental pulp stem cells, neuron differentiation, neurodegenerative disorders, chitosan, poly(vinyl alcohol), montmorillonite, chitosan-intercalated montmorillonite

1. INTRODUCTION Neurodegenerative disorders such as Huntington’s disease (HD), multiple sclerosis (MS), Alzheimer’s disease (AD), Parkinson’s disease (PD), and amyotrophic lateral sclerosis (ALS) comprise a significant heterogeneous range of diseases. They affect the nervous system and cause severe neural deficits primarily of the neurons. This often occurs as a result of progressive dysfunction of cells in the central or peripheral nervous system.1−3 Due to a very limited capacity for selfrepairing and lack of regeneration of mature nerve cells, there is a great enthusiasm toward employing adequate therapy strategies for the treatment of neurological disorders.2 The available clinical approaches are limited to palliative therapies for neurodegenerative disorders, which do not restrain disease progression or halt underlying pathology. They only allow improvement of patients’ conditions for a limited time period.4 The most common therapies include the use of chemical drugs including herbal substances such as polyphenolic compounds that exhibit various mechanisms of action on cellular and molecular levels.5 Many efforts are being made for treatment of neurodegenerative diseases using curative stem cell therapies.3,6−9 In almost all cell therapy approaches, the damaged and lost cells are replaced with healthy ones, and the transplanted cells usually exhibit a low degree of differentiation into target cells.10 Furthermore, the risks of rejection and postimplantation infections remain two major problems in current neurodegenerative disease therapies.11 Stem cell therapy is a promising treatment strategy in combination with optimal and advanced scaffolds, which serve as a suitable microenvironment for guided differentiation of neurons to restore damaged neural tissue. Therefore, finding a suitable source of stem cells and finding appropriate biological substitutes for fabrication of the scaffolds are two crucial steps in tissue engineering, especially in neural tissue repair and neuronal differentiation.11,12 The reports show that both adipose-tissue mesenchymal stem cells and bone marrow stem cells have low transdifferentiating efficacy. Therefore, they are widely used as two important cell sources in neural tissue engineering. Nevertheless, low proliferation capacity and their guided differentiation toward neurons remain challenging.13,14 Dental pulp stem cells (DPSCs) are proposed as a promising cell source for neural cell therapy applications due to their similar embryonic origin and ease of harvesting.13 A wide variety of biomaterials including synthetic polymers (such as poly(ε-caprolactone) and poly(lactic-co-glycolic acid)) and natural polymers (such as chitosan, silk, and collagen) are used in nerve tissue regeneration studies.15,16 In our search for the optimal scaffold, we look for favorable characteristics such as suitable mechanical properties, biocompatibility, and neural conductiveness. Our choice of chitosan (CS), an organic montmorillonite (OMMT), and poly(vinyl

alcohol) (PVA) fulfill all above criteria. CS is a positively charged polysaccharide, which consists of glucosamine and N-acetylglucosamine units derived from deacetylation of chitin. CS possesses desirable properties such as biodegradability, biocompatibility, and high level of porosity that make this biomaterial a good candidate for tissue engineering.17 Poor hydrophilicity and unfavorable thermal and physicochemical properties limit the use of CS in fabrication of tissue engineering scaffolds.18 Montmorillonite (MMT) is a member of the smectite group with a layered phyllosilicates structures, each composed of an octahedral sheet of aluminum hydroxide sandwiched between two silica tetrahedral. This nanoclay has a large surface area and high cation exchange capacity.19,20 A number of studies have shown that Na+-MMT can enhance the mechanical and thermal properties when a polymer such as chitosan is intercalated in it through cationic exchange. The free amine and hydroxyl groups of chitosan are chemically active groups, which are susceptible to structure modification. The basicity of amine group endows the chitosan with a polyelectrolytic nature as well as chelating behavior.20 Other materials are also employed to further improve already mechanical properties of chitosan. For example, poly(vinyl alcohol) (PVA) is a nontoxic and hydrophilic polymer that has many applications in tissue engineering due to its biocompatibility and adequate physical and chemical properties.21 The bulk hydrophilicity of the blended polymers such as CS/PVA has significant impression mainly on their biological behavior. The combination of CS with PVA is reported to be superior than each polymer on its own, and it improves the physicochemical properties and production cost.22 Combination of MMT with PVA favorably improves its performance. The presence of MMT and hydrogen bonding between the negative surface charge of MMT and the hydroxyl groups of the PVA lead to a decrease in PVA crystallinity and faster biodegradation of nanocomposite when compared to pure PVA.23 More interestingly, synthetically modified MMT, organic montmorillonite (OMMT), can form high-performance composites better than natural MMT. The exfoliated structure as well as the hydrophobicity of OMMT can further improve the functional properties of composites.24 In the current study, we design a chitosan-intercalated organic montmorillonite/poly(vinyl alcohol) (OMMT/PVA) fibrous scaffold for neural tissue engineering applications. The novelty of this report is that intercalated montmorillonite/poly(vinyl alcohol) nanocomposite scaffold for directing differentiation of human dental pulp stem cells (hDPSCs) toward neuronlike cells is carried out for the first time. To achieve this, the OMMT/ PVA scaffolds are fabricated with different concentrations of the OMMT in PVA. Biophysical characteristics of the prepared scaffolds are tested. The effects of the OMMT/PVA scaffolds on guided differentiation of human dental pulp stem cells toward neuron like cells are investigated. 11393


Research Article


Figure 1. Schematic representation of chitosan/montmorillonite/poly(vinyl alcohol) nanofibrous mesh preparations.

Table 1. Primers Used in This Study gene name

significance

OCT-4

stem cell marker

Nestin

neuroprogenitor marker

NF-M

neuronal marker

NF-H

mature neuronal marker

MAP2


βIII-Tubulin


GAPDH

internal control

sequence F: TATGCAAATCGGAGACCCTG R: AAGCTGATTGGCGATGTGAG F: AAGAGAGCATAGAGGCAGTAA R: GAGATTTCAGTGTTTCCAGGT F: GACGGCGCTGAAGGAAATC R: CTTGGCGGAGCGGATGGCCT F: CAGCCAAGGTGAACACAGAC R: GCTGCTGAATGGCTTCCT F: CCTGTGTTAAGCGGAAAACC R: AGAGACTTTGTCCTTTGCCTGT F: CTCAGGGGCCTTTGGACATC R: CAGGCAGTCGCAGTTTTCAC F: GGAGAGT GTTTCCTCGTCCC R: TTTGCCGTGAGTGGAGTCAT

product size (bp) 143 93 142 189 86 150 188

under magnetic stirring for 24 h. For electrospinning process, the solutions were fed into the syringe pump, the applied voltage was 20 Kv; the feeding rate and the tip of the collector distance were set at 0.02 mm/min and 10 cm, respectively. The preparation procedure is illustrated in Figure 1. 2.3. Characterization. 2.3.1. ATR. The presence of specific chemical groups on PVA, CS, and montmorillonite (MMT) nanofibers, as well as the reaction between PVA and OMMT, were analyzed using attenuated total reflectance (ATR) (Nexus 670-USA) in a range of 500− 4000 cm−1. 2.3.2. X-ray Diffraction. Structural characterization of OMMT/PVA was recorded by X-ray diffraction (XRD) (Philips PW-1800) operated with the Cu anode (λ = 1.54 Å, 40 kV, 30 mA). XRD scans were carried out on PVA and OMMT/PVA nanofibers with a scanning speed of 2°/min and a scanning step of 0.04° by diffraction intensity curves obtained with 2θ range between (5−33°). 2.3.3. Scanning Electron Microscope. The morphology of the nanofibers was viewed by scanning electron microscope (SEM) at an acceleration voltage of 15 kV (AIS2100; Seron Technology, Uiwang-si, Gyeonggi-do, South Korea). For taking SEM micrographs, the samples were sputter-coated with gold (Nanotech SEMprep 2 sputter coater,

2. MATERIALS AND METHODS 2.1. Preparation of OMMT Composite. For making OMMT composites, a modified version of the method previously described by Kabiri et al. was used.25 Briefly, 1 g of MMT (montmorillonite) powder was dispersed in 50 mL of deionized water and 2 g of chitosan powder was dissolved in 312 mL of 1% v/v acetic acid aqueous solution, while stirring for 6 h at 60 °C. Chitosan of high molecular weight (MW average = 342 500 g mol−1) containing an average number of glucosamine units of 2130 (glucosamine MW = 161 g mol−1) was supplied by SigmaAldrich. The resulting solution was centrifuged, washed with distilled water, and dried in an oven at 80 °C. 2.2. Preparation of OMMT/PVA Nanofibers. In order to employ OMMT nanocomposite for cell culturing, we used PVA (96% hydrolyzed typical average MW 85 000−124 000, Sigma-Aldrich) as a guest polymer to simplify electrospinning process. We modified natural MMT with CS polymer to increase interlayer distance of MMT and to enhance entrance of monomers and polymers in the interlayer distance of OMMT in the process of polymer/nanocomposite preparation. PVA was dissolved in distilled water at a concentration of 5 wt %. Different concentrations of OMMT (0, 1, 3, and 5%) were added to PVA solution 11394


Research Article


Figure 2. ATR spectra of OMMT/PVA electrospun nanofibers. (a) PVA, (b) OMMT/PVA 1%, (c) OMMT/PVA 3%, and (d) OMMT/PVA 5%.

Figure 3. XRD patterns of (a) PVA, (b) OMMT/PVA 1%, (c) OMMT/PVA 3%, and (d) OMMT/PVA 5% nanofibers. impacted third molars were obtained from young adults (ages 18−35) with informed consent of the participants and in according to Human Ethical Committee of Mazandaran University of Medical Sciences (Helsinki Declaration). The extracted teeth were rinsed with phosphate-buffered saline (PBS, Sigma) containing 1% (v/v) penicillin−streptomycin (Invitrogen). Dental pulp tissues were removed from their cavities and minced into small pieces by sterile surgical scissors. Then, the pulp tissues were enzymatically digested with 3 mg/mL collagenase type I and 4 mg/mL Dispase (both of them obtained from Gibco) for 1 h at 37 °C with gentle agitation. To remove cellular debris, the mixture was filtered by passing the cells through a 70 μm pore size nylon mesh. The cells were centrifuged at 400 g for 5 min and cultured in DMEM/F-12 (1:1) (Gibco) supplemented with 10% fetal bovine serum (FBS; Invitrogen), 2 mM L-glutamine, and 1% (v/v) penicillin−streptomycin, and incubated at 37 °C with 5% CO2 in a humidified chamber. After 80% confluency, the cells were trypsinized and passaged at 1:3 ratios. Subsequently, the cultures were expanded through two additional successive subcultures. The media was replaced every 2−3 days. The cells were observed daily under an inverted microscope. 2.4.2. Characterization of Dental Pulp Stem Cells. The hDPSCs were identified by flow cytometry and their differentiation capacity toward osteogenic and adipogenic lineages. For identification of cell phenotype by flow cytometry, the cells were tested for expression of mesenchymal stem cells such as CD73, CD90, and CD105 and hematopoietic stem cells specific markers CD33, CD34, and CD45 (all antibodies obtained from Abcam, Cambridge, UK). Briefly, the cells (3 × 105 cells in PBS) were incubated with antibodies for 30 min in dark chamber, washed with PBS, and then analyzed by flow cytometry.

Nanotech, Ltd., Manchester, UK). The average diameter of nanofibers (average of 10 nanofibers ± SD) was determined. The porosity of nanofibrous meshes was measured by a previously described method26 using image analysis program ImageJ (US National Institute of Health, Bethesda, MD). Briefly, the SEM micrographs were taken in original magnification of 30×. The grayscale level processing based on image structure was used to determine average diameter and porosity of various layers of mats using ImageJ.27 The SEM images were converted to binary images suing different threshold. The porosity of each binary image was calculated using the mean intensity of micrographs.28 2.3.4. Contact Angle. Contact angles were measured using a NRC contact angle goniometer model 100−00 from Ramé-Hart at ambient humidity and temperature. A 5 μL pure water droplet was deposited for each measurement. For each sample, the contact angle was measured five times, and the average value was recorded. 2.3.5. Mechanical Properties. The tensile properties of the electrospun fibrous scaffolds were characterized at room temperature by an Instron 5564 mechanical testing instrument (Instron Corporation, Norwood, MA). The ends of rectangular samples were fixed vertically between two mechanical gripping units, leaving a 6 mm gauge length, and an extension rate of 1 mm/min was then applied. Data from the load−deformation and stress−strain curves were recorded, and the tensile stress at maximal load was obtained from these data for each sample. For each fibrous scaffold, several rectangular samples were taken and averaged to examine the tensile properties of the whole scaffold. Young’s modulus (E), and toughness values were calculated for all the measurements in triplicate. 2.4. OMMT/PVA-hDPSCs Interaction. 2.4.1. Isolation and Culture of hDPSCs. The hDPSCs were isolated according to a protocol modified from Gronthos et al.29 Briefly, the discarded normal human 11395


Research Article


Figure 4. SEM micrographs and fiber size distribution graphs of (A) PVA, (B) OMMT/PVA 1%, (C) OMMT/PVA 3% and (D) OMMT/PVA 5%. were cultured in DMEM supplemented with 10 mM β-glycerol phosphate, 0.2 Mm ascorbic acid, and 0.1 μM dexamethasone (all obtained from Sigma-Aldrich) for 21 days. The medium was changed every 3 days. At the end of differentiation induction, the cells were fixed in 4% paraformaldehyde (PFA, Sigma-Aldrich, USA) and stained with Oil red (Sigma-Aldrich) and Alizarin Red S (Sigma-Aldrich) for the

To evaluate the differentiation potential of hDPSCs, the cells were induced with adipogenic and osteogenic differentiation media. For adipogenic differentiation, the cells were cultured in DMEM supplemented with 10% rabbit serum, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM hydrocortisone, and 0.1 mM indomethacin (all obtained from Sigma-Aldrich)30 for 21 days. For osteogenic differentiation, the cells 11396


Research Article


wavelength of 590 nm with a reference filter of 620 nm. The cells cultured on the plastic surface of the culture plate served as positive control (100% cell viability). The OD of the samples was normalized to the positive control. 2.5. Differentiation Potential of the hDPSCs Cultured on CS/ MMT/PVA Nanofibrous Mesh. The effect of the CS/MMT/PVA nanofibrous meshes (1, 3, and 5% CS/MMT in PVA) on differentiation of the hDPSCs to neuronlike cells was studied by culturing the cells on the meshes and induction with neural differentiation media. Briefly, a density of 2 × 105 hDPSCs was seeded on sterilized fibrous mesh (15 × 15 mm), and the cells were preinduced with neurogenic medium consisting of serum-free DMEM/F12 with 2% B27 (Invitrogen) supplemented with 20 ng/mL basic fibroblast growth factor (bFGF, Invitrogen) and 20 ng/mL epidermal growth factor (EGF, Invitrogen) for 2 days. The cells were then treated in neurogenic medium supplemented with 5% FBS, 2% B27, 100 ng/mL glial-derived neurotrophic factor (GDNF, Invitrogen), and 200 ng/mL brain-derived neurotrophic factor (BDNF, Invitrogen) for 6 days. In the current study, 1% CS/ MMT/PVA, 3% CS/MMT/PVA, 5% CS/MMT/PVA, and negative control (NC) (the cells cultured on plastic surface of culture plate) were coded as G1, G2, G3, and NC. 2.6. Characterization of Neural Differentiation. 2.6.1. RealTime PCR. The expression of the stemness marker (Oct-4), neuroprogenitor marker (Nestin), neuronal marker (Neurofilament-medium; NF-M), and mature neuronal markers (Neurofilament heavy, NF-H; Microtubule-associated protein2, MAP2; and βIII- tubulin) in hDPSCs was determined at preinduction (day 2) and postinduction (day 6) and compared between the experimental groups.12 Total cellular RNA was extracted by Trizol Reagent (Invitrogen Life Technologies) according to the manufacturers’ instructions. Then, 5 μg of total RNA was transcribed to cDNA by High-Capacity cDNA archive kit (Applied Biosystems, Foster City, CA) using a random primer. RT-PCR amplification was done under the following conditions: 3 min at 95 °C followed by 40 repeated cycles of 95 °C, 30 s; 60 °C, 45 s; and 72 °C, 45 s, and a final extension cycle of 7 min at 72 °C. The expression level of each gene was normalized to GAPDH housekeeping gene, and the relative expression was defined by 2-ΔΔCt. RT-PCR products were run in 1.5% agarose gel, stained with ethidium bromide, and visualized under UV translluminator. The RT-PCR was repeated three time for each reaction. All primers used and product lengths are listed in Table 1. 2.6.2. Immunostaining. At 8 days postinduction, the cells were washed with PBS (PH 7.4) and fixed in 4% PFA for 30 min at room temperature (RT). The fixed cells were permeabilized with 0.025% Triton X-100 for 10 min at RT and followed by three washes with PBS. To block unspecific binding of the antibody, the cells were incubated with 10% goat serum for 30 min. The cells were subsequently treated with primary antibodies against Nestin (rabbit polyclonal to Nestin, ab92391, Abcam system, UK) and MAP2 (rabbit monoclonal to MAP2, ab183830, Abcam system, UK) for 1 h at RT. The cells were washed three times with PBS and then incubated with secondary antibody (FITC-conjugated goat polyclonal secondary antibody to rabbit IgG, Abcam, Cambridge, MA) for 45 min at RT in a dark chamber. The cells were washed again with PBS and cell nuclei were counterstained with DAPI. Both primary antibodies were diluted 1:1000 in Tris buffered saline (TBST), 1% BSA, and 0.1% Tween-20. Secondary antibody was diluted 1:100 in TBST.35 All the used antibodies were purchased from Abcam, Cambridge, MA. The immunostained cells were viewed under fluorescent microscope (Olympus BX51, Japan). The positive cells for Nestin and MAP2 were counted, and the results were reported as average cell number per HPF.

Table 2. Porosity Measurement of the Fabricated Matrices of Binary Images of PVA, OMMT/PVA 1%, OMMT/PVA 3%, and OMMT/PVA 5% sample

magnification

porosity

PVA OMMT/PVA 1% OMMT/PVA 3% OMMT/PVA 5%

3000 3000 3000 3000

91.3333 86.2421 84.7915 80.2912

Table 3. Sample Compositions and Their Relative Contact Angles samples

contact angles


49 ± 2.8 41 ± 1.4 37 ± 1.7 31 ± 1.9

visualization of adipogenic and osteogenic differentiation, respectively. The stained cells were observed under a light microscope equipped with a phase-contrast apparatus. 2.4.3. Cell Adhesion and Distribution. The cell adhesion was studied by taking SEM micrographs from the cells grown on the nanofibrous meshes for 72 h. The cells/mesh constructs were fixed in 4% paraformaldehyde (PFA) for 2 h, followed by treatment with 1% osmium tetroxide (OsO4) (Sigma-Aldrich). The samples were then dehydrated in a series of increasing grades of acetone (Merck, Darmstadt, Germany). The constructs were finally sputter-coated with gold and the morphology of the cells viewed under SEM at an accelerating voltage of 15 kV. The hDPSCs grown on the nanofibrous meshes were also stained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) to determine the cell distribution and density.31 The distribution of the cells over the nanofibrous meshes was viewed under fluorescent microscope, and the cell density was quantified by counting the cells per high power field (HFP). The test was repeated six times. 2.4.4. Cell Viability and Cytotoxicity. The cells were seeded and cultured on nanofibrous meshes for 1, 5, and 15 days at 37 °C in 5% CO2. After each time interval, cell viability and cytotoxicity were evaluated by MTT and LDH specific activity assays.32,33 Nanofibers were sterilized with UV light for 4 h. A density of 1 × 104 cells was seeded on each nanofibrous mesh (5 × 5 mm). The medium in which the cells were grown was analyzed for lactate dehydrogenase (LDH) specific activity using LDH assay kit (Zist Shimi kits, Tehran, Iran). LDH being a cytoplasmic enzyme plays an important role in cells. In the presence of the NAD+, this enzyme converts lactate to pyruvate. After cell damage or rupture, LDH is released from cells. LDH is considered as an indicator for determination of cell damage or death in vitro. Measurement is based on the conversion of P-Nitro Phenyl Phosphate to P-Nitro Phenol.34 The UV absorbance of NADH was quantitated on a Biotek EL800 absorbance plate reader at 490 nm. For cell viability evaluation, the cells were treated with 10% 3-(4,5dimethylthiazoyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich) solution for 1 h. The reaction solution was removed, and the produced formazan crystals were dissolved in dimethyl sulfoxide (DMSO) (Sigma-Aldrich), placed in dark chamber, and shacked for 20 min. The optical density (OD) of formazon was measured using an ELISA (enzyme-linked immunosorbent assay) plate reader at a

Table 4. Mechanical Properties of Fabricated PVA, OMMT/PVA 1%, OMMT/PVA 3%, and OMMT/PVA 5% Matrices samples

tensile strength (GPa)

initial modulus (GPa)

toughness (MPa)

elongation at break (%)


1.53 ± 0.12 1.69 ± 1.03 1.83 ± 1.27 1.88 ± 1.78

33.12 ± 0.53 34.49 ± 0.72 34.98 ± 0.42 35.25 ± 0.98

64.37 ± 1.23 67.59 ± 1.44 68.21 ± 1.37 72.58 ± 1.87

8.2 ± 1.3 8.1 ± 1.1 7.9 ± 0.9 8.0 ± 1.5

11397


Research Article


Figure 5. (A) Morphological changes in human dental pulp stem cells in cell culture media at days 3, 15, and 21 postextraction. Cultured cells gradually showed a flattened and fibroblast-like morphology (10× magnification for 3 and 15 days; 20× magnification for 21 days). (B) Flow cytometry results of CD90, CD105, CD73, CD33, CD34, and CD45. More than 90% of cell population showed a phenotypic characteristics of human dental pulp mesenchymal stem cells (hDPSCs). 2.7. Statistical Analysis. Statistical analysis was carried out by applying one-way ANOVA and Tukey’s test. P < 0.05 was considered as level of significance. The results were given as means standard error (SE).

a lower frequency range (the peaks positioned at 906.94 and 749.21 cm−1), which confirmed the interaction occurred between PVA and OMMT. 3.1.2. XRD. XRD patterns of PVA and OMMT/PVA nanofibers with different concentration of OMMT (0, 1, 3, and 5%) are shown in Figure 3. The pure PVA nanofibers showed a significant crystalline peak at about 17.4°, which is due to the presence of strong intermolecular and intramolecular hydrogen bonding. A broad peak at about 20.1° was exhibited in the blends corresponding to the characteristic diffraction pattern of the CS polymer. This diffraction peak appeared to be very broad due to the amorphous nature of electrospun chitosan nanofibers.38 During electrospinning process, the stretched molecular chains of the fiber solidified quickly at high elongated rates, which caused the retardation of crystalline microstructure of electrospun nanofibers. Thus, the crystallinity of PVA/OMMT electrospun nanofibers was reduced in electrospinning process. In addition, by increasing OMMT content, the peak around 2θ = 21.9°, which was related to CS polymer, slightly shifted to 22.5° in OMMT 5%. This confirms that strong interaction occurred between OMMT and PVA molecule in the blends.39 According to the OMMT modification method with CS, before electrospinning process and preparation of the electrospinning solution,

3. RESULTS AND DISCUSSION 3.1. Characterization of Organic Montmorillonite/ Poly(vinyl alcohol) (OMMT/PVA). 3.1.1. ATR-FTIR. The interaction of PVA and OMMT was analyzed by ATR (Figure 2). PVA displayed main bands at 3300, 2910, 1726, 1230, and 1025 cm−1, which correspond to the chemical groups of OH, CH2 symmetric, CO, C−O, and C−O−C stretching vibration, respectively. By adding 1% OMMT into PVA solution the peak at 3300 cm−1 shifted to higher frequency of 3309 cm−1 due to the CS presence, as a result of stretching vibrations of −OH groups at 3000−3500 cm−1 that were overlapped to the stretching vibration of −NH2 groups in CS.36 Moreover, increasing absorption in the range of (1600,1650) cm−1 was related to the vibrations of carbonyl bands (CO) in a secondary amide group in CS.37 In OMMT/PVA 1% peaks in 1025, 905, and 747 cm−1 related to Si−O, OH, and (Al−Fe−OH) stretching vibration in MMT. As shown in ATR results, by increasing OMMT concentration to 5%, the sharp peaks in PVA sample shifted to 11398


Research Article


Figure 6. (A) SEM micrographs of the human dental pulp stem cells grown on 1, 3, and 5% w/v OMMT-PVA nanofibrous scaffolds for 72 h. (B) Cells grown on the scaffolds and stained with DAPI under fluorescent microscope (left). Density of the cells grown on the scaffolds. (C) MTT and LDH specific activity tests representing the cell viability and cytotoxicity. NC: G1: 1% OMMT/PVA; G2: 3% OMMT/PVA; G3: 5% OMMT/PVA; NC: negative control. p ≤ 0.05 was considered as level of significance.

pure polymer nanofibers (PVA) had averaged at 49°, which is in the same range of order as previously reported.45 Table 3 shows the contact angle values of each produced sample. Addition of OMMT clearly showed altered surface wettability, with enhanced hydrophilicity on the surface of PVA nanofibers modified with OMMT. The decrease in contact angle indicated that composite nanofibers were obtained. It is related to the side chains grafted on the OMMT nanostructure. OMMT surface hydroxyls increased the hydrophilicity of the composite. 3.1.5. Mechanical Properties. Mechanical properties including tensile strength, initial modulus, toughness, and elongation at break are summarized in Table 4. The improvements in tensile strength, initial modulus, and toughness for the OMMT/PVA fibers were highly significant. The average tensile strength of 1.88 GPa for the OMMT/PVA 5% fiber was 18% higher than that determined of 1.53 GPa for PVA fiber. Similarly, the average initial modulus of 35.25 GPa for the OMMT/PVA 5% was 8% higher than that measured for PVA fiber (33.12 GPa). Likewise, the toughness of the OMMT/PVA 5% fiber was increased by 13% compared to PVA fiber. Elongations at break for all of fibers were almost similar. This means the OMMT/PVA 5% fiber possesses the same ductility as that of PVA fiber. The mechanical properties such as tensile strength, initial modulus, and toughness were significantly higher. It shows that the addition of a second phase into a polymer matrix can enhance its mechanical properties. In this case, OMMT particles in the PVA polymeric matrix act as reinforcement. It is also speculated that the chitosan functional groups in the OMMT particles can bind to the functional groups of PVA. In recent years, polymer blending has

OMMT was exfoliated in PVA polymers, and this also corresponded with the X-ray results. 3.1.3. Scanning Electron Microscopy. The morphology and diameters of different electrospun nanofibers were observed by SEM, shown in Figure 4. The OMMT/PVA mats showed almost similar surface morphologies which consisted of continuous and randomly oriented nanofibers. The average fiber diameters of OMMT/PVA are also shown in Figure 4. The SEM micrographs showed that the nanofibers had a solid surface with interconnected voids among the fibers, making up a porous network. The distribution of the nanofibers diameters showed that OMMT/PVA had approximately 95% of the nanofibers within 60−140 nm diameter range. The percentage porosity values of different samples are presented in Table 2. It indicated that the porosity percentage in mats with smaller fiber diameters were larger when compared to the mats with larger fiber diameters. They had lower porosity percentages. Scaffolds should have a large pore size and high porosity to provide a 3D microenvironment for brain-derived cell infiltration and nutrient/metabolic waste exchanges.40,41 Thus, high porosity and interconnectivity are two important features that make scaffolds suitable for tissue engineering applications. An increase in concentration of electrospinning solution decrease porosity of nanofibrous mats.42−44 The unique morphology of OMMT/PVA nanofibers with high porosity and surface area makes this mat a promising scaffold for neural tissue engineering applications. 3.1.4. Contact Angle. Contact angle measurements were used to evaluate the wettability difference between pure polymer and OMMT-modified electrospun samples. The contact angles of 11399


Research Article


and CD105, while only 3.6, 4.1, and 5.7% of them were positive for CD33, CD34 and CD45, respectively (Figure 5B). 3.3. Cell Adhesion and Distribution. An ideal scaffold for tissue engineering applications should provide a microenvironment for cell attachment and support cell growth and migration.49,50 The morphology of the hDPSCs grown on the scaffolds was observed under SEM, and the results are shown in Figure 6A. The cells exhibited a spindlelike morphology with effective attachment to nanofibers. The cells were stretched over sample 5% OMMT and tightly attached to the nanofibers. The morphology of the cells on all three samples of OMMT/PVA (1, 3, and 5%) showed excellent cell adhesion property for hDPSCs. The density of the cells cultured on the scaffolds was determined by DAPI staining of the attached cells and cell count (Figure 6B). According to the results, although the cell density (average cell number) in all the nanofibrous samples was higher than that of negative control (the cells cultured on plastic surface of culture plate), the difference was not significant (p ≥ 0.05). The results indicate high biocompatibility of all the prepared OMMT/PVA scaffolds for hDPSCs that are in agreement with earlier investigations.26,51,52 Shokrgozar et al.44 reinforced chitosan/poly(vinyl alcohol) nanofibrous scaffolds with single-walled carbon nanotube for neural tissue engineering applications. Their porous scaffold showed an excellent attachment property for brain-derived cells. In another study, chitosan/poly(vinyl alcohol) electrospun scaffold was conjugated with nerve growth factor to enhance proliferation and attachment of neural cell lines.53 3.4. Cell Viability and Cytotoxicity. The cell viability was determined based on the ability of the living cells’ mitochondria formation of the formazon crystals by reduction of tetrazolium salt. The MTT result is presented in Figure 6C. According to the results, there was no significant difference in cell viability between experimental groups and NC (p ≥ 0.05). The toxicity of the nanofibrous meshes against hDPSCs was also evaluated by LDH specific assay, and results are shown in Figure 6C. No cytotoxicity was observed in all nanofibrous samples when compared to NC (p ≥ 0.05). Noncytotoxicity of PVA, CS, and montmorillonite was also reported by several investigations.17,20,22,25,26,36,38,54 For example, CS/PVA electrospun mat is suggested as a potential scaffold for neural cell proliferation and migration.53 3.5. Characterization of in Vitro Differentiation. 3.5.1. Real-Time PCR. The hDPSCs grown on nanofibrous meshes were analyzed for gene expression after preinduction and induction stages by RT-PCR (Figure 7). Oct-4, a stemness marker, was significantly lower than in NC in both induction stages. Furthermore, the lowest expression of Oct4 was measured in the cells cultured on 5%OMMT/PVA (G3) compared with other groups at induction stage (Figure 7A). The Nestin, representing the important neuroprogenitor marker, was significantly up-regulated and down-regulated in all experimental groups compared with NC at preinduction and induction stages, respectively. According to our results, the 5% OMMT/PVA showed the highest accelerated neural differentiation between the groups in both induction stages. The expressional levels of mature neuronal markers (NF-H, MAP2, and βIII-tubulin) were low in all groups at preinduction stage, indicating successful stimulation of neural differentiation. However, at the induction stage, the mature neuronal markers showed a significant upregulation in all the experimental groups when compared with that in NC (Figure 7A). The RT-PCR results indicated that 5% OMMT-PVA mat provided the better 3D microenvironment for stimulation of neural differentiation of

Figure 7. (A) Real-time PCR results of relative gene expression of the hDPSCs culture on the nanofibrous meshes at preinduction stage and postinduction stage. (B) RT-PCR products of Oct-4, Nestin, and NF-H genes at induction stage were visualized in 1.5% gel electrophoresis. G1: 1% OMMT/PVA; G2: 3% OMMT/PVA; G3: 5% OMMT/PVA; NC: negative control. p ≤ 0.05 was considered as level of significance. * indicates significant difference with NC. # indicates significant difference with G1 and G2. p ≤ 0.05 was considered as level of significance.

become a method for providing polymeric materials with desirable properties for practical applications. In particular, chitosan blended with PVA is reported to have good mechanical and chemical properties and as a topic of great interest is extensively studied in the biomedical field. The enhanced property is attributed to the interactions between chitosan and PVA in the blend through hydrophobic side-chain aggregation and intermolecular and intramolecular hydrogen bonds.20,25,26,44 The result obtained from mechanical properties of OMMT/PVA mats reveals that this scaffold is suitable for potential applications in neural tissue engineering. 3.2. Characterization of Human Dental Pulp Stem Cells. The most important criteria for characterization of dental pulp stem cells are their fibroblast-like morphology, expression of specific CD markers on their surface, and their differentiation capacity toward adipogenic, osteogenic, and chondroenic lineages.46,47 It has been well-documented that these cells are positive for mesenchymal specific markers such as CD73, CD90, and CD105 and negative for hematopoietic stem cells specific markers such as CD33, CD34, and CD45.48 The morphology of the cells during isolation and expansion as well as flow cytometry results are shown in Figure 5. The hDPSCs showed a typical fibroblast-like morphology with bipolar shape under light microscope Figure 5A. Flow cytometry results revealed that 99.1, 87.5, and 100% of the cell population were positive for CD73, CD90, 11400


Research Article


Figure 8. (A) Immunostaining of the human dental pulp stem cells (hDPSCs) expression of Nestin and MAP2 markers (red) at induction stage. Cell nuclei were stained with DAPI (blue). White and yellow arrows indicate negative and positive cells, respectively. Scale bar: 40 μm. (B) Average percentage of Nestin and MAP2 expressing hDPSCs. G1: 1% OMMT/PVA; G2: 3% OMMT/PVA; G3: 5% OMMT/PVA; NS: negative control. p ≤ 0.05 was considered as level of significance. * indicates significant difference with NC. # indicates significant difference with G1 and G2. p ≤ 0.05 was considered as level of significance.

hDPSCs than 1% and 3% OMMT/PVA mats. The RT-PCR products of Oct-4, Nestin, and NF-H genes at induction stage were visualized in 1.5% gel electrophoresis (Figure 7B). The development of support materials for guiding the differentiation of stem cells toward neuronlike cells were reported by earlier.55,56 Zhang et al.56 prepared a 3D scaffold uniaxial multichannel (42− 142 μm in diameter) from silk fibroin by freeze-drying method. They seeded primary hippocampal neurons on the scaffold and showed that the cells aligned along the scaffold channels and formed a multipolar shape of newly formed axons. Hoveizi and co-workers52 also showed that polylactic acid/chitosan (PLA/ CS) 3D scaffolds significantly accelerated the differentiation of PC12 nerve cells into neural-like cells. Our results strongly indicate the efficiency of the OMMT/PVA during the induction of neuronlike cells specific gene expression in dental pulp stem cells. 3.5.2. Immunostaining. The cultured hDPSCs on nanofibrous samples at postinduction day were stained with Nestinand MAP2-specific antibody and viewed under fluorescent microscope (Figure 8). The results showed that the percentage of the cells expressing Nestin in NC (52.8 ± 2.9% Nestin positive cells) was higher than that in other experimental groups. The 5% OMMT/PVA groups were found to have the lowest percentage of Nestin positive cells (20.8 ± 6.8%) among the experimental groups. In contrast, the percentage of the MAP2-expressing cells in all the experimental groups was significantly higher than that in NC (P = 0.001) (Figure 8). The percentage of the MAP2 positive cells in the 5% CS/MMT/PVA group was 17.2 ± 4.5%. The hDPSCs are reported to be a promising autologous cell source for different therapeutic applications, especially neurodegenerative disorders. These cells are able to differentiate into neural cells under induction with neural differentiation media.57

Other studies have also shown that in response to neuronal inductive stimuli, a large part of DPSCs stop proliferation and acquired a phenotype characteristic similar to neurons.13,58 Numerous studies had identified DPSCs as promising stem cell source and had represented these cells as alternative source of stem cells for tissue engineering for nondental tissue repair or regeneration. However, more clinical studies are needed.59 According to the results reported by Karaoz et al.,60 hDPSCs showed superior epithelial and neural stem cells properties to those of bone-marrow-derived mesenchymal stem cells. It also revealed that transplantation of undifferentiated and untreated dental pulp stem cells into hippocampus of mice significantly accelerated the proliferation and differentiation of endogenous neural cells.61 One of the greatest advantages of DPSCs as a preferable cell source in cell therapy is that such cells can be isolated from patients more easily. Therefore, this choice substantially reduced a number of complications associated with host immune rejection.61 In this study, we show that OMMT/PVA is an excellent supporter for proliferation and differentiation of hDPSCs for predifferentiation of these cells before cell therapy. Among the synthesized nanofibrous meshes, 5% OMMT/PVA samples showed the best results in differentiation of the hDPSCs toward neuronlike cells. The ability of chitosan as a material for regeneration of nerve system was also reported.26,51 For example, Wang et al.51 showed that chitosan/polyglycolic acid (CS/PGA) artificial nerve graft reconstructed the peripheral nerve system after implantation in dog. It showed that PVA was a suitable biomaterial for neural tissue engineering.26,62 In another study, Bagher et al.55 showed the effects of collagen grafted-polycaprolactone (PCL) nanofibers on differentiation of Wharton’s jelly derived mesenchymal stem cells into motor neuronlike cells. According to their results, the cells seeded on the fabricated 11401


Research Article


(2) Srivastava, A. S.; Malhotra, R.; Sharp, J.; Berggren, T. Potentials of ES Cell Therapy in Neurodegenerative diseases. Curr. Pharm. Des. 2008, 14, 3873−9. (3) Manchineella, S.; Thrivikraman, G.; Basu, B.; Govindaraju, T. Surface-Functionalized Silk Fibroin Films as a Platform To Guide Neuron-like Differentiation of Human Mesenchymal Stem Cells. ACS Appl. Mater. Interfaces 2016, 8, 22849−22859. (4) Nowacek, A.; Kosloski, L. M.; Gendelman, H. E. Neurodegenerative Disorders and Nanoformulated Drug Development. Nanomedicine (London, U. K.) 2009, 4 (5), 541−55. (5) Solanki, I.; Parihar, P.; Parihar, M. S. Neurodegenerative Diseases: from Available Treatments to Prospective Herbal Therapy. Neurochem. Int. 2016, 95, 100−8. (6) Lindvall, O.; Kokaia, Z. Stem Cells in Human Neurodegenerative DisordersTime for Clinical Translation? J. Clin. Invest. 2010, 120, 29− 40. (7) Lindvall, O.; Kokaia, Z. Stem Cells for the Treatment of Neurological Disorders. Nature 2006, 441, 1094−1096. (8) Lindvall, O.; Barker, R. A.; Brüstle, O.; Isacson, O.; Svendsen, C. N. Clinical Translation of Stem Cells in Neurodegenerative Disorders. Cell Stem Cell 2012, 10, 151−155. (9) Yang, K.; Lee, J.; Lee, J. S.; Kim, D.; Chang, G.-E.; Seo, J.; Cheong, E.; Lee, T.; Cho, S.-W. Graphene Oxide Hierarchical Patterns for the Derivation of Electrophysiologically Functional Neuron-like Cells from Human Neural Stem Cells. ACS Appl. Mater. Interfaces 2016, 8, 17763− 17774. (10) Karimi-Abdolrezaee, S.; Eftekharpour, E.; Wang, J.; Morshead, C. M.; Fehlings, M. G. Delayed Transplantation of Adult Neural Precursor Cells Promotes Remyelination and Functional Neurological Recovery After Spinal Cord Injury. J. Neurosci. 2006, 26, 3377−3389. (11) O’Brien, F. J. Biomaterials & Scaffolds for Tissue Engineering. Mater. Today 2011, 14, 88−95. (12) Bagher, Z.; Azami, M.; Ebrahimi-Barough, S.; Mirzadeh, H.; Solouk, A.; Soleimani, M.; Ai, J.; Nourani, M. R.; Joghataei, M. T. Differentiation of Wharton’s Jelly-Derived Mesenchymal Stem Cells into Motor Neuron-Like Cells on Three-Dimensional Collagen-Grafted Nanofibers. Mol. Neurobiol. 2016, 53, 2397−408. (13) Chang, C. C.; Chang, K. C.; Tsai, S. J.; Chang, H. H.; Lin, C. P. Neurogenic Differentiation of Dental Pulp Stem Cells to Neuron-Like Cells in Dopaminergic and Motor Neuronal Inductive Media. J. Formosan Med. Assoc. 2014, 113, 956−65. (14) Nazm Bojnordi, M.; Ghasemi, H.; Akbari, E. Remyelination After Lysophosphatidyl Choline-Induced Demyelination is Stimulated by Bone Marrow Stromal Cell-Derived Oligoprogenitor Cell Transplantation. Cells Tissues Organs 2015, 200, 300−306. (15) Subramanian, A.; Krishnan, U. M.; Sethuraman, S. Development of Biomaterial Scaffold for Nerve Tissue Engineering: Biomaterial Mediated Neural Regeneration. J. Biomed. Sci. 2009, 16, 108. (16) Farokhi, M.; Mottaghitalab, F.; Shokrgozar, M. A.; Kaplan, D.; Kim, H. W.; Kundu, S. Prospects of Peripheral Nerve Tissue Engineering Using Nerve Guide Conduits Based on Silk Fibroin Protein and Other Biopolymers. Int. Mater. Rev. 2016, 62, 1−25. (17) Rodríguez-Vázquez, M.; Vega-Ruiz, B.; Ramos-Zúñiga, R.; Saldaña-Koppel, D. A.; Quiñones-Olvera, L. F. Chitosan and Its Potential Use as a Scaffold for Tissue Engineering in Regenerative Medicine. BioMed Res. Int. 2015, 2015, 821279. (18) Mokhtarzadeh, A.; Alibakhshi, A.; Hejazi, M.; Omidi, Y.; Ezzati Nazhad Dolatabadi, J. Bacterial-Derived Biopolymers: Advanced Natural Nanomaterials for Drug Delivery and Tissue Engineering. TrAC, Trends Anal. Chem. 2016, 82, 367−384. (19) Chang, P. H.; Jiang, W. T.; Li, Z.; Kuo, C. Y.; Jean, J. S.; Chen, W. R.; Lv, G. Mechanism of Amitriptyline Adsorption on Ca-Montmorillonite (Saz-2). J. Hazard. Mater. 2014, 277, 44−52. (20) Darder, M.; Colilla, M.; Ruiz-Hitzky, E. Biopolymer−Clay Nanocomposites Based on Chitosan Intercalated in Montmorillonite. Chem. Mater. 2003, 15, 3774−3780. (21) Kamoun, E. A.; Chen, X.; Mohy Eldin, M. S.; Kenawy, E.-R. S. Crosslinked Poly(Vinyl Alcohol) Hydrogels for Wound Dressing

nanofibrous scaffold showed an upregulation of motor neuron biomarkers at both RNA and protein levels at 15 days postinduction. The results of RT-PCR and immunofluorescence staining revealed the feasible application of OMMT/PVA as a novel artificial nerve graft for neuronlike differentiation of hDPSCs; subsequently, this may have potential for cell therapy for neurodegenerative disorders.

4. CONCLUSION Cell therapy is considered as an attractive treatment strategy for a number of disorders including neurodegenerative disorders. We show that human dental pulp can be used as a rich and substantial cell source for cell therapy of neurodegenerative disorders. We engineer a novel nanofibrous mesh made from organic montmorillonite/poly(vinyl alcohol) (OMMT-PVA) as an excellent supportive environment for guiding neural differentiation of human dental pulp stem cells (hDPSCs). OMMTPVA 3D scaffolds with higher concentration of montmorillonite (5%) exhibit better inductive property for neuronal lineage differentiation of the hDPSCs. Preculture of hDPSCs on OMMT/ PVA nanofibrous meshes and transplantation of hDPSCsOMMT/PVA constructs indicate a promising strategy for regeneration of the damaged neural tissues in neurodegenerative disorders.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Tel.: (+98 912) 649 0679. Fax: (+98 263) 6280033 ext. 477. *E-mail: [email protected]; mazaher.gholipour@ sbmu.ac.ir. Tel.: (+98 21) 8862 2755; (+98 912) 640 3948. Fax: (+98 21) 8862 2533. ORCID

Masoud Mozafari: 0000-0002-0232-352X Mazaher Gholipourmalekabadi: 0000-0001-6287-6831 Author Contributions

M.G. and M.M. conceived and designed the study. M.G., M.M, H.G.H., Z.R., M.N.B., M.R., M.S., and A.Y. performed the experiments. M.G., M.M., M.T.J., and H.G.H. analyzed the data. M.G., M.M., A.M.S., A.M.U., H.G.H., Z.R., A.A., and M.T.J interpreted the results. H.H.G., Z.R., M.N.B., M.R., A.A., A.Y., A.M.U, and M.G prepared the manuscript. M.G., A.M.S., M.T.J., M.M., S.C.K. H.S., and R.L.R reviewed during the preparation of manuscript, revised the manuscript, and responded to reviewers’ comments. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We express our sincere thanks to Dr. Ali Samadikuchaksaraei for providing helpful comments on this work. The project was funded by Mazandaran University of Medical Sciences (Grant No. 2580). S.C.K. presently holds ERA Chair Full Professor position at the 3B’s Research Group, University of Minho, Portugal, supported by the European Union Framework Programme for Research and Innovation Horizon 2020 under grant agreement n° 668983 − FoReCaST.

■

REFERENCES

(1) Amor, S.; Puentes, F.; Baker, D.; van der Valk, P. Inflammation in Neurodegenerative Diseases. Immunology 2010, 129, 154−69. 11402


Research Article

ACS Applied Materials & Interfaces Applications: A Review of Remarkably Blended Polymers. Arabian J. Chem. 2015, 8, 1−14. (22) Rafique, A.; Mahmood Zia, K.; Zuber, M.; Tabasum, S.; Rehman, S. Chitosan Functionalized Poly(Vinyl Alcohol) for Prospects Biomedical and Industrial Applications: A Review. Int. J. Biol. Macromol. 2016, 87, 141−54. (23) Karimi, A.; Wan Daud, W. M. A. Materials, Preparation, and Characterization of PVA/MMT Nanocomposite Hydrogels: A Review. Polym. Compos. 2015, 23671. (24) Liu, R.; Cao, J.; Luo, S.; Wang, X. Effects of Two Types of Clay on Physical and Mechanical Properties of Poly(Lactic Acid)/Wood Flour Composites at Various Wood Flour Contents. J. Appl. Polym. Sci. 2013, 127, 2566−2573. (25) Kabiri, K.; Mirzadeh, H.; Zohuriaan-Mehr, M. J. Highly Rapid Preparation of A Bio-Modified Nanoclay with Chitosan. Iran. Polym. J. 2007, 16, 147. (26) Naghavi Alhosseini, S.; Moztarzadeh, F.; Mozafari, M.; Asgari, S.; Dodel, M.; Samadikuchaksaraei, A.; Kargozar, S.; Jalali, N. Synthesis and Characterization of Electrospun Polyvinyl Alcohol Nanofibrous Scaffolds Modified by Blending with Chitosan for Neural Tissue Engineering. Int. J. Nanomed. 2012, 7, 25. (27) Semnani, D.; Latifi, M.; Tehran, M.; Pourdeyhimi, B.; Merati, A. Effect of Yarn Appearance on Apparent Quality of Weft Knitted Fabric. J. Text. Inst. 2005, 96, 295−301. (28) Ghasemi-Mobarakeh, L.; Semnani, D.; Morshed, M. A Novel Method for Porosity Measurement of Various Surface Layers of Nanofibers Mat Using Image Analysis for Tissue Engineering Applications. J. Appl. Polym. Sci. 2007, 106, 2536−2542. (29) Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P. G.; Shi, S. Postnatal Human Dental Pulp Stem Cells (Dpscs) in Vitro and In Vivo. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 13625−13630. (30) Lee, O. K.; Kuo, T. K.; Chen, W.-M.; Lee, K.-D.; Hsieh, S.-L.; Chen, T.-H. Isolation of Multipotent Mesenchymal Stem Cells from Umbilical Cord Blood. Blood 2004, 103, 1669−1675. (31) Cheng, L.; Sun, X.; Zhao, X.; Wang, L.; Yu, J.; Pan, G.; Li, B.; Yang, H.; Zhang, Y.; Cui, W. Surface Biofunctional Drug-Loaded Electrospun Fibrous Scaffolds for Comprehensive Repairing Hypertrophic Scars. Biomaterials 2016, 83, 169−181. (32) Gholipourmalekabadi, M.; Mozafari, M.; Gholipourmalekabadi, M.; Nazm Bojnordi, M.; Hashemi-soteh, M. B.; Salimi, M.; Rezaei, N.; Sameni, M.; Samadikuchaksaraei, A.; Ghasemi Hamidabadi, H. In Vitro and In Vivo Evaluations of Three-Dimensional Hydroxyapatite/Silk Fibroin Nanocomposite Scaffolds. Biotechnol. Appl. Biochem. 2015, 62, 441−450. (33) Rostami, A.; Mozafari, M.; Gholipourmalekabadi, M.; Caicedo, H. H.; Lasjerdi, Z.; Sameni, M.; Samadikuchaksaraei, A. Optimization of Fluoride-Containing Bioactive Glasses as a Novel Scolicidal Agent Adjunct to Hydatid Surgery. Acta Trop. 2015, 148, 105−114. (34) Mitchell, D. B.; Santone, K. S.; Acosta, D. Evaluation of Cytotoxicity in Cultured Cells by Enzyme Leakage. J. Tissue Cult. Methods 1980, 6, 113−116. (35) Nazm Bojnordi, M.; Movahedin, M.; Tiraihi, T.; Javan, M.; Ghasemi Hamidabadi, H. Oligoprogenitor Cells Derived from Spermatogonia Stem Cells Improve Remyelination in Demyelination Model. Mol. Biotechnol. 2014, 56, 387−393. (36) Koosha, M.; Mirzadeh, H.; Shokrgozar, M. A.; Farokhi, M. Nanoclay-Reinforced Electrospun Chitosan/PVA Nanocomposite Nanofibers for Biomedical Applications. RSC Adv. 2015, 5, 10479− 10487. (37) Lertsutthiwong, P.; Noomun, K.; Khunthon, S.; Limpanart, S. Influence of Chitosan Characteristics on the Properties of Biopolymeric Chitosan−Montmorillonite. Prog. Nat. Sci. 2012, 22, 502−508. (38) Han, Y.-S.; Lee, S.-H.; Choi, K. H.; Park, I. Preparation and Characterization of Chitosan−Clay Nanocomposites with Antimicrobial Activity. J. Phys. Chem. Solids 2010, 71, 464−467. (39) Zhuang, H.; Zheng, J. P.; Gao, H.; De Yao, K. In Vitro Biodegradation and Biocompatibility of Gelatin/MontmorilloniteChitosan Intercalated Nanocomposite. J. Mater. Sci.: Mater. Med. 2007, 18, 951−957.

(40) Agarwal, S.; Wendorff, J. H.; Greiner, A. Use of Electrospinning Technique for Biomedical Applications. Polymer 2008, 49, 5603−5621. (41) Ma, P. X. Biomimetic Materials for Tissue Engineering. Adv. Drug Delivery Rev. 2008, 60, 184−198. (42) Ramakrishna, S.; Fujihara, K.; Teo, W.-E.; Yong, T.; Ma, Z.; Ramaseshan, R. Electrospun Nanofibers: Solving Global Issues. Mater. Today 2006, 9 (3), 40−50. (43) Xie, J.; MacEwan, M. R.; Schwartz, A. G.; Xia, Y. Electrospun Nanofibers for Neural Tissue Engineering. Nanoscale 2010, 2, 35−44. (44) Shokrgozar, M. A.; Mottaghitalab, F.; Mottaghitalab, V.; Farokhi, M. Fabrication of Porous Chitosan/Poly (Vinyl Alcohol) Reinforced Single-Walled Carbon Nanotube Nanocomposites for Neural Tissue Engineering. J. Biomed. Nanotechnol. 2011, 7, 276−284. (45) Song, W.; Markel, D. C.; Wang, S.; Shi, T.; Mao, G.; Ren, W. Electrospun Polyvinyl Alcohol−Collagen−Hydroxyapatite Nanofibers: A Biomimetic Extracellular Matrix for Osteoblastic Cells. Nanotechnology 2012, 23, 115101. (46) Kerkis, I.; Kerkis, A.; Dozortsev, D.; Stukart-Parsons, G. C.; Gomes Massironi, S.; Pereira, L. V.; Caplan, A. I.; Cerruti, H. F. Isolation and Characterization of a Population of Immature Dental Pulp Stem Cells Expressing Oct-4 and Other Embryonic Stem Cell Markers. Cells Tissues Organs 2006, 184, 105−116. (47) Gronthos, S.; Brahim, J.; Li, W.; Fisher, L.; Cherman, N.; Boyde, A.; DenBesten, P.; Robey, P. G.; Shi, S. Stem Cell Properties of Human Dental Pulp Stem Cells. J. Dent. Res. 2002, 81, 531−535. (48) Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal Criteria for Defining Multipotent Mesenchymal Stromal Cells. The International Society for Cellular Therapy Position Statement. Cytotherapy 2006, 8, 315−317. (49) Khorshidi, S.; Solouk, A.; Mirzadeh, H.; Mazinani, S.; Lagaron, J. M.; Sharifi, S.; Ramakrishna, S. A Review of Key Challenges of Electrospun Scaffolds for Tissue-Engineering Applications. J. Tissue Eng. Regener. Med. 2016, 10, 715−738. (50) Cui, W.; Zhou, Y.; Chang, J. Electrospun Nanofibrous Materials for Tissue Engineering and Drug Delivery. Sci. Technol. Adv. Mater. 2010, 11, 014108. (51) Wang, X.; Hu, W.; Cao, Y.; Yao, J.; Wu, J.; Gu, X. Dog Sciatic Nerve Regeneration Across a 30-Mm Defect Bridged by a Chitosan/Pga Artificial Nerve Graft. Brain 2005, 128, 1897−1910. (52) Hoveizi, E.; Tavakol, S.; Ebrahimi-Barough, S. Neuroprotective Effect of Transplanted Neural Precursors Embedded on PLA/CS Scaffold in an Animal Model of Multiple Sclerosis. Mol. Neurobiol. 2015, 51, 1334−1342. (53) Mottaghitalab, F.; Farokhi, M.; Mottaghitalab, V.; Ziabari, M.; Divsalar, A.; Shokrgozar, M. A. Enhancement of Neural Cell Lines Proliferation Using Nano-Structured Chitosan/Poly (Vinyl Alcohol) Scaffolds Conjugated with Nerve Growth Factor. Carbohydr. Polym. 2011, 86, 526−535. (54) Samadikuchaksaraei, A.; Gholipourmalekabadi, M.; Farhadihosseinabadi, B.; Rezvani, Z.; Mozafari, M. Carboxymethyl Chitosan/Forsterite Bone Tissue Engineering Scaffolds: Correlations Between Composition and Physico-Chemical Characteristics. Biointerface. Res. Appl. Chem. 2016, 6, 1222−1228. (55) Bagher, Z.; Azami, M.; Ebrahimi-Barough, S.; Mirzadeh, H.; Solouk, A.; Soleimani, M.; Ai, J.; Nourani, M. R.; Joghataei, M. T. Differentiation of Wharton’s Jelly-Derived Mesenchymal Stem Cells into Motor Neuron-Like Cells on Three-Dimensional Collagen-Grafted Nanofibers. Mol. Neurobiol. 2016, 53, 2397−2408. (56) Zhang, Q.; Zhao, Y.; Yan, S.; Yang, Y.; Zhao, H.; Li, M.; Lu, S.; Kaplan, D. L. Preparation of Uniaxial Multichannel Silk Fibroin Scaffolds for Guiding Primary Neurons. Acta Biomater. 2012, 8, 2628− 2638. (57) Arthur, A.; Rychkov, G.; Shi, S.; Koblar, S. A.; Gronthos, S. Adult Human Dental Pulp Stem Cells Differentiate Toward Functionally Active Neurons Under Appropriate Environmental Cues. Stem Cells 2008, 26, 1787−1795. 11403


Research Article

ACS Applied Materials & Interfaces (58) Chun, S. Y.; Soker, S. Differentiation of Human Dental Pulp Stem Cells into Dopaminergic Neuron-like Cells in Vitro. J. Korean Med. Sci. 2016, 31, 171. (59) Daltoe, F. P.; Mendonca, P. P.; Mantesso, A.; Deboni, M. C. Can SHED or DPSCs be Used to Repair/Regenerate Non-dental Tissues? A Systematic Review of In vivo Studies. Braz. oral Res. 2014, 28, 1−7. (60) Karaöz, E.; Demircan, P. C.; Sağlam, Ö .; Aksoy, A.; Kaymaz, F.; Duruksu, G. Human Dental Pulp Stem Cells Demonstrate Better Neural and Epithelial Stem Cell Properties than Bone Marrow-Derived Mesenchymal Stem Cells. Histochem. Cell Biol. 2011, 136, 455−473. (61) Huang, A. H. C.; Snyder, B. R.; Cheng, P. H.; Chan, A. W. Putative Dental Pulp-Derived Stem/Stromal Cells Promote Proliferation and Differentiation of Endogenous Neural Cells in the Hippocampus of Mice. Stem Cells 2008, 26, 2654−2663. (62) Mori, H.; Hara, M. Clusters of Neural Stem/Progenitor Cells Cultured on a Soft Poly (Vinyl Alcohol) Hydrogel Crosslinked by Gamma Irradiation. J. Biosci. Bioeng. 2016, 121, 584−590.

11404


Poly(vinyl alcohol) - American

Recommend Documents