Porphyromonas gingivalis Infection Promoted the Proliferation of Oral

Article Cite This: ACS Infect. Dis. XXXX, XXX, XXX−XXX

pubs.acs.org/journal/aidcbc

Porphyromonas gingivalis Infection Promoted the Proliferation of Oral Squamous Cell Carcinoma Cells through the miR-21/PDCD4/ AP‑1 Negative Signaling Pathway Chunrong Chang,† Hongyan Wang,† Junchao Liu,† Chunling Pan,† Dongmei Zhang,† Xin Li,† and Yaping Pan*,†,‡

Downloaded via UNIV OF ROCHESTER on July 22, 2019 at 02:06:12 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

Department of Periodontics, School of Stomatology, China Medical University, No. 117 Nanjing North Street, Shenyang, Liaoning 110002, China ‡ Department of Oral Biology, School of Stomatology, China Medical University, No. 117 Nanjing North Street, Shenyang, Liaoning 110002, China S Supporting Information *

ABSTRACT: Recent epidemiological studies have revealed that Porphyromonas gingivalis, a major pathogen in periodontal disease, is associated with the development of oral squamous cell carcinoma (OSCC). However, the underlying mechanisms induced by P. gingivalis have not been well-defined. We aimed to determine the role of P. gingivalis in OSCC proliferation and the relevant molecular mechanisms. A cellular proliferation model of OSCC Tca8113 cells infected by P. gingivalis at a multiplicity of infection (MOI) of 50 was established. Cell proliferation was drastically increased in the infected cells compared with the control cells, while the proportion of cells in S phase was increased and the proportion of cells in G1 phase was decreased in the infected cells compared with the control cells. Additionally, the levels of activator protein 1 (AP-1; c-Jun and c-Fos) and its target gene cyclin D1 were increased in P. gingivalis-infected Tca8113 cells compared with control cells. miR-21 expression was elevated when programmed cell death 4 (PDCD4) expression was downregulated. Cyclin D1 expression was regulated by miR-21, PDCD4, and AP-1. The disruption of the pathway by silencing c-Jun, blocking miR-21 expression, or overexpressing PDCD4 led to decreased cyclin D1 expression and inhibited cell proliferation. P. gingivalis DNA levels were positively correlated with miR-21 and c-Jun expression and negatively correlated with PDCD4 expression in clinical OSCC samples. Our findings indicated that P. gingivalis might promote OSCC proliferation by regulating cyclin D1 expression via the miR-21/PDCD4/AP-1 negative feedback signaling pathway. KEYWORDS: Porphyromonas gingivalis, OSCC, miR-21, cell proliferation, AP-1, cyclin D1 (IHGE) cells and periodontal ligament fibroblasts and regulate the cell cycle by upregulating the expression of cyclin D1, E1, and E2.12,13 Long-term infection with P. gingivalis can change the cell cycle of oral epithelial cells and accelerate cell proliferation.14 P. gingivalis might also influence the progression of oral squamous cell carcinoma (OSCC) by regulating the proliferative ability of OSCC cells. However, few studies have revealed molecular events downstream of P. gingivalis infection that could induce carcinogenesis. Cyclin D1 is an important regulatory factor of cell proliferation. The overexpression of cyclin D1 can shorten the G1 phase and reduce cell volume, which might result in uncontrolled cell proliferation.15 c-Jun, which forms a homodimeric activator protein 1 (AP-1) or a heterodimeric AP-1 with Jun or Fos, is the regulatory factor upstream of cyclin

C

hronic inflammation is widely considered to be a cause of cancer. Periodontitis is one of the most common chronic inflammatory diseases.1 This disease may cause or promote the development of oral cancer by causing systemic inflammatory responses.2,3 Moraes et al. and Tezal et al. reported that tooth loss or periodontal disease was associated with a significantly increased risk of oral cancers in patients.4,5 Within the tumor microenvironment of oral cancer patients with periodontitis, chronic inflammatory cells and multiple pathogens might accordingly change the biological behaviors of oral cancer cells. Porphyromonas gingivalis, a keystone pathogen in periodontal disease, is known as an independent microorganism risk factor for increased orodigestive tumor mortality.4,6,7 As previously reported, the P. gingivalis detection rate can reach up to 85.7% in subgingival plaques from chronic periodontitis patients.8 P. gingivalis could also be detected in the buccal mucosa, back of the tongue, and saliva.9−11 Our team found that pathogenic bacteria could invade immortal human gingival epithelial © XXXX American Chemical Society

Received: January 27, 2019 Published: June 6, 2019 A

DOI: 10.1021/acsinfecdis.9b00032 ACS Infect. Dis. XXXX, XXX, XXX−XXX

ACS Infectious Diseases

Article

Figure 1. P. gingivalis induced cell proliferation and cell cycle alteration. (A) Tca8113 cells were infected with P. gingivalis for 12, 24, 48, and 72 h at MOIs of 1, 10, 50, and 100. OD 450 was determined by the CCK-8 method. The data are shown as the mean ± SD of three independent experiments. (B) Cells infected with P. gingivalis ATCC 33277, P. gingivalis W83, heat-inactivated P. gingivalis ATCC 33277, and P. gingivalis-derived LPS. OD 450 was determined by the CCK-8 method. The data are shown as the mean ± SD of three independent experiments. *P < 0.05 compared with control cells at the same time point. HK: heat-inactivated P. gingivalis ATCC 33277. (C, D) Tca8113 cells were infected with P. gingivalis ATCC 33277 for 12, 24, and 48 h at an MOI of 50. Cell cycle distribution was detected by flow cytometry. *P < 0.05 compared with control group.

■

D1.16,17 The AP-1 dimer regulates numerous signaling pathways involved in cell survival, including cellular proliferation, apoptosis, differentiation, survival, cell migration, and transformation at the transcriptional level.17−19 Recently, research found that specific miRNAs contributed to oral carcinogenesis, while several miRNAs could serve as biomarkers for diagnosis, prognosis, and metastasis prediction in OSCC patients.20 miR-21 plays a pathogenic role in the development of oral cancer.21 Programmed cell death 4 (PDCD4), the direct target gene of miR-21, is downregulated in oral squamous carcinoma tissue.22 We hypothesized that the interaction of miR-21 and PDCD4 with the transcription factor AP-1 might play an important role in OSCC. In addition to live P. gingivalis, which might play a role in cell proliferation, important toxicity factors, such as lipopolysaccharide (LPS), from P. gingivalis and heat-killed P. gingivalis might also have different effects on cell proliferation. Our study attempts to use miRNA and transcription factor coregulation as a novel approach to clarify the carcinogenic role of P. gingivalis in OSCC. To achieve this goal, we conducted clinical histological studies. We look forward to revealing the effects of periodontal microorganisms on OSCC.

RESULTS Infection and Invasion of the OSCC Cell Line Tca8113 by P. gingivalis. To observe whether P. gingivalis ATCC 33277 could survive for extended periods and spread in OSCC cells, Tca8113 cells were incubated for 24 h with P. gingivalis at a multiplicity of infection (MOI) of 50. P. gingivalis was recovered from the Tca8113 cell lysates. Each cell lysate contained 5.3 ± 3.1 CFU in the infection group and 3.2 ± 1.3 CFU in the invasion group (Figure S1A). Cells were observed by transmission electron microscopy (Figure S1). The bacteria that adhered to the cell membrane are shown in Figure S1C, and the organisms that invaded the cell cytoplasm are shown in Figure S1D. Determination of Tca8113 Cell Proliferation and Cell Cycle Progression. The proliferation rate of Tca8113 cells infected with P. gingivalis ATCC 33277 at an MOI of 1 was not significantly different from that of uninfected cells (control) (P > 0.05). However, proliferation was increased in Tca8113 cells infected at MOIs of 100, 50, and 10 compared with control cells. The proliferation rate was markedly increased in Tca8113 cells infected with P. gingivalis ATCC 33277 at an MOI of 100 at 12 h and an MOI of 10 between 48 and 72 h compared with control cells (P < 0.05). In contrast, at an MOI of 50, there was a significant difference in Tca8113 cell proliferation at every time B



Article

Figure 2. P. gingivalis induced the expression of cyclin D1 and its upstream transcription factor AP-1 (c-Jun and c-Fos). (A) Tca8113 cells were infected with P. gingivalis for 12, 24, and 48 h at an MOI of 50. Cyclin D1 mRNA expression was measured by quantitative RT-PCR using specific primers. The data were normalized to GAPDH mRNA expression. The data were calculated as relative gene expression by the 2−ΔΔCT method and are shown as the mean ± SD of three experiments. *P < 0.05 and **P < 0.01 compared with the control group. (B, C) Tca8113 cells were infected with P. gingivalis for 12, 24, and 48 h at an MOI of 50. The protein expression of cyclin D1, p-c-Jun, p-c-Fos, c-Jun, and c-Fos was detected by Western blot analysis. Anti-GAPDH antibodies were used as a loading control. *P < 0.05 compared with the control group. (D) Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50. A chromatin immunoprecipitation assay with real-time quantitative PCR showed that P. gingivalis infection increased the binding of cyclin D1 to AP-1 in Tca8113 cells. Data shown are representative of three independent experiments.

expression of cyclin D1, p-c-Jun, and p-c-Fos in the Tca8113 cells infected with P. gingivalis was significantly higher than that in the control cells at 12, 24, and 48 h (P < 0.05) (Figure 2B,C). P. gingivalis infection promoted the binding of c-Jun to cyclin D1 in Tca8113 cells. To detect whether c-Jun can bind to the promoter region of cyclin D1, we analyzed the promoter sequence of cyclin D1 and identified AP-1 binding sites in the promoter of cyclin D1 with the sequence 5′-CTACTCA-3′, according to Manuel’s assay.23 We used the ChIP method and confirmed the binding of c-Jun to the promoter region of cyclin D1. The expression of the cyclin D1 gene was higher in the P. gingivalis-infected cells than the control cells (Figure 2D). Expression of miR-21 and Its Target Gene in Tca8113 Cells Infected by P. gingivalis ATCC 33277. As shown in the figure, miR-21 expression was significantly increased in Tca8113 cells infected with P. gingivalis compared with control cells (P < 0.05) (Figure 3A). The expression of PDCD4, one of the target genes of miR-21 (http://www.microrna.org/microrna/home. do/), was also significantly decreased (P < 0.05) in cells infected with P. gingivalis compared with control cells (Figure 3B−D). Specifically, the mRNA and protein levels of PDCD4 were significantly negatively correlated with the levels of miR-21 (Figure 3E) (P < 0.05). Compared with the control condition, the inhibition of miR21 expression decreased cell proliferation (P < 0.05) (Figure 4A−C). Accordingly, the mRNA and protein levels of PDCD4

point (from 12 to 72 h), and the difference was most significant at 24 h (P < 0.05) (Figure 1A). The proliferative effect of P. gingivalis W83 on cells was similar to that of P. gingivalis ATCC 33277 (P < 0.05 vs control). Heat-inactivated P. gingivalis ATCC 33277 had no marked effect on proliferation (P > 0.05 vs control), while P. gingivalis LPS (1 μg/mL) had a slight effect on cell proliferation (P < 0.05 vs control) (Figure 1B). Thus, we used a proliferative model of Tca8113 cells infected with P. gingivalis ATCC 33277 at an MOI of 50 for the following experiments. The cell cycle progression data are shown in Figure 1C,D. The cells were starved for 24 h before they were incubated with bacteria. At 12−48 h after infection, the percentage of cells in the G0/G1 phase was decreased, while the percentage of cells in the S phase was increased in the P. gingivalis-infected group compared with the control group. These results suggested that P. gingivalis promoted cell proliferation by accelerating the G1 phase. Expression of Cyclin D1 and AP-1 (c-Jun and c-Fos) in Tca8113 Cells Infected with P. gingivalis ATCC 33277. To study the mechanisms of proliferation promoted by P. gingivalis, we first assessed the cell cycle protein cyclin D1 and its upstream transcription factor AP-1 (c-Jun and c-Fos). Tca8113 cells were stimulated with bacteria at an MOI of 50 over 12, 24, and 48 h. Compared with the control condition, P. gingivalis infection increased the level of cyclin D1 mRNA (Figure 2A). The protein C



Article

Figure 3. P. gingivalis induced changes in miR-21 and PDCD4 expression in Tca8113 cells. Tca8113 cells were infected with P. gingivalis at an MOI of 50 for 12, 24, and 48 h. (A) miR-21 expression was measured by qRT-PCR using specific primers. The data were normalized to U6 expression and were analyzed as described in Figure 2A. (B) PDCD4 mRNA expression was measured by quantitative RT-PCR using specific primers. The data were normalized to GAPDH mRNA expression and were analyzed. (C, D) The level of PDCD4 protein was detected by Western blot analysis. AntiGAPDH antibodies were used as a loading control. (E) The correlations between the content of miR-21 and the expression of PDCD4 mRNA were analyzed with Pearson correlation analysis (Pearson correlation coefficient R = −0.995, P = 0.005). *P < 0.05 and **P < 0.01 compared with control cells. Data shown are representative of three independent experiments.

P. gingivalis DNA and miR-21 expression and to perform immunohistochemical analysis. The level of miR-21 was significantly higher in tumor tissue than normal tissue and paracancerous tissue (P < 0.05) (Figure 7A). In OSCC tissue, P. gingivalis DNA was enriched, and there was a correlation between the P. gingivalis DNA content and the expression of miR-21 (R = 0.728) (Figure 7B). Immunohistochemical analysis showed that PDCD4 was more strongly expressed in the nuclei of normal tissue and paracancerous tissue than in cancer tissue. c-Jun was more strongly expressed in the cancer tissue group than in the other two groups of clinical samples (Figure 7C). According to the average values of integrated optical density (IOD) obtained in the immunohistochemical analysis of the samples, we found that the DNA content of P. gingivalis was negatively related to PDCD4 and positively related to c-Jun in cancer tissue (Figure 7D,E).

cells were significantly higher (P < 0.05), and the mRNA and protein levels of cyclin D1 were significantly lower (P < 0.01) in the miR-21-inhibited group than the control group (Figure 4D− F), which indicated the negative regulation of PDCD4 by miR21. The overexpression of PDCD4 by the transfection of the PDCD4-pcDNA3.1 plasmid decreased cell proliferation (P < 0.05) and decreased the levels of cyclin D1 expression and c-Jun and c-Fos phosphorylation (Figure 5A−F), which indicated the negative regulation of AP-1 (c-Jun and c-Fos) by PDCD4. When the levels of c-Jun were significantly inhibited by transfection with a siRNA plasmid, cell proliferation was inhibited (Figure 6A−C). As expected, the levels of miR-21 and cyclin D1 were markedly decreased in the transfected group compared with the control group (Figure 6D,F,G), while the levels of PDCD4 were significantly increased in the transfected group compared with the control group (P < 0.05) (Figure 6E,G). Therefore, the expression of miR-21 was positively regulated by AP-1. Clinical Tissue Detection. Samples from the cancer tissues and adjacent paracancerous tissues of 61 OSCC patients and from the normal oral tissues of 30 volunteers were used to detect

■

DISCUSSION The role of microorganisms in the promotion of oral cancer has gradually become an area of focus. Epidemiological and in vitro studies have shown that P. gingivalis is associated with the progression and metastasis of oral cancer.7,24,25 Recently, certain D



Article

Figure 4. Effects of inhibiting miR-21 on the expression of PDCD4 and cyclin D1 in Tca8113 cells. (A ) Tca8113 cells were transiently transfected with inhibitors of miR-21 (miR-21 inhibitor) or a scrambled negative control (miR-21NC). Control (control) cells were not transfected. *P < 0.05 and **P < 0.01 compared with the control group. (B) Transfected Tca8113 cells were infected with P. gingivalis for 12, 24, and 48 h at an MOI of 50. Cell proliferation was measured by a CCK-8 assay. *P < 0.05 compared with the control group. (C−E) Transfected Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50, and miR-21, PDCD4, and cyclin D1 mRNA expression in the transfected cells was detected by qRT-PCR. Data were normalized to U6 (miR-21) and GAPDH (PDCD4 and cyclin D1) expression. *P < 0.05 and **P < 0.01 compared with the untreated group. (F) Transfected Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50. The protein expression of PDCD4 and cyclin D1 was detected by Western blot analysis. Anti-GAPDH antibodies were used as a loading control. Data shown are representative of three independent experiments.

types of microorganisms, including P. gingivalis, Pseudomonas aeruginosa, and Fusobacterium nucleatum, have been detected in oral cancer tissue samples.26−29 In our previous research, 16S rRNA gene sequencing data showed that the bacterial genera Fusobacterium and Porphyromonas were more abundant in cancer tissue than paracancerous tissue; however, Streptococcus was more abundant in paracancerous tissue.30 P. gingivalis can invade and exit from epithelial cells with proper control of its population for persistent colonization and chronic infection.31 In addition, invasion of P. gingivalis can evade the immune clearance mechanism of the host and survive, propagate, and affect biologic function of host cells.32 As critically reviewed, P. gingivalis can be recognized by receptors such as proteinase-activated receptor 2 (PAR2) and P2X purinergic receptor 7 (P2X7), which meditate molecular mechanisms associated with cell cycle and apoptosis as well as cell metastasis.33 Our team previously established a novel model in which P. gingivalis infected human immortalized oral epithelial cells

(HIOECs) at an MOI of 1 over 23 weeks. The bacteria-infected cells were found to exhibit tumorigenic properties.14 This study was the first time that a low dose of P. gingivalis was observed to promote tumorigenic alterations in normal cells similar to those of early stage tumor development. To further explore the role of P. gingivalis in tumor progression, an OSCC Tca8113 cell infection model with P. gingivalis at an MOI of 50 was established. We found that P. gingivalis promoted cell proliferation and altered cell cycle distribution with a reduced proportion of cells in the G1 phase and an increased proportion in the S phase, which significantly affected the G1/S phase conversion of Tca8113 cells. Rapid entry into the S phase, the DNA synthesis phase, and accelerated synthesis speed can cause cells to undergo uncontrolled proliferation through the overexpression of cyclin D1.34−36 Huang et al. reported that cyclin D1 was overexpressed in OSCC and was related to poor clinical outcomes in Taiwanese people.37 As previously reported, P. gingivalis could promote chemical-induced tongue tumorigenesis and increase cyclin D1 expression in tumor tissue E



Article

Figure 5. Effect of PDCD4 overexpression on AP-1 and cyclin D1 expression in Tca8113 cells. (A, B) Tca8113 cells were transiently transfected with PDCD4-pcDNA3.1 (PDCD4-pcDNA3.1) or a scrambled negative control (pcDNA3.1). Control (control) cells were not transfected. *P < 0.05 and **P < 0.01 compared with the control group. (C) Transfected Tca8113 cells were infected with P. gingivalis for 12, 24, and 48 h at an MOI of 50. Cell proliferation was determined by a CCK-8 assay. *P < 0.05 compared with the control group. (D, E) Transfected Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50. PDCD4 and cyclin D1 mRNA expression was detected by qRT-PCR. Data were normalized to GAPDH mRNA expression. *P < 0.05 and **P < 0.01 compared with the untreated group. (F) Transfected Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50. The protein expression of c-Fos, p-c-Fos, c-Jun, p-c-Jun, and cyclin D1 was detected by Western blot analysis. Anti-GAPDH antibodies were used as a loading control. Data shown are representative of three independent experiments.

in a mouse model.38 In this study, the expression of cyclin D1 was significantly increased in Tca8113 cells infected with P. gingivalis compared with control cells. P. gingivalis might promote cell proliferation by increasing cyclin D1 expression to accelerate OSCC cell cycle progression. The regulatory effect of transcription factors on cell cycle proteins cannot be ignored. The AP-1 transcription factor can promote multiple cell proliferation pathways in tumor promotion and progression by upregulating cyclin D1 expression.39,40 In the present study, we also identified that c-Jun in the AP-1 dimer could bind to the promoter region of cyclin D1 and control the expression of cyclin D1, which contributed to the increased proliferation of OSCC cells. The dimeric subunits of AP-1 (Jun and Fos) are some of the key transcription factors of miR-21.41 High miR-21 expression can be used as an indicator for the diagnosis and prognosis of gastric cancer, liver cancer, and specific oral cancers since the increased levels of miR-21 are related to the severity of the lesion and have good predictive value for malignant transformation.21,42,43 miR-21 expression was higher in PDCD4-negative OSCC tissue than PDCD4-positive OSCC tissue, which indicated that miR-21 could downregulate the expression of PDCD4.22 PDCD4 has also been identified as a suppressor of tumorigenesis with low expression in a wide variety of tumors, such as osteosarcoma, colon carcinoma, and hepatocellular carcinoma.44−46 Our study determined that P. gingivalis increased the expression of miR-21 and decreased the expression of PDCD4 in Tca8113 cells. Similarly, by inhibiting miR-21 or c-

Jun or overexpressing PDCD4, miR-21 could enhance the activity of AP-1 by reversing PDCD4 expression, which in turn further promoted miR-21 expression. Once this negative feedback pathway was activated, it could continuously increase the expression of the downstream gene cyclinD1 to possibly promote uncontrolled cell proliferation, which probably led to additional malignant behaviors. Although the negative feedback pathway of miR-21/PDCD4/AP-1 exists in some tumors, such as glioblastoma and hepatocellular carcinoma,47,48 this study was the first to find that bacteria such as P. gingivalis could promote cell proliferation through the miR-21/PDCD4/AP-1 pathway. The results from the clinical tissue samples further suggested that miR-21/PDCD4/AP-1 might play a key role in the P. gingivalis-induced changes in the biological behavior of tumor cells. Similar to P. gingivalis ATCC 33277, P. gingivalis W83 also promoted Tca8113 cell proliferation. This result was consistent with a study by Pan et al.,12 which divided P. gingivalis strains into avirulent (e.g., ATCC 33277) and virulent (e.g., W83) strains according to their ability to promote abscess formation.49 Additionally, many virulence factors, including LPS and proteinases, were nearly identical in both strains of P. gingivalis. However, P. gingivalis W83 was naturally deficient in the production of both long and short fimbriae50 and had a thick capsule.51 Thus, the proliferation-promoting effect of P. gingivalis on Tca8113 cells is widely distributed among strains, implying that neither the fimbriae nor the capsule is involved in this process. Live P. gingivalis secrete many biologically active F



Article

Figure 6. Effects of silencing c-Jun on miR-21, PDCD4, and cyclin D1 in Tca8113 cells. (A, B) Tca8113 cells were transiently transfected with an siRNA targeted to c-Jun (c-Jun siRNA) or scrambled negative control (con siRNA). Control (control) cells were not transfected. *P < 0.05 and **P < 0.01 compared with the control group. (C) Transfected Tca8113 cells were infected with P. gingivalis for 12, 24, and 48 h at an MOI of 50. Cell proliferation was determined by a CCK-8 assay. *P < 0.05 compared with the control group. (D−F) Transfected Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50. The miR-21, PDCD4, and cyclin D1 mRNA levels of the transfected cells were detected by qRT-PCR. Data were normalized to U6 (miR-21) and GAPDH (PDCD4 and cyclin D1) expression. *P < 0.05 and **P < 0.01 compared with the untreated group. (G) Transfected Tca8113 cells were infected with P. gingivalis for 24 h at an MOI of 50. The protein expression of PDCD4 and cyclin D1 was detected by Western blot analysis. Anti-GAPDH antibodies were used as a loading control. Data shown are representative of three independent experiments.

substances and metabolites, but inactive bacteria do not.52 Live P. gingivalis could increase Bcl-2 to suppress apoptosis in primary gingival epithelial cells, while heat-treated P. gingivalis did not induce Bcl-2.53 This finding indicated that heat-inactivated P. gingivalis did not markedly affect the proliferation of Tca8113 cells. LPS is a unique component of the cell wall of P. gingivalis. In vitro studies have confirmed that whole bacteria and the LPS molecules isolated from these bacteria induce similar responses. Soto et al. reported that the O-antigen region of P. gingivalis LPS could increase gingival epithelial cell viability and reduce apoptosis via TLR4.54 We speculated that LPS might interact with other active substances to promote Tca8113 cell proliferation. Gingipain has also been reported to promote cell proliferation.55 The effects of different virulent factors of P. gingivalis on cell proliferation still need further study. We acknowledge some limitations of our present work. In this study, the role of P. gingivalis in OSCC development and progression and the underlying mechanisms were identified. Other periodontal pathogens and nonpathogenic bacteria should be included in future studies to explore the specific role of P. gingivalis and the possible effects of other periodontal

pathogens in OSCC. In addition, because tongue squamous cell carcinoma was the most common type of OSCC,46 we used the Tca8113 cell line in this study. In the near future, other types of OSCC cell lines and primary cells from different OSCC tissues should be applied to better understand the possible relationship between P. gingivalis and OSCC. In conclusion, our current findings provide critical insights into the molecular mechanisms by which the miR-21/PDCD4/ AP-1 negative feedback pathway could increase cyclin D1 expression to accelerate the OSCC cell proliferation induced by P. gingivalis (Scheme 1). In addition, clinical tissue studies confirmed this view. The removal of P. gingivalis as well as suspected microorganisms might result in significant benefits in OSCC treatment. Our model may offer a new approach not only to further understand the connection between P. gingivalis and OSCC but also to develop novel prevention/treatment strategies for OSCC patients with chronic oral infection.

■

MATERIALS AND METHODS Bacterial Strains. P. gingivalis ATCC 33277 and P. gingivalis W83 (American Type Culture Collection) were cultured as G



Article

Figure 7. miRNA, PDCD4 and c-Jun detection in clinical tissue samples. Samples included the cancer tissues and adjacent paracancerous tissues of 61 OSCC patients and the normal oral tissue of 30 volunteers. Bacterial DNA and miR-21 were extracted from the tissue samples. (A) miR-21 expression was measured by qRT-PCR using specific primers. miR-21 was normalized to U6. These samples were normalized to the median expression sample of the control group. *P < 0.05 and **P < 0.01 compared with the control group; # P < 0.05 compared with the paracancerous tissue group. (B) The correlation between the content of P. gingivalis DNA and the level of miR-21 was analyzed with Pearson correlation analysis (Pearson correlation coefficient R = 0.728, P < 0.01). (C) Immunohistochemical analysis of PDCD4 and c-Jun expression in clinical tissue samples. *P < 0.05 and **P < 0.01 compared with the control group; #P < 0.05 compared with the paracancerous tissue group. Scale bars: 100 μm. (D, E) The correlations between the content of P. gingivalis DNA and the IOD average values of PDCD4 and c-Jun were analyzed with Pearson correlation analysis (Pearson correlation coefficient R = −0.454 and R = 0.402; P < 0.01 and P < 0.01).

previously described.12 Briefly, the bacteria were anaerobically cultured in brain-heart infusion agar medium (Difco Laboratories, MI, USA). Bacteria grown in liquid medium for 16−18 h were collected and cleaned twice in phosphate-buffered saline (PBS). Tca8113 OSCC Cell Culture. The Tca8113 OSCC cells from the Chinese Academy of Sciences Cell Bank are tongue squamous carcinoma cells with biological characteristics of tumor cells.56,57 Cells were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum at 37 °C and 5% CO2. Cells were infected with P. gingivalis at the

indicated multiplicity of infection (MOI) and incubated under normal cell culture conditions for the appropriate time. Infection and Invasion of Tca8113 Cells by P. gingivalis. The infection and invasion models used in this study have been previously described.58 Briefly, Tca8113 cells were cultured to 80% confluency for all experiments. P. gingivalis ATCC 33277 resuspended in PBS was added to the Tca8113 cells at an MOI of 50. The Tca8113 cells were incubated for 24 h with P. gingivalis at 37 °C and 5% CO2. In the infection group, the cells were lysed with sterile distilled water for 0.5 h, and the bacteria were inoculated on brain-heart infusion agar medium H



Article

room temperature in the dark for over 30 min. The cell cycle distribution of 10 000 cells per sample was detected by a flow cytometer (FACS, Becton-Dickinson, Islandia, NY, USA). qRT-PCR Analysis of Tca8113 Cells (mRNA and miRNA). Tca8113 cells were incubated with P. gingivalis ATCC 33277 at an MOI of 50 for the appropriate time. Total RNA was extracted from the cells as previously described.12 mRNA reverse transcription reactions were conducted with the RTase cDNA Synthesis Kit (Takara, Dalian, China), and quantitative real-time PCR (qRT-PCR) was conducted with SYBR Green Ex Taq (Takara, Dalian, China) according to the manufacturer’s instructions as previously described.12 GAPDH was used as an internal control. The reverse transcription of miRNAs in total mRNA was subsequently performed using a Mir-X miRNA First-Strand Synthesis kit (Clontech, USA) according to the manufacturer’s instructions. qRT-PCR was conducted with SYBR Green Ex Taq (Takara, Dalian, China). U6 snRNA was used as an internal control. All of the specific qPCR primers are shown in Table S1. Fold changes in the level of each gene were calculated by the 2−ΔΔCT method. The ABI 7500 Real-Time PCR Detection System (Applied Biosystems, Carlsbad, CA, USA) was used. Western Blot Analysis of Tca8113 Cells. Cells were lysed with RIPA lysis buffer (Beyotime Biotech. Co., Shanghai, China) containing protease inhibitor (1 mM). The protein concentration was measured with a bicinchoninic acid assay kit (Beijing Dingguo Changsheng, Beijing, China). Equal amounts of protein were loaded onto 8% polyacrylamide-SDS gels. Electrophoresed proteins were transferred onto nitrocellulose membranes. The membranes were then blocked with 5% fat-free milk. The blots were incubated with the following antirabbit primary antibodies at 4 °C overnight: anti-c-Fos diluted 1:1000 (Cell Signaling Technology, USA), anti-c-Jun diluted 1:1000 (Cell Signaling Technology, USA), anti-PDCD4 diluted 1:1000 (Cell Signaling Technology, USA), anti-GAPDH diluted 1:1000 (Cell Signaling Technology, USA), anticyclin D1 diluted 1:100 (Abcam, Cambridge, MA, USA), anti-p-c-Jun diluted 1:500 (Abcam, Cambridge, MA, USA), and anti-p-c-Fos diluted 1:500 (Abcam, Cambridge, MA, USA). A goat antirabbit IgG IRDye1 800CW secondary antibody (Proteintech Group, Chicago, IL, USA) was used for 1 h at room temperature. These blots were measured and analyzed using an Odyssey CLX (LI-COR). ChIP of Tca8113 Cells. Chromatin immunoprecipitation (ChIP) reactions were performed with the ChIP Assay Kit (Millipore, Merck KGaA, Darmstadt, Germany) according to the product’s instructions. Tca8113 cells were infected with P. gingivalis for 24 h. The cells were cross-linked and quenched. Then, the cells were resuspended in lysis buffer on ice. The cell lysates were sonicated into 200−1000 base pair fragments. After centrifugation, the supernatant containing chromatin and magnetic beads was incubated with specific antibodies, either anti-c-Jun or normal mouse immunoglobulin G (IgG, Santa, USA), at 37 °C overnight for immunoprecipitation. The DNA/ antibody/magnetic bead complexes were washed. Next, the purified chromatin DNA samples were analyzed (primers in Table S1) for the promoter of the cyclin D1 gene by real-time PCR. Three independent reactions were performed. miRNA, PDCD4, and c-Jun Transfection into Tca8113 Cells. The first group of cells was transfected with a miR-21 inhibitor or a negative control of chemically synthesized oligonucleotides (miRNA21 inhibitor: UCAACUCAGUCUGAUAAGCUA; miRNA inhibitor NC: CAGUACUUUU-

Scheme 1. Schematic of the Negative Feedback Signaling Loop

(Difco Laboratories, MI, USA) and cultured under anaerobic conditions. In the invasion group, Tca8113 cells were incubated at 37 °C and 5% CO2 in RPMI 1640 medium supplemented with 200 mg/mL gentamicin (Sigma-Aldrich) and 300 mg/mL metronidazole (Sigma-Aldrich) for an additional 1 h to kill extracellular and surface-attached bacteria. Then, the cells were lysed. Colony forming units (CFU) of bacteria and number of Tca8113 cells were counted. Tca8113 Cell Transmission Electron Microscopy. Tca8113 cells were infected with P. gingivalis ATCC 33277 at an MOI of 50 for 24 h. Infected Tca8113 cells and control cells were trypsinized and fixed in 1 mL of 2.5% glutaraldehyde at 4 °C for 12 h. Then, the cells were fixed with osmium for 1 h and dehydrated for 30 min in each solution of a graded series of 30%, 50%, and 70% ethanol and 80%, 90%, and 100% acetone. Then, the samples were vacuum-dried, embedded with EPON-812 epoxy resin, and sliced into ultrathin sections. The sections were stained with uranium acetate−citrate and observed with a transmission electron microscope (BX51TF, OLYMPUS, Japan). CCK-8 Cell Proliferation Assay with Tca8113 Cells. Cell proliferation was detected by a cell counting kit-8 (CCK-8, Keygen Biotech, China) following the manufacturer’s instructions.59 Tca8113 cells (3 × 103 cells/well) were plated in 96-well plates cultured with one of the following for 12, 24, 48, and 72 h: P. gingivalis ATCC 33277 (MOIs of 1, 10, 50, and 100); P. gingivalis W83 (MOI of 50); heat-killed P. gingivalis ATCC 33277 (MOI of 50), which was killed by heating at 70 °C for 1 h;60 or P. gingivalis-derived LPS (1 μg/mL, InvivoGen, San Diego, USA). Ten microliters of CCK-8 was added to each well. Then, the 96-well plates were incubated for 2 h at 37 °C. The wells with only RPMI 1640 medium were used as blank controls. The absorbance of the colored solution was quantified at 450 nm using a microplate reader (Tecan, Untersbergstrasse, Austria). Tca8113 Cell Cycle Assays. Cultured Tca8113 cells were incubated with P. gingivalis ATCC 33277 for 12, 24, and 48 h at an MOI of 50. Cells were collected with trypsin and fixed in 70% ethanol at 4 °C overnight. These cells were added to propidium iodide (50 μg/mL) and RNase (10 μg/mL) in 500 μL of PBS at I



Article

and eosin (H&E) staining according to a previously described protocol.22 IHC staining was performed using the Avidin− Biotin method.63 Sections were incubated with anti-c-Jun (1:400, Cell Signaling Technology, USA) and anti-PDCD4 (1:300, Cell Signaling Technology, USA) antibodies. Immunohistochemical results were analyzed by the integral optical density method. Statistical Analyses. Each experiment was performed at least three times. The continuous variables of two groups were compared with t tests. Multiple groups were analyzed with ANOVA. Statistical data were analyzed with the SPSS 17.0 software package (SPSS Inc., Chicago, IL, USA). P-values < 0.05 were considered statistically significant.

GUGUAGUACAA). The second group of cells was transfected with pcDNA3.1-PDCD4 or a negative control (pcDNA3.1) (Wanlei Life Sciences Co., Ltd., Shenyang, China). The third group of cells was transfected with a c-Jun siRNA or a negative control (con siRNA). Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was applied at the indicated concentrations according to the supplier’s instructions. Patients and Specimen Collection. Samples of cancer tissues and adjacent paracancerous tissues were obtained from 61 OSCC patients, and normal oral tissue samples were obtained from 30 volunteers at the Affiliated Stomatological Hospital of China Medical University between 2013 and 2014. The cancer tissue and paracancerous tissue originated from lesions and safety margins of patients with malignant tumors.61 A total of 39 males and 22 females were included in the study, and the average age of the cancer patients was 57.4 ± 10.4 years. All patients had primary oral cancer without other types of malignant tumors. Tumor diagnosis and the histological grading of tissues were completed in the tissue pathology laboratory at the Affiliated Stomatological Hospital of China Medical University. The volunteers who provided normal control tissue had no periodontal disease. These isolated normal tissues were collected during implant surgery, crown lengthening, or gingival tissue removal after the removal of wisdom teeth. The average age of the control group was 55.4 ± 10.2 years, and this group included 18 males and 12 females. Written informed consent was obtained from all patients. This experiment was approved by the ethics committee of the Affiliated Stomatological Hospital of China Medical University. The ethics approval number is G2014006. Each specimen (approximately 0.5 cm3) was collected in an Eppendorf (EP) tube that was frozen at −80 °C or immediately used for DNA and miRNA extraction,62 and additional specimens were dipped in formalin for fixation and paraffin embedding in preparation for immunohistochemical detection. qPCR for Bacterial DNA in Clinical Tissues. Clinical tissue samples were homogenized, and DNA was extracted using the QIAampFast DNA Stool Mini Kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. qPCR was used to quantify the abundance of P. gingivalis species. A standard curve was made by amplifying the 16S rRNA of P. gingivalis with P. gingivalis primers (primers in Table S1). qPCR was conducted with SYBR Green Ex Taq (Takara, Dalian, China) according to the product’s instructions as previously described.12 The number of fragment copies was calculated using the following formula:

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsinfecdis.9b00032. Figure of infection and invasion of P. gingivalis in the oral squamous cell carcinoma cell line Tca8113; table of primer sequences used in this study (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Chunrong Chang: 0000-0002-2940-3415 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors would like to thank Dr. Hongyang Wang from the Department of Medicine, Center for Immunity, Inflammation & Regenerative Medicine, University of Virginia, Charlottesville, VA, USA, for her assistance during the revision process of this paper. This study was supported by Grants from the National Natural Science Foundation of China (Nos. 81470745 and 81670997).

■

REFERENCES

(1) Zheng, X. Y., Mao, C. Y., Qiao, H., Zhang, X., Yu, L., Wang, T. Y., and Lu, E. Y. (2017) Plumbagin suppresses chronic periodontitis in rats via down-regulation of TNF-alpha, IL-1beta and IL-6 expression. Acta Pharmacol. Sin. 38 (8), 1150−1160. (2) Hashim, D., Sartori, S., Brennan, P., Curado, M. P., Wunsch-Filho, V., Divaris, K., Olshan, A. F., Zevallos, J. P., Winn, D. M., Franceschi, S., Castellsague, X., Lissowska, J., Rudnai, P., Matsuo, K., Morgenstern, H., Chen, C., Vaughan, T. L., Hofmann, J. N., D’Souza, G., Haddad, R. I., Wu, H., Lee, Y. C., Hashibe, M., Vecchia, C. L., and Boffetta, P. (2016) The role of oral hygiene in head and neck cancer: results from International Head and Neck Cancer Epidemiology (INHANCE) consortium. Annals of oncology: official journal of the European Society for Medical Oncology 27 (8), 1619−25. (3) Toporcov, T. N., Znaor, A., Zhang, Z. F., Yu, G. P., Winn, D. M., Wei, Q., Vilensky, M., Vaughan, T., Thomson, P., Talamini, R., Szeszenia-Dabrowska, N., Sturgis, E. M., Smith, E., Shangina, O., Schwartz, S. M., Schantz, S., Rudnai, P., Richiardi, L., Ramroth, H., Purdue, M. P., Olshan, A. F., Eluf-Neto, J., Muscat, J., Moyses, R. A., Morgenstern, H., Menezes, A., McClean, M., Matsuo, K., Mates, D., Macfarlane, T. V., Lissowska, J., Levi, F., Lazarus, P., La Vecchia, C., Lagiou, P., Koifman, S., Kjaerheim, K., Kelsey, K., Holcatova, I., Herrero, R., Healy, C., Hayes, R. B., Franceschi, S., Fernandez, L.,

DNA (copy/μL) = 6.02 × 1023 (copy/mol) × DNA concentration (μg/μL)/DNA length (bp) × 660 (Daltons/bp)

Seven standards with serial dilutions were used to create a standard curve. A 20 μL qPCR reaction system was used. An ABI 7500 Real-Time PCR Detection System (Applied Biosystems, Carlsbad, CA, USA) was used. qRT-PCR of Clinical Tissue Samples. Clinical tissue was homogenized, and total RNA was extracted as previously described.12 miRNA reverse transcription reactions and qRTPCR were conducted as part of this experiment. Clinical Tissue IHC Assay. Paraffin-embedded clinical tissue samples were cut into 4 μm sections. The sections were processed for immunohistochemistry (IHC) and hematoxylin J



Article

Fabianova, E., Daudt, A. W., Curioni, O. A., Maso, L. D., Curado, M. P., Conway, D. I., Chen, C., Castellsague, X., Canova, C., Cadoni, G., Brennan, P., Boccia, S., Antunes, J. L., Ahrens, W., Agudo, A., Boffetta, P., Hashibe, M., Lee, Y. C., and Filho, V. W. (2015) Risk factors for head and neck cancer in young adults: a pooled analysis in the INHANCE consortium. International journal of epidemiology 44 (1), 169−185. (4) Moraes, R. C., Dias, F. L., Figueredo, C. M., and Fischer, R. G. (2016) Association between Chronic Periodontitis and Oral/ Oropharyngeal Cancer. Braz Dent J. 27 (3), 261−6. (5) Tezal, M., Sullivan, M. A., Hyland, A., Marshall, J. R., Stoler, D., Reid, M. E., Loree, T. R., Rigual, N. R., Merzianu, M., Hauck, L., Lillis, C., Wactawski-Wende, J., and Scannapieco, F. A. (2009) Chronic periodontitis and the incidence of head and neck squamous cell carcinoma. Cancer Epidemiol., Biomarkers Prev. 18 (9), 2406−12. (6) Ahn, J., Segers, S., and Hayes, R. B. (2012) Periodontal disease, Porphyromonas gingivalis serum antibody levels and orodigestive cancer mortality. Carcinogenesis 33 (5), 1055−1058. (7) Gao, S., Li, S., Ma, Z., Liang, S., Shan, T., Zhang, M., Zhu, X., Zhang, P., Liu, G., Zhou, F., Yuan, X., Jia, R., Potempa, J., Scott, D. A., Lamont, R. J., Wang, H., and Feng, X. (2016) Presence of Porphyromonas gingivalis in esophagus and its association with the clinicopathological characteristics and survival in patients with esophageal cancer. Infect. Agents Cancer 11, 3. (8) Lin, L., Li, C., Liu, J., Zhang, D., Zhao, J., Kou, Y., Yu, N., and Pan, Y. (2009) Virulence genes of Porphyromonas gingivalis W83 in chronic periodontitis. Acta Odontol. Scand. 67 (5), 258−64. (9) Zhou, P., Liu, J., Merritt, J., and Qi, F. (2015) A YadA-like autotransporter, Hag1 in Veillonella atypica is a multivalent hemagglutinin involved in adherence to oral streptococci, Porphyromonas gingivalis, and human oral buccal cells. Mol. Oral Microbiol. 30 (4), 269−79. (10) Zhang, T., Andrukhov, O., Haririan, H., Muller-Kern, M., Liu, S., Liu, Z., and Rausch-Fan, X. (2016) Total Antioxidant Capacity and Total Oxidant Status in Saliva of Periodontitis Patients in Relation to Bacterial Load. Front. Cell. Infect. Microbiol. 5, 97. (11) Porto, A. N., Borges, A. H., Rocatto, G., Matos, F. Z., Borba, A. M., Pedro, F. L., Lima, S. L., Tonetto, M. R., Bandeca, M. C., and Aranha, A. M. (2016) Periodontal and Microbiological Profile of Intensive Care Unit Inpatients. J. Contemp Dent Pract 17 (10), 807− 814. (12) Pan, C., Xu, X., Tan, L., Lin, L., and Pan, Y. (2014) The effects ofPorphyromonas gingivalison the cell cycle progression of human gingival epithelial cells. Oral Diseases 20 (1), 100−108. (13) Liu, J., Tang, X., Li, C., Pan, C., Li, Q., Geng, F., and Pan, Y. (2015) Porphyromonas gingivalis promotes the cell cycle and inflammatory cytokine production in periodontal ligament fibroblasts. Arch. Oral Biol. 60 (8), 1153−61. (14) Geng, F., Liu, J., Guo, Y., Li, C., Wang, H., Wang, H., Zhao, H., and Pan, Y. (2017) Persistent Exposure to Porphyromonas gingivalis Promotes Proliferative and Invasion Capabilities, and Tumorigenic Properties of Human Immortalized Oral Epithelial Cells. Front. Cell. Infect. Microbiol. 7, 57. (15) Kim, J. K., and Diehl, J. A. (2009) Nuclear cyclin D1: an oncogenic driver in human cancer. J. Cell. Physiol. 220 (2), 292−6. (16) Han, B., Rorke, E. A., Adhikary, G., Chew, Y. C., Xu, W., and Eckert, R. L. (2012) Suppression of AP1 transcription factor function in keratinocyte suppresses differentiation. PLoS One 7 (5), No. e36941. (17) Shen, Q., Uray, I. P., Li, Y., Krisko, T. I., Strecker, T. E., Kim, H. T., and Brown, P. H. (2008) The AP-1 transcription factor regulates breast cancer cell growth via cyclins and E2F factors. Oncogene 27 (3), 366−77. (18) Yadav, S., Kalra, N., Ganju, L., and Singh, M. (2017) Activator protein-1 (AP-1): a bridge between life and death in lung epithelial (A549) cells under hypoxia. Mol. Cell. Biochem. 436, 99. (19) Weekes, D., Kashima, T. G., Zandueta, C., Perurena, N., Thomas, D. P., Sunters, A., Vuillier, C., Bozec, A., El-Emir, E., Miletich, I., PatinoGarcia, A., Lecanda, F., and Grigoriadis, A. E. (2016) Regulation of osteosarcoma cell lung metastasis by the c-Fos/AP-1 target FGFR1. Oncogene 35 (22), 2852−61.

(20) Wong, T. S., Liu, X. B., Wong, B. Y., Ng, R. W., Yuen, A. P., and Wei, W. I. (2008) Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue. Clin. Cancer Res. 14 (9), 2588−92. (21) Yang, X., Li, C., and Pan, Y. (2016) The Influences of Periodontal Status and Periodontal Pathogen Quantity on Salivary 8-Hydroxydeoxyguanosine and Interleukin-17 Levels. J. Periodontol. 87 (5), 591−600. (22) Reis, P. P., Tomenson, M., Cervigne, N. K., Machado, J., Jurisica, I., Pintilie, M., Sukhai, M. A., Perez-Ordonez, B., Grenman, R., Gilbert, R. W., Gullane, P. J., Irish, J. C., and Kamel-Reid, S. (2010) Programmed cell death 4 loss increases tumor cell invasion and is regulated by miR-21 in oral squamous cell carcinoma. Mol. Cancer 9, 238. (23) Vikhanskaya, F., Toh, W. H., Dulloo, I., Wu, Q., Boominathan, L., Ng, H. H., Vousden, K. H., and Sabapathy, K. (2007) p73 supports cellular growth through c-Jun-dependent AP-1 transactivation. Nat. Cell Biol. 9 (6), 698−705. (24) Lee, J., Roberts, J. S., Atanasova, K. R., Chowdhury, N., Han, K., and Yilmaz, O. (2017) Human Primary Epithelial Cells Acquire an Epithelial-Mesenchymal-Transition Phenotype during Long-Term Infection by the Oral Opportunistic Pathogen, Porphyromonas gingivalis. Front. Cell. Infect. Microbiol. 7, 493. (25) Ha, N. H., Woo, B. H., Kim da, J., Ha, E. S., Choi, J. I., Kim, S. J., Park, B. S., Lee, J. H., and Park, H. R. (2015) Prolonged and repetitive exposure to Porphyromonas gingivalis increases aggressiveness of oral cancer cells by promoting acquisition of cancer stem cell properties. Tumor Biol. 36 (12), 9947−9960. (26) Katz, J., Onate, M. D., Pauley, K. M., Bhattacharyya, I., and Cha, S. (2011) Presence of Porphyromonas gingivalis in gingival squamous cell carcinoma. Int. J. Oral Sci. 3 (4), 209−15. (27) Byakodi, R., Krishnappa, R., Keluskar, V., Bagewadi, A., and Shetti, A. (2011) The microbial flora associated with oral carcinomas. Quintessence Int. 42 (9), No. e118-23. (28) Yang, S. F., Huang, H. D., Fan, W. L., Jong, Y. J., Chen, M. K., Huang, C. N., Chuang, C. Y., Kuo, Y. L., Chung, W. H., and Su, S. C. (2018) Compositional and functional variations of oral microbiota associated with the mutational changes in oral cancer. Oral Oncol. 77, 1−8. (29) Hooper, S. J., Crean, S. J., Fardy, M. J., Lewis, M. A., Spratt, D. A., Wade, W. G., and Wilson, M. J. (2007) A molecular analysis of the bacteria present within oral squamous cell carcinoma. J. Med. Microbiol. 56 (12), 1651−1659. (30) Chang, C., Geng, F., Shi, X., Li, Y., Zhang, X., Zhao, X., and Pan, Y. (2019) The prevalence rate of periodontal pathogens and its association with oral squamous cell carcinoma. Appl. Microbiol. Biotechnol. 103, 1393. (31) Woo, B. H., Kim, D. J., Choi, J. I., Kim, S. J., Park, B. S., Song, J. M., Lee, J. H., and Park, H. R. (2017) Oral cancer cells sustainedly infected with Porphyromonas gingivalis exhibit resistance to Taxol and have higher metastatic potential. Oncotarget 8 (29), 46981−46992. (32) Lee, K., Roberts, J. S., Choi, C. H., Atanasova, K. R., and Yilmaz, O. (2018) Porphyromonas gingivalis traffics into endoplasmic reticulum-rich-autophagosomes for successful survival in human gingival epithelial cells. Virulence 9 (1), 845−859. (33) Hajishengallis, G. (2015) Periodontitis: from microbial immune subversion to systemic inflammation. Nat. Rev. Immunol. 15 (1), 30− 44. (34) Kuboniwa, M., Hasegawa, Y., Mao, S., Shizukuishi, S., Amano, A., Lamont, R. J., and Yilmaz, O. P. (2008) gingivalis accelerates gingival epithelial cell progression through the cell cycle. Microbes Infect. 10 (2), 122−8. (35) Fu, M., Wang, C., Li, Z., Sakamaki, T., and Pestell, R. G. (2004) Minireview: Cyclin D1: normal and abnormal functions. Endocrinology 145 (12), 5439−47. (36) Junk, D. J., Cipriano, R., Stampfer, M., and Jackson, M. W. (2013) Constitutive CCND1/CDK2 activity substitutes for p53 loss, or MYC or oncogenic RAS expression in the transformation of human mammary epithelial cells. PLoS One 8 (2), No. e53776. K



Article

(53) Nakhjiri, S. F., Park, Y., Yilmaz, O., Chung, W. O., Watanabe, K., El-Sabaeny, A., Park, K., and Lamont, R. J. (2001) Inhibition of epithelial cell apoptosis by Porphyromonas gingivalis. FEMS Microbiol. Lett. 200 (2), 145−9. (54) Soto, C., Bugueno, I., Hoare, A., Gonzalez, S., Venegas, D., Salinas, D., Melgar-Rodriguez, S., Vernal, R., Gamonal, J., Quest, A. F., Perez-Donoso, J. M., and Bravo, D. (2016) The Porphyromonas gingivalis O antigen is required for inhibition of apoptosis in gingival epithelial cells following bacterial infection. J. Periodontal Res. 51 (4), 518−28. (55) Cao, C., Ji, X., Luo, X., and Zhong, L. (2015) Gingipains from Porphyromonas gingivalis promote the transformation and proliferation of vascular smooth muscle cell phenotypes. Int. J. Clin Exp Med. 8 (10), 18327−18334. (56) Hou, C., Li, W., Li, Z., Gao, J., Chen, Z., Zhao, X., Yang, Y., Zhang, X., and Song, Y. (2017) Synthetic Isoliquiritigenin Inhibits Human Tongue Squamous Carcinoma Cells through Its Antioxidant Mechanism. Oxid. Med. Cell. Longevity 2017, 1379430. (57) Sun, S. S., Zhou, X., Huang, Y. Y., Kong, L. P., Mei, M., Guo, W. Y., Zhao, M. H., Ren, Y., Shen, Q., and Zhang, L. (2015) Targeting STAT3/miR-21 axis inhibits epithelial-mesenchymal transition via regulating CDK5 in head and neck squamous cell carcinoma. Mol. Cancer 14, 213. (58) Li, Q., Pan, C., Teng, D., Lin, L., Kou, Y., Haase, E. M., Scannapieco, F. A., and Pan, Y. (2014) Porphyromonas gingivalis modulates Pseudomonas aeruginosa-induced apoptosis of respiratory epithelial cells through the STAT3 signaling pathway. Microbes Infect. 16 (1), 17−27. (59) Moriwaki, K., Ayani, Y., Kuwabara, H., Terada, T., Kawata, R., and Asahi, M. (2018) TRKB tyrosine kinase receptor is a potential therapeutic target for poorly differentiated oral squamous cell carcinoma. Oncotarget 9 (38), 25225−25243. (60) Jayaprakash, K., Khalaf, H., and Bengtsson, T. (2014) Gingipains from Porphyromonas gingivalis play a significant role in induction and regulation of CXCL8 in THP-1 cells. BMC Microbiol. 14, 193. (61) Liu, X., Shang, W., and Zheng, F. (2018) Long non-coding RNA NEAT1 promotes migration and invasion of oral squamous cell carcinoma cells by sponging microRNA-365. Exp. Ther. Med. 16 (3), 2243−2250. (62) McCoy, A. N., Araujo-Perez, F., Azcarate-Peril, A., Yeh, J. J., Sandler, R. S., and Keku, T. O. (2013) Fusobacterium is associated with colorectal adenomas. PLoS One 8 (1), No. e53653. (63) Makitie, A. A., Pintor Dos Reis, P., Arora, S., Macmillan, C., Warner, G. C., Sukhai, M., Dardick, I., Perez-Ordonez, B., Wells, R., Brown, D., Gilbert, R., Freeman, J., Gullane, P., Irish, J., and KamelReid, S. (2005) Molecular characterization of salivary gland malignancy using the Smgb-Tag transgenic mouse model. Lab. Invest. 85 (8), 947− 961.

(37) Huang, S. F., Cheng, S. D., Chuang, W. Y., Chen, I. H., Liao, C. T., Wang, H. M., and Hsieh, L. L. (2012) Cyclin D1 overexpression and poor clinical outcomes in Taiwanese oral cavity squamous cell carcinoma. World journal of surgical oncology 10, 40. (38) Binder Gallimidi, A., Fischman, S., Revach, B., Bulvik, R., Maliutina, A., Rubinstein, A. M., Nussbaum, G., and Elkin, M. (2015) Periodontal pathogens Porphyromonas gingivalis and Fusobacterium nucleatum promote tumor progression in an oral-specific chemical carcinogenesis model. Oncotarget 6 (26), 22613−22623. (39) Ming, J., Jiang, G., Zhang, Q., Qiu, X., and Wang, E. (2012) Interleukin-7 up-regulates cyclin D1 via activator protein-1 to promote proliferation of cell in lung cancer. Cancer Immunol. Immunother. 61 (1), 79−88. (40) Jia, J., Ye, T., Cui, P., Hua, Q., Zeng, H., and Zhao, D. (2016) AP1 transcription factor mediates VEGF-induced endothelial cell migration and proliferation. Microvasc. Res. 105, 103−8. (41) Lorenzen, J. M., Schauerte, C., Hubner, A., Kolling, M., Martino, F., Scherf, K., Batkai, S., Zimmer, K., Foinquinos, A., Kaucsar, T., Fiedler, J., Kumarswamy, R., Bang, C., Hartmann, D., Gupta, S. K., Kielstein, J., Jungmann, A., Katus, H. A., Weidemann, F., Muller, O. J., Haller, H., and Thum, T. (2015) Osteopontin is indispensible for AP1mediated angiotensin II-related miR-21 transcription during cardiac fibrosis. Eur. Heart J. 36 (32), 2184−96. (42) Ren, J., Kuang, T. H., Chen, J., Yang, J. W., and Liu, Y. X. (2017) The diagnostic and prognostic values of microRNA-21 in patients with gastric cancer: a meta-analysis. Eur. Rev. Med. Pharmacol Sci. 21 (1), 120−130. (43) Jiang, J., Yang, P., Guo, Z., Yang, R., Yang, H., Yang, F., Li, L., and Xiang, B. (2016) Overexpression of microRNA-21 strengthens stem cell-like characteristics in a hepatocellular carcinoma cell line. World journal of surgical oncology 14 (1), 278. (44) Fang, W. L., Huang, K. H., Chang, S. C., Lin, C. H., Chen, M. H., Chao, Y., Lo, S. S., Li, A. F., Wu, C. W., and Shyr, Y. M. (2019) Comparison of the Clinicopathological Characteristics and Genetic Alterations Between Patients with Gastric Cancer with or Without Helicobacter pylori Infection. Oncologist, theoncologist.2018-0742. (45) Rubinstein, M. R., Baik, J. E., Lagana, S. M., Han, R. P., Raab, W. J., Sahoo, D., Dalerba, P., Wang, T. C., and Han, Y. W. (2019) Fusobacterium nucleatum promotes colorectal cancer by inducing Wnt/beta-catenin modulator Annexin A1. EMBO reports 20, e47638. (46) Bagan, J., Sarrion, G., and Jimenez, Y. (2010) Oral cancer: clinical features. Oral Oncol. 46 (6), 414−7. (47) Gaur, A. B., Holbeck, S. L., Colburn, N. H., and Israel, M. A. (2011) Downregulation of Pdcd4 by mir-21 facilitates glioblastoma proliferation in vivo. Neuro-oncology 13 (6), 580−90. (48) He, X., Li, J., Guo, W., Liu, W., Yu, J., Song, W., Dong, L., Wang, F., Yu, S., Zheng, Y., Chen, S., Kong, Y., and Liu, C. (2015) Targeting the microRNA-21/AP1 axis by 5-fluorouracil and pirarubicin in human hepatocellular carcinoma. Oncotarget 6 (4), 2302−14. (49) Naito, M., Hirakawa, H., Yamashita, A., Ohara, N., Shoji, M., Yukitake, H., Nakayama, K., Toh, H., Yoshimura, F., Kuhara, S., Hattori, M., Hayashi, T., and Nakayama, K. (2008) Determination of the genome sequence of Porphyromonas gingivalis strain ATCC 33277 and genomic comparison with strain W83 revealed extensive genome rearrangements in P. gingivalis. DNA Res. 15 (4), 215−25. (50) Noiri, Y., Li, L., Yoshimura, F., and Ebisu, S. (2004) Localization of Porphyromonas gingivalis-carrying fimbriae in situ in human periodontal pockets. J. Dent. Res. 83 (12), 941−5. (51) Tachibana-Ono, M., Yoshida, A., Kataoka, S., Ansai, T., Shintani, Y., Takahashi, Y., Toyoshima, K., and Takehara, T. (2008) Identification of the genes associated with a virulent strain of Porphyromonas gingivalis using the subtractive hybridization technique. Oral Microbiol. Immunol. 23 (1), 84−7. (52) Brozovic, S., Sahoo, R., Barve, S., Shiba, H., Uriarte, S., Blumberg, R. S., and Kinane, D. F. (2006) Porphyromonas gingivalis enhances FasL expression via up-regulation of NFkappaB-mediated gene transcription and induces apoptotic cell death in human gingival epithelial cells. Microbiology 152 (3), 797−806. L


Porphyromonas gingivalis Infection Promoted the Proliferation of Oral

Recommend Documents