Aquaculture and Fisheries 2 (2017) 269e277
Contents lists available at ScienceDirect
Aquaculture and Fisheries journal homepage: www.keaipublishing.com/en/journals/ a q u a c u l t u r e - a n d - fi s h e r i e s /
Original research article
Dynamic interaction of neutrophils and RFP-labelled Vibrio parahaemolyticus in zebrafish (Danio rerio) Qiuyue Zhang a, An Ding a, Qianwen Yue a, Weiming Li a, b, Yao Zu a, Qinghua Zhang a, * a Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China b Department of Fisheries and Wildlife, Michigan State University, East Lansing, MI 48824, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 May 2017 Received in revised form 18 October 2017 Accepted 19 October 2017 Available online 16 November 2017
Vibrio parahaemolyticus (Vp) is an aquatic zoonotic pathogen that causes vibriosis in marine animals as well as sepsis, gastroenteritis and wound infection in human. In vertebrates, the innate immune system plays a critical defense mechanism against Vp infection including transmigration of neutrophils. In this study, we have examined the genetic recombination and infectious process of Vp in the zebrafish (Danio rerio), a vertebrate model system extensively used for studying host-pathogen interactions. A pathogenic Vp strain, Vp57, tagged with red fluorescent protein (RFP) (Vp57RFP) was introduced into larval zebrafish at 3 days post fertilization (dpf), in which the innate immunity is present whereas the adaptive immunity has not yet developed. Vp57 and Vp57RFP showed similar LD50 and induced similar symptoms and pathological changes in the hosts. We microinjected 579 colony-forming units (CFU) Vp57RFP into the zebrafish caudal vein, and observed that neutrophils were recruited to the injection site and within 3 h post infection (hpi) Vp57RFP were mainly distributed in the tail, eyes, heart and optic vesicle. After 3 hpi, the fish died with slight spine bending. Several Vp57RFP were also detected in somites, the phagocytosis of neutrophils was activated through the progress of bacterial infections. We found that chemotaxis and phagocytosis of neutrophils occurs when zebrafish is infected by Vp57RFP, whereas Vp57RFP can escape from neutrophils and colonize other remote regions using the blood circulation system. © 2017 Published by Elsevier B.V. on behalf of Shanghai Ocean University. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Keywords: Zoonotic pathogen Danio rerio Tri-parental mating Neutrophil Dynamic change
1. Introduction Vibrio parahaemolyticus is a halophilic Gram-negative bacterium that inhabits marine and estuarine environments (Gavilan, Zamudio, & Martinez-Urtaza, 2013; Joseph, Colwell, & Kaper, 1982). Many strains of Vp are important aquatic zoonotic pathogens and may cause gastroenteritis, wound infection and septicemia in both humans and aquatic animals (Austin, 2010). Recently, it has been reported that penaeid shrimp (Penaeus orientalis) when infected with Vp, suffers from acute hepatopancreatic necrosis syndrome (AHPNS) or early mortality syndrome (EMS) (Tran et al., 2013; Wang et al., 2015). Vp is a foodborne pathogen that has become a major public health concern (Gavilan et al., 2013). In Jiangsu province and Shanghai city in China, potential pathogenic Vp has been shown to be present in some fresh, low-temperature
* Corresponding author. 999 Huchenghuan Road, Shanghai Ocean University, Shanghai 201306, China. E-mail address:
[email protected] (Q. Zhang).
preserved, dried, and salted seafood products (Yang et al., 2008) and this results in serious economic losses. Many of Vp's toxins and effectors have been identified and characterized, such as the multi-type secretion system (T3SS1, T3SS2, T6SS1, T6SS2), and thermostable direct hemolysin (TDH), TDH related hemolysin (TRH) and thermolabile hemolysin (TLH) genes (Broberg, Zhang, Gonzalez, Laskowski-Arce, & Orth, 2010; Broberg, Calder, & Orth, 2011; Wang et al., 2015). In addition, three types of cells (HeLa, Changliver, and Raw264.7) and rabbit ileal loops test model have been developed to clarify Vp pathogenicity in mammalian species (Wang et al., 2012). However, the detailed mechanisms whereby combined or individual effectors of Vp cause pathogenicity have not yet been investigated (Broberg et al., 2011; Wang et al., 2015). Moreover, current studies of Vp pathogenicity are limited to in vitro models. In this study, we aimed to develop an efficient and reliable method to visualize interaction between Vp and immune cells using the in vivo the teleost fish zebrafish (Danio rerio). Recently, the use of fluorescently labelled microbes and phagocyte transgenic lines have enabled spatial and temporal
https://doi.org/10.1016/j.aaf.2017.10.006 2468-550X/© 2017 Published by Elsevier B.V. on behalf of Shanghai Ocean University. This is an open access article under the CC BY license (http://creativecommons.org/ licenses/by/4.0/).
270
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
imaging of host-pathogen interactions using living vertebrate animal models (Chu & Lu, 2008; O'Toole, Von Hofsten, Rosqvist, Olsson, & Wolf-Watz, 2004). Many findings on zebrafish have highlighted the advantage of the use of this teleost as a vertebrate model that complements mouse and human for the visualization of neutrophil behavior in vivo (Le Guyader et al., 2008). An important advantage of the use of zebrafish is the temporal separation of innate immunity from adaptive responses (Meijer & Spaink, 2011). These findings elucidate how the inflammatory status affects the response to a particular therapy, with the aim towards hostdirected therapeutic strategies (Harvie & Huttenlocher, 2015; Vacaru et al., 2014). The innate immunity is a rapid anti-infection process. Innate immune cells play an important role in the identification of nonspecific pathogens. The neutrophils are innate immune cells and the most abundant immune cell type of circulating leukocyte in both humans and zebrafish. They are produced by the bone marrow and are abundant in the blood and are rapidly recruited to the infection sites by the chemical attractants that are produced by inflamed tissues (Baggiolini, 1998; Scapini et al., 2000). These leukocytes are typically the first cell type responders recruited to the sites of tissue injury or infection (Amulic, Cazalet, Hayes, Metzler, & Zychlinsky, 2012; Lieschke, Oates, Crowhurst, Ward, & Layton, 2001). Neutrophils, as well as monocytes and macrophages are phagocytes that act to remove irritants, bacteria or damaged cells and tissues during inflammation. During acute inflammation in many fish species, neutrophils migrate more rapidly than monocytes and macrophages (Suzuki & Iida, 1992). Transmigration of neutrophils through the vascular endothelial walls into the inflamed tissues is a critical defense mechanism of the innate immune system against infection and injury caused by sepsis, trauma, ischemia-reperfusion and other acute or chronic inflammatory diseases (Hirano, Aziz, & Wang, 2016). Most studies available on Vp have focused on their virulence mechanisms and biological characteristics, but useful information of the genetic recombination and infectious process of Vp is currently lack. In this study, we have engineered a RFP-tagged Vp (Vp57RFP) with tri-parental mating method and validated its utility comparing the growth curves and virulence before and after RFPmarked Vp. Subsequently, we have observed their interactions with green fluorescent protein (GFP) transgenic neutrophils in 3days post fertilization (dpf) larvae zebrafish line by caudal vein microinjection. Here, we established a useful system for visualization and manipulation of bacteria and cellular processes of neutrophils in a live vertebrate. 2. Materials and methods 2.1. Plasmids and bacterial strains The plasmid pVSV209 was kindly provided by Professor Eric V. Stabb from University of Georgia, Athens, GA, US. The pVSV209 was a pES213-derived plasmid, and was constructed from the aph (kanamycin resistance)-carrying pES213-based vector pES213Kn (Dunn, Millikan, Adin, Bose, and Stabb (2006)). E. coli S17-1lpir strain was kindly provided by Dr. Shaohui Wang from Shanghai Veterinary Research Institute, China. E. coli DH5a strain was purchased in TIANGEN (Beijing, China). Vp57, isolated from Penaeus vannamei, was kindly provided by Dr. Yong Zhao from Shanghai Ocean University, China. 2.2. Tri-parental mating We developed a version of the tri-parental mating procedure as described by Dunn et al. (2006), adjusted for the differences in the
optimal growth temperatures of E. coli and Vp57. The pVSV209 plasmid (Dunn et al., 2006) with RFP and kanamycin-resistance expression cassettes was transferred from E. coli to Vp57 by triparental mating method using the conjugative helper strain E. coli S17-1lpir (Stabb & Ruby, 2002). Each fluorescent colony was tested by epifluorescence microscopy to verify RFP expressing (exciting light was 470 nm, emitted light was 530 nm). All positive colonies were confirmed by PCR using 3 pairs of primers specific for the RFP gene as a specific marker for Vp57RFP. The primers were synthesized by Shanghai Sheng Gong Synthetic Biological Co., Ltd, China and are listed in Table 1. DNA marker was purchased in TaKaRa Biomedical Technology (Beijing, China). We sequenced Vp57RFP using 16S rRNA method and confirmed the Vp identity by comparing the sequence submitted to NCBI (https://blast.ncbi.nlm. nih.gov/Blast.cgi). 2.3. Growth curves of Vp57 and Vp57RFP To compare growth between Vp57 and Vp57RFP, a single colony of each bacterium was pre-inoculated into 5 mL LBS liquid medium as seed culture solution, then subsequently transferred to 100 mL LBS liquid medium and was incubated 37 C with shaking speed 200 r/min (OD600 ¼ 1). A sample of each culture of Vp57 and Vp57 RFP were taken at 0.5 h intervals from the time of inoculation of the culture (0 h) during a 12 h incubation period (Sampling time points within 1 h were 0 h, 0.25 h, 0.5 h and 0.75 h). Growth curves were plotted according to the absorbance recorded at 600 nm (OD600) using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, US). All experiments were performed in triplicate. All methods followed the procedures previously described by Liu et al. (2014). 2.4. Plasmid stability One Vp57RFP fluorescent colony, grown overnight at 37 C in LBS with 100 mg/mL kanamycin, was diluted in LBS without antibiotics and subsequently incubated at 37 C overnight. On the next day, an aliquot of previous day's culture was plated on LBS agar to verify the relative number of fluorescent. Vp57RFP was cultured for 11 days, with daily re-inoculations of fresh medium. This method followed as described by Vinoj, Vaseeharan, Thomas, Spiers, and Shanthi (2014a). 2.5. Zebrafish maintenance The described research methodology was approved by Shanghai Ocean University Experimentation Ethics Review Committee (SHOU-DW-2016-002). Wild-type AB adult zebrafish (5 months old) were obtained from Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China) and used throughout this study. Zebrafish with GFP-labelled neutrophils were kindly provided by Prof. Shuo Lin (University of California, Los Angeles, US). Fish husbandry followed the methods of Westerfield (http://zfin.org/zf_ info/zfbook/zfbk.html). Adult zebrafish (5 months old) were
Table 1 Primers of RFP fragment sequences used in this study. Designation
Nucleotide sequences (50 -30 )
Size (bp)
1-for 1-rev 2-for 2-rev 3-for 3-rev
CACGAGTTCGAGATCGAGGG AAGGTGAAGTTCATCGGCGT GGCTCCAAGGTGTACGTGAA CCCACAACGAGGACTACACC CCGAGGACGTCATCAAGGAG GAAGACTATGGGCTGGGAGC
308 426 423
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
transferred to a stand-alone unit with a separate flow-through system, and acclimated for 2 weeks before infection treatment. Zebrafish were handled according to the procedures of the Institutional Animal Care and Use Committee of Shanghai Ocean University. Embryos and larvae were grown at 28.5e30 C in zebrafish re-circulated water. 2.6. Virulence comparison of Vp57 and labelled strain Vp57RFP To estimate 50% lethal dose (LD50) determinations, intraperitoneal (i.p.) injection was carried out as previously described by (Zhang et al., 2016). Vp57 and Vp57 RFP were routinely grown overnight in TCBS agar culture medium at 37 C. Single colony was selected and inoculated into LBS liquid medium and grown overnight at 37 C with shaking at 200 r/min. Logarithmic phase cultures were obtained by diluting (1:10) the overnight culture in LBS. Cultures were harvested by centrifugation (2000 r/min), washed twice and re-suspended in saline solution (0.85% NaCl). Bacterial suspensions were prepared with saline, and control groups were treated with saline in the same way as in the test groups. The concentrations of the two strains were determined by McFarland nephelometry and plate count methods (Aldridge & Schiro, 1994). The concentration of Vp57 was 1.6 108 colony-forming units (CFU)/mL, then it was gradient diluted threefold to obtain final concentration of 5.3 107 CFU/mL, 1.7 107 CFU/mL, 5.9 106 CFU/mL, 1.9 106 CFU/mL, respectively. The concentration of Vp57RFP was 3.1 108 CFU/mL, and was also gradient diluted threefold to obtain the final concentrations of 1.6 108 CFU/mL, 3.3 107 CFU/mL, 1.1 107 CFU/mL, 3.7 106 CFU/mL, respectively. Anesthetized zebrafish (5 months old) were infected in triplicates, with ten animals in each replicate. The injected volume was 10 mL. The needle was inserted into the midline of the abdomen immediately posterior to the pectoral fins. After injection, the needle was held in place for 5 s before withdrawn. Infected zebrafish were transferred to fresh re-circulated water aquariums (Neely, Pfeifer, & Caparon, 2002). Any zebrafish observed to be bleeding was immediately euthanized. Mortalities were recorded for 96 h and zebrafish were sampled for re-isolation of the pathogen and for histology. 2.7. Re-isolation and identification of the bacteria Adult zebrafish (5 months old) infected with Vp57 or Vp57RFP were dissected and analyzed separately for the presence of bacteria. The ascites, liver, pancreas and kidneys were homogenized in 10 mL of saline solution using a stomacher lab blender, and the tissue homogenized was streaked on selective TCBS and LBS agar plates (nutrient broth supplemented with NaCl (3% W/V) (LBS) and kanamycin (0.1% V/V)), and incubated overnight at 37 C. Recorded the red color of colony of Vp57RFP to confirm the pVSV209 plasmid is stable even if they are observed in visible light without any special light to excite.
271
Olympus BX35 microscope (Olympus Corporation, Japan) fitted with cellSens Entry (Olympus Corporation, Japan). 2.9. Dynamic interactions of Vp57
RFP
and GFP-labelled neutrophils
The 3 dpf zebrafish larvae with GFP-labelled neutrophils were taken and placed at 28 C. In order to prevent melanization, 0.003% N-Phenylthiourea (PTU) (Sigma-Aldrich, Saint Louis, MO, USA) was added to the water when embryos were approximately 12 h post fertilization (hpf). Overnight cultures of Vp57 RFP were washed twice in sterile phosphate buffered saline (PBS) buffer at room temperature. Optional 0.085% (V/V) phenol red (Sigma-Aldrich, Saint Louis, MO, USA) was added to aid in the visualization of the injection process. The concentrations of the two strains were determined using the McFarland nephelometry and plate count methods (Aldridge & Schiro, 1994). The concentration of Vp57RFP was 2.2 108 CFU/mL and 1 nL of the bacteria suspension was microinjected (about 2200 CFU), but the actual number of bacteria introduced into zebrafish was 579 CFU, which was calculated through homogenized larvae directly after injection by plate count methods. All experiments were performed in triplicate. Bacterial suspension was shaken to avoid clumping before caudal vein microinjection, and the experiments were performed according to the method described by Benard et al. (2012) (Fig. 1). Subsequently, the fish were examined using a fluorescence stereomicroscope (ZEISS, Carl Zeiss Jena, Germany) for the presence of Vp57 RFP bacteria. Injected bacteria will follow the bloodstream through the caudal vein towards the heart. To check if injection was correctly performed we have monitored for an expanding volume of the vascular system directly after the pulse. 2.10. Statistical analysis Three independent replicates were performed for each data set. The data of growth curve were figured out by Graphpad Prism 5. Values were expressed as mean ± standard error. 3. Results 3.1. Conjugation of Vp57 with pVSV209 plasmid To obtain the RFP-tagged Vp, the plasmid pVSV209 was transferred into Vp57 using the tri-parental mating method. The obtained strain Vp57RFP formed red colony in vitro when grown in LBS
2.8. Histopathology To examine the pathogenicity of Vp57 and Vp57RFP, adult zebrafish (5 months old) were infected for 96 h with Vp57 and Vp57RFP respectively with a 1 108 CFU/mL i.p. injection of 10 mL volume. The infected zebrafish were euthanized, cut along the ventral line and placed in 10 mL of buffered 10% formalin. After 24 h, the fixative was aspirated and replaced with 10 mL of fresh buffered 10% formalin and the samples were stored at 4 C. Whole zebrafish were embedded in paraffin wax and the sections were stained with hematoxylin and eosin (Neely et al., 2002). Microphotographs of the histological sections were obtained using
Fig. 1. Overview of the injection procedure in zebrafish larva. A rapid systemic infection was performed into the caudal vein by intravenous injection at the posterior blood island at 3 dpf. The red in the syringe represents the Vp57 RFP bacteria. Syringe points out in direction of the injection site. Magnification: 50. Scale bars ¼ 200 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
272
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
solid medium which was confirmed by fluorescence microscope (Fig. 2). The RFP fragments of pVSV209 were successfully amplified in the Vp57RFP strains based on the size of the PCR products obtained using different primers (Fig. 3). We sequenced 16S rRNA of Vp57RFP, and a sequence of 969 bp was obtained and shares 99% identity to Vibrio parahaemolyticus strain HEP1B1 in the NCBI database (Supporting information 1 in supplementary data). 3.2. Characteristics of Vp57 and Vp57RFP bacteria In order to determine whether the fluorescent marker strain Vp57RFP is suitable for in vivo infection, the growth curve, plasmid stability and LD50 of the paternal and the tagged strain were tested. No obvious differences between Vp57 and Vp57RFP were observed in vitro when grown in liquid LBS medium for 10 h (Fig. 4). To assess for the stability of pVSV209, the plasmid was stably retained growth for 11 days in nonselective LBS medium. This feature was important to ensure that most of the bacteria retained fluorescence during the infection experiment. After 11 days of nonselective culture, around 60% retained their high fluorescence (Fig. 5). The result of LD50 showed that Vp57RFP had similar values as Vp57. The LD50 of Vp57 and Vp57RFP is 2.18 107 CFU/mL and 2.00 107 CFU/mL, respectively (Table 2). 3.3. Clinical symptoms and histopathology of zebrafish infected with Vp57 and Vp57RFP The most notable symptom from adult zebrafish treated by intraperitoneal injection of 1 107 CFU/mL Vp57 or Vp57RFP was a widespread septicemia after 24 h. Zebrafish from the two treated groups showed mild abdominal hemorrhages and swelling when compared to the controls (Fig. 6B and C). Moreover, edema and congestion were noted in the gill and mucus (Fig. 6E), while the
Fig. 3. PCR amplification of rfp gene of Vp 57, Vp57RFP, pVSV209. (M) DNA molecular size marker of 50e500 bp. (1) PCR product of Vp57, (2) PCR products of Vp57RFP are 308 bp (primer 1 F/R), 426 bp (primer2 F/R) and 423 bp (primer 3 F/R). (3) PCR products of pVSV209 are 308 bp (primer1 F/R), 426 bp (primer2 F/R) and 423 bp (primer3 F/R), respectively.
liver became pale yellow (Fig. 6G). In the control fish the gills and liver were normal and presented no abnormalities in structure or color (Fig. 6A, D and F). As previously described by Zhang et al. (2016), infection of zebrafish with Vp57 and Vp57RFP causes serious abdominal hemorrhages and swelling. Pathological results showed that the liver and intestine of the infected group possess distinct degrees of pathological lesions. Necrosis and shedding occurred in intestinal villus, and connective tissues separated from muscularis (Fig. 7B and C). Almost all the cytoplasm of hepatocytes in Vp57RFP infected zebrafish had severe hydropic degeneration and necrosis (Fig. 7E and F). No pathogenic symptoms were observed in the control animal (Fig. 7A and D). Bacteriological analysis was carried out on ascites, liver, heart, gill and kidney from diseased zebrafish using LBS plates. All the
Fig. 2. Microscopy observation of Vp57 and Vp57RFP bacteria. (A) Bright-field images of Vp57 at 400 Magnification. (B) Green light exciting field images of Vp57 at 400 Magnification. (C) Bright-field images of Vp57RFP at 400 Magnification. (D) Green light exciting field images of Vp57RFP at 400 Magnification. Scale bars ¼ 20 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
273
Fig. 4. Growth curves of Vp57 and Vp57 RFP. Growth in LBS was estimated by continuous OD600 measurements for 10 h. Both strains were regularly measured in three independent experiments. Solid line represents Vp57, dotted line represents Vp57RFP.
tissues of infected zebrafish carried relevant bacterial strains, as shown by re-isolation. For example, the ascites, no colony in LBS plates were observed for the control group (Fig. 8A), while the LBS plates of the Vp57 and Vp57RFP groups recovered many colonies (Fig. 8B and C). 3.4. Dynamic interactions between Vp57 neutrophils
RFP
and GFP-labelled
In order to observe how injected Vp57RFP affected the distribution of neutrophils, we compared the neutrophil movement in
Fig. 5. Plasmid stability. Plasmid stability is estimated by calculating the relative number of fluorescent unit-forming colonies for 11 days in on-selective LBS culture.
the 3dpf zebrafish larvae of control and infected groups. Neutrophils were evenly distributed throughout the body of control larvae (Fig. 9A). When PBS adding 0.085% (v/v) phenol red was injected into larvae at caudal vein, neutrophils obviously gathered at the injection site (Fig. 9B), which caused injury to the tissue. Compared with the control group (Fig. 9A and B), neutrophils of zebrafish larvae infected by Vp57RFP not only migrated to the injury, but also gathered in some tissues, such as heart, which were not injured (Fig. 9C). In order to observe if the RFP-tagged bacteria affect the distribution of neutrophils and the fate of zebrafish larvae, 579 CFU Vp57RFP bacteria were microinjected into 3 dpf larvae and the dynamic changes between the neutrophils and bacteria were observed for 3 h (Fig. 10A). At 0 h post infection (hpi), bacteria were mainly concentrated on the tail and few were found around heart and optic vesicle. Neutrophils were distributed in the blood vessels. After 1 hpi, Vp57RFP proliferated into many regions of the blood circulation system. As blood stream circulated with time, Vp57RFP was distributed in the whole blood vessels, infecting the eyes and heart, and neutrophils in the trunk of the larvae were gathered to engulf bacteria. At 2 hpi, heart and blood vessel of larvae were mainly covered with Vp57RFP, however, there was a small decrease when compared with the amount of Vp57RFP at 1 hpi and phagocytosis of neutrophils in the heart was obvious. After 3 hpi, the fish died, and the zebrafish larvae presented a very severely curved dorsal spine. Most of the body was covered with bacteria and we found that there were several strains Vp57RFP in somites. In the zebrafish larva infected with 579 CFU Vp57RFP at 2 hpi (Fig. 10B), we also found the yolk sac of infected larva covered with a lot of Vp57RFP bacteria, but there was very little neutrophils, even almost no neutrophils (Fig. 10C). In contrast, neutrophils were directed to the caudal vein (Fig. 10D).
Table 2 Bliss method to calculate LD50 of zebrafish infected by Vp57 and Vp57RFP at 96 h. Strain
Dose probit regression (Y)
Logarithmic dose (x)
Lest animals
Dead
Mortality%
Probit (Y)
Regression probability (Y)
LD50 (CFU/mL)
Vp57
1.6 108 5.3 107 1.7 107 5.9 106 1.9 106 0.85%NaCl
8.20 7.72 7.23 6.77 6.28 e
10 10 10 10 10 10
10 7 5 1 0 0
100 70 50 10 0 0
e 5.52 5 3.72 e e
6.92 5.86 4.76 3.74 2.65 e
2.18 107
Vp57RFP
3.1 108 1.6 108 3.3 107 1.1 107 3.7 106 0.85%NaCl
8.49 8.20 7.52 7.04 6.82 e
10 10 10 10 10 10
10 9 7 3 1 0
100 90 70 30 10 0
e 6.28 5.52 4.48 3.72 e
7.08 6.58 5.38 4.54 3.72 e
2.00 107
274
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
Fig. 6. Pathology of zebrafish infected by Vp at 24h. (A) Control zebrafish injected with saline solution (0.85% NaCl). (B) Zebrafish injected with Vp57 (1.6 108 CFU/mL) showing serious abdominal hemorrhages and swelling. (C) Zebrafish injected with Vp57RFP (3.1 108 CFU/mL) presenting similar symptom to Vp57. (D) Gill filament of control zebrafish was white. (E) The gill of zebrafish injected with Vp57RFP hyperaemia. (F) The liver of control zebrafish was orange. (G) The liver of Zebrafish injected with Vp57RFP was pale yellow. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 7. Histopathology of zebrafish infected with Vp57RFP. Intestinal structure of control zebrafish injected with (A) saline solution (0.85% NaCl) (B) with Vp57RFP (3.1 108 CFU/ mL) and with Vp57 (1.6 108 CFU/mL). Animals in B show intestinal mucosal epithelial cell fallen off and the connective tissue is separated with muscularis. In (C) the symptoms were similar to zebrafish injected with Vp57RFP. Liver of zebrafish injected (D) with saline solution (0.85% NaCl), injected with Vp57RFP (3.1 108 CFU/mL) and with Vp57 (1.6 108 CFU/mL (F). Animals in (E) showed severe hydropic degeneration (white arrow) and necrosis (black arrow) and in (F) severe hydropic degeneration (white arrow). Scale bars ¼ 20 mm.
4. Discussion In the present study, we reported the construction of a tagged Vp strain (Vp57RFP) obtained using the tri-parental mating method. After confirming that the physiological characteristics of Vp57 and Vp57RFP were similar, we utilized visual characteristic of Vp57RFP to illustrate the infection pathway, process and outcome in zebrafish
larvae. We observed that fluorescently labelled V. parahaemolyticus (with RFP) and neutrophils (with GFP) transgenic zebrafish line facilitated the study of host-pathogen interactions at spatial and temporal imaging in whole animal level. The results demonstrated that zebrafish is an efficient live vertebrate model for visualization and manipulation of invading bacteria in tissues and cellular processes.
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
275
Fig. 8. Isolation of Vp57RFP from zebrafish ascites. (A) Control zebrafish injected with saline solution (0.85% NaCl), (B) injected with Vp57 (1.6 108 CFU/mL), (C) injected with Vp57RFP (3.1 108 CFU/mL). Vp57RFP colonies were red color in visible light without any special light to excite. The culture medium was LBS agar supplemented with Kanþ (0.1% V/ V). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 9. Zebrafish larvae (3 dpf) with GFP-labelled neutrophils infected with Vp 57RFP. (A) Zebrafish larvae (3 dpf) with GFP-labelled neutrophils. (B) Zebrafish larvae (3 dpf) with GFP-labelled neutrophils injected with 1PBS and 0.085% (v/v) phenol red (Sigma-Aldrich). (C) Zebrafish larvae (3 dpf) with GFP-labelled neutrophils injected with 579 CFU Vp57RFP and 0.085% (v/v) phenol red (Sigma-Aldrich). Magnification: 50. Scale bars ¼ 200 mm.
Many studies have used GFP-tagged V. parahaemolyticus to test its virulent and protective effects of the probiotic Bacillus licheniformis or Pseudomonas aeruginosa which have quorum-quenching activity in the host level. These findings help us to understood colonization of Vp in the heamolymph, intestine, gills and muscles and other tissues of the shrimp and fish, and the novel methods for the treatment of aquatic diseases caused by V. parahaemolyticus. (Gobi et al., 2016; Vinoj, Vaseeharan, Thomas, Spiers, & Shanthi, 2014b, 2015), however little was known about the interactions between bacteria and immune cells. In our study, RFP tagged
bacteria and GFP transgenic zebrafish line provided new insights into the interaction between bacteria and neutrophils. In order to effectively control the spread of Vp the use of biological fluorescent markers to observe their route of transmission was found to be an effective way to study its propagation mechanism. The fluorescent proteins have been used as tools in numerous applications, including minimally invasive markers to track and quantify individual or multiple protein species (Lippincott-Schwartz, Snapp, & Kenworthy, 2001). Recent advances in microscopy imaging techniques have provided additional ways to visualize and quantify molecules and events with high spatial and temporal resolutions (Lippincott-Schwartz & Patterson, 2003). With these fluorescent proteins and microscopy imaging techniques, red fluorescence of Vp57RFP indicates the location and process of the infection in 3 dpf zebrafish larvae with neutrophils labelled by GFP. Our experiments proved that tagged RFP plasmid has no change on the virulence of bacteria. Infection path of Vp57RFP was tracked primarily by photographing. The results indicated that the use of fluorescent proteins provides a direct and visual means of bacteria detection which can be used to study the invasion route in the zebrafish. Our experiments showed that the infection pathway of Vp57 can be recorded for real-time analysis, and we found that Vp57RFP could colonize more remote regions of the blood circulation system, like the marginal of the yolk sac circulation valley. Previously Van Der Sar et al. (2003) demonstrated that macrophages and increasing amounts of extracellular Salmonlla typhimurium can be observed in infected zebrafish embryos. These bacteria are mostly attached to the epithelium of the smaller blood vessels or observed in the marginal regions of the yolk sac circulation valley (Van Der Sar et al., 2003). They speculated that these bacteria may harbor in some sites where immune cells were sparsely present, or because of the reduced blood flow. This suggests that Vp57RFP circulated to the yolk sac to avoid the phagocytic effect of phagocytes. Tri-parental mating is widely applied in the Vibrio spp. bacteria conjugation. Up to now, several Vibrio species, such as V. cholera (Das, Chakrabortty, Banerjee, & Chaudhuri, 2002), V. fischeri (Lupp & Ruby, 2004), V. harveyi (Miyamoto, Sun, & Meighen, 1998), V. salmonicida (Nelson, Tunsjø, Fidopiastis, Sørum, & Ruby, 2007) and V. parahaemolyticus (Datta, Kaper, & MacQuillan, 1984; Gobi et al., 2016; Vinoj et al., 2014a, 2014b, 2015) have been transformed using this mating method. The stability of plasmid was found to be maintained at 60% after 11 days and Travers et al. (2008) found that GFP-encoding plasmid could be maintained in 80% of Vibrio harveyi after 7 days, less than 20% GFP-expression bacteria was counted after 12 days of continuous culture, and they deemed it stable. The reason for the plasmid stable ratio is different maybe due to the different plasmids in their separate host bacteria and the medium used in each experiment. So, we
276
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
Fig. 10. Real time analysis of the interactions between Vp57RFP and GFP-labelled neutrophils. Zebrafish larvae were inoculated 3 dpf by caudal vein microinjection of Vp57RFP and 0.085% (v/v) phenol red (Sigma-Aldrich). (A) The process of one zebrafish larva infected with approximately 579 CFU Vp57RFP from 0 hpi to 3 hpi. (B) More Vp57RFP existed in another zebrafish larva, but there was little neutrophils at the same dose of infected Vp57RFP at 2 hpi. (C) Yolk sac of partially zebrafish larva from Fig B exist even almost no neutrophils. (D) Caudal vein of partially zebrafish larva from Fig B. Magnification: 50. Scale bar ¼ 200 mm.
hypothesize that based on the previous findings that the plasmid in Vp57 was also stable. Datta et al. (1984) have also demonstrated that the plasmid (pAD22) can be transferred into and be stably maintained in V. parahaemolyticus strains, which offers certain advantages as a host for target genes because of its very short generation time. Our labelled strain Vp57RFP can survive for a long time so as to fit for the marker of Vp's infection process in zebrafish. Some studies have proved that fluorescent tagging did not have any adverse effect on the survival and pathogenic expression of the experiment strain (Vinoj et al., 2014a). However, Leigh A. Knodler et al. (2005) demonstrated that plasmid vectors and fluorescent protein reporter systems could impair the ability of bacterial pathogen to invade host cells. In addition to this, D.G. Allison and M.A. Sattenstall found that GFP incorporation has a significant effect on bacterial physiology and can modulate antimicrobial susceptibility (Allison & Sattenstall, 2007). In contrast, our result demonstrated that the growth curve and toxicity of Vp57 was unchanged after labelled. It is worth mentioning that, using RFPlabelled instead of GFP-labelled bacteria has another advantage, the whole tissues from zebrafish have a green fluorescence background, which is often encountered when trying to visualize GFPlabelled bacteria in tissue sections, will interfere with the observed results of the fluorescence, and this is completely eliminated by the use of RFP-labelled bacteria (Singer et al., 2010). We, therefore, chose RFP to label Vp57. Based upon the use of two distinct labeling systems we were able to clearly recorded the infection pathway of Vp57RFP in zebrafish larvae and its interaction with neutrophils. In summary, we used tri-parental mating method to label the Vp57 with pVSV209 plasmid, and validated a RFP-tagged Vp strain
as a useful tool to observe the dynamic interaction with neutrophils in the zebrafish larvae. According to the LD50 and clinical symptoms and histopathology, we verified that the toxicity of Vp57 was not changed after tagging. This allowed us to visualize the infection pathway through the caudal vein microinjection of 3 dpf zebrafish larvae and the distribution of neutrophils and fate of zebrafish larva. This system may help us to screen for novel drugs that can be used for the treatment of V. parahaemolyticus against neutrophil target. 5. Conclusion Here, we have established an effective artificial infection disease model for the study of neutrophils function in innate immune response against Vp infection. A remaining question is whether different ways of infection (such as immersion, injection, wound and so on) and different pathogens (such as bacteria, virus, fungi, etc) lead to the same clinical symptom. These specific mechanisms of infection should be further explored. Targeting these neutrophils responses may provide useful clinically alternatives as adjuvant therapies in the future. Conflict of interest The authors declare no conflict of interest. Acknowledgements We thank Professor Eric V. Stabb (University of Georgia, Athens, US) for the plasmid pVSV209. We thank Prof. Shuo Lin (University
Q. Zhang et al. / Aquaculture and Fisheries 2 (2017) 269e277
of California, Los Angeles, US) for providing zebrafish with GFPlabelled neutrophils. We thank Dr. Shaohui Wang (Shanghai Veterinary Research Institute, China) for the Escherichia coli S17-1lpir strain and Dr. Yong Zhao (Shanghai Ocean University, China) for the Vp57. This work was supported by the Innovation Program of Shanghai Municipal Education Commission (13ZZ127), the Project Sponsored by the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry (D-8002-150042), the Doctor Startup Fund of Shanghai Ocean University (A0209-13-0105344), and the SHOU & MSU Marine Joint Research Center Grant (A1-0209-15-0806). Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.aaf.2017.10.006. References Aldridge, K. E., & Schiro, D. D. (1994). Anaerobic susceptibility testing slight differences in inoculum size can make a difference in minimum inhibitory concentrations. Diagnostic Microbiology and Infectious Disease, 18(3), 191e195. Allison, D. G., & Sattenstall, M. A. (2007). The influence of green fluorescent protein incorporation on bacterial physiology: A note of caution. Journal of Applied Microbiology, 103(2), 318e324. Amulic, B., Cazalet, C., Hayes, G. L., Metzler, K. D., & Zychlinsky, A. (2012). Neutrophil function: From mechanisms to disease. Annual Review of Immunology, 30, 459e489. Austin, B. (2010). Vibrios as causal agents of zoonoses. Veterinary Microbiology, 140(3e4), 310e317. Baggiolini, M. (1998). Chemokines and leukocyte traffic. Nature, 392(6676), 565e568. Benard, E. L., van der Sar, A. M., Ellett, F., Lieschke, G. J., Spaink, H. P., & Meijer, A. H. (2012). Infection of zebrafish embryos with intracellular bacterial pathogens. JoVE (Journal of Visualized Experiments), 61. e3781ee3781. Broberg, C. A., Calder, T. J., & Orth, K. (2011). Vibrio parahaemolyticus cell biology and pathogenicity determinants. Microbes Infection, 13(12e13), 992e1001. Broberg, C. A., Zhang, L. L., Gonzalez, H., Laskowski-Arce, M. A., & Orth, K. (2010). A Vibrio effector protein is an inositol phosphatase and disrupts host cell membrane integrity. Science, 329(5999), 1660e1662. Chu, W.-H., & Lu, C.-P. (2008). In vivo fish models for visualizing Aeromonas hydrophila invasion pathway using GFP as a biomarker. Aquaculture, 277(3), 152e155. Das, S., Chakrabortty, A., Banerjee, R., & Chaudhuri, K. (2002). Involvement of in vivo induced icmF gene of Vibrio cholerae in motility, adherence to epithelial cells, and conjugation frequency. Biochemical and Biophysical Research Communications, 295(4), 922e928. Datta, A. R., Kaper, J. B., & MacQuillan, A. M. (1984). Shuttle cloning vectors for the marine bacterium Vibrio parahaemolyticus. Journal of Bacteriology, 160(2), 808e811. Dunn, A. K., Millikan, D. S., Adin, D. M., Bose, J. L., & Stabb, E. V. (2006). New rfp- and pES213-derived tools for analyzing symbiotic Vibrio fischeri reveal patterns of infection and lux expression in situ. Applied and Environmental Microbiology, 72(1), 802e810. Gavilan, R. G., Zamudio, M. L., & Martinez-Urtaza, J. (2013). Molecular epidemiology and genetic variation of pathogenic Vibrio parahaemolyticus in Peru. PLoS Neglected Tropical Diseases, 7(5), e2210. Gobi, N., Malaikozhundan, B., Sekar, V., Shanthi, S., Vaseeharan, B., Jayakumar, R., et al. (2016). GFP tagged Vibrio parahaemolyticus Dahv2 infection and the protective effects of the probiotic Bacillus licheniformis Dahb1 on the growth, immune and antioxidant responses in Pangasius hypophthalmus. Fish & Shellfish Immunology, 52, 230e238. Harvie, E. A., & Huttenlocher, A. (2015). Neutrophils in host defense: New insights from zebrafish. Journal of Leukocyte Biology, 98(4), 523e537. Hirano, Y., Aziz, M., & Wang, P. (2016). Role of reverse transendothelial migration of neutrophils in inflammation. Biological Chemistry, 397(6), 497e506. Joseph, S. W., Colwell, R. R., & Kaper, J. B. (1982). Vibrio parahaemolyticus and related halophilic vibrios. CRC Critical Reviews in Microbiology, 10(1), 77e124. Knodler, L. A., Bestor, A., Ma, C., Hansen-Wester, I., Hensel, M., Vallance, B. A., et al. (2005). Cloning vectors and fluorescent proteins can significantly inhibit Salmonella enterica virulence in both epithelial cells and macrophages: Implications for bacterial pathogenesis studies. Infection and Immunity, 73(10), 7027e7031. Le Guyader, D., Redd, M. J., Colucci-Guyon, E., Murayama, E., Kissa, K., Briolat, V., et al. (2008). Origins and unconventional behavior of neutrophils in developing
277
zebrafish. Blood, 111(1), 132e141. Lieschke, G. J., Oates, A. C., Crowhurst, M. O., Ward, A. C., & Layton, J. E. (2001). Morphologic and functional characterization of granulocytes and macrophages in embryonic and adult zebrafish. Blood, 98(10), 3087e3096. Lippincott-Schwartz, J., & Patterson, G. H. (2003). Development and use of fluorescent protein markers in living cells. Science, 300(5616), 87e91. Lippincott-Schwartz, J., Snapp, E., & Kenworthy, A. (2001). Studying protein dynamics in living cells. Nature Reviews. Molecular Cell Biology, 2(6), 444e456. Liu, X., Liu, L., Wang, Y., Wang, X., Ma, Y., & Li, Y. (2014). The Study on the factors affecting transformation efficiency of E. coli competent cells. Pakistan Journal of Pharmaceutical Sciences, 27(3 Suppl), 679e684. Lupp, C., & Ruby, E. G. (2004). Vibrio fischeri LuxS and AinS: Comparative study of two signal synthases. Journal of Bacteriology, 186(12), 3873e3881. Meijer, A. H., & Spaink, H. P. (2011). Host-pathogen interactions made transparent with the zebrafish model. Current Drug Targets, 12(7), 1000e1017. Miyamoto, C. M., Sun, W., & Meighen, E. A. (1998). The LuxR regulator protein controls synthesis of polyhydroxybutyrate in Vibrio harveyi. Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology, 1384(2), 356e364. Neely, M. N., Pfeifer, J. D., & Caparon, M. (2002). Streptococcus-zebrafish model of bacterial pathogenesis. Infection and Immunity, 70(7), 3904e3914. Nelson, E. J., Tunsjø, H. S., Fidopiastis, P. M., Sørum, H., & Ruby, E. G. (2007). A novel lux operon in the cryptically bioluminescent fish pathogen Vibrio salmonicida is associated with virulence. Applied and Environmental Microbiology, 73(6), 1825e1833. O'Toole, R., Von Hofsten, J., Rosqvist, R., Olsson, P.-E., & Wolf-Watz, H. (2004). Visualisation of zebrafish infection by GFP-labelled Vibrio anguillarum. Microbial Pathogenesis, 37(1), 41e46. Scapini, P., Lapinet-Vera, J. A., Gasperini, S., Calzetti, F., Bazzoni, F., & Cassatella, M. A. (2000). The neutrophil as a cellular source of chemokines. Immunological Reviews, 177, 195e203. Singer, J. T., Phennicie, R. T., Sullivan, M. J., Porter, L. A., Shaffer, V. J., & Kim, C. H. (2010). Broad-host-range plasmids for red fluorescent protein labeling of gramnegative bacteria for use in the zebrafish model system. Applied and Environmental Microbiology, 76(11), 3467e3474. Stabb, E. V., & Ruby, E. G. (2002). RP4-based plasmids for conjugation between Escherichia coli and members of the Vibrionaceae. Methods in Enzymology, 358, 413. Suzuki, Y., & Iida, T. (1992). Fish granulocytes in the process of inflammation. Annual Review of Fish Diseases, 2, 149e160. Tran, L., Nunan, L., Redman, R. M., Mohney, L. L., Pantoja, C. R., Fitzsimmons, K., et al. (2013). Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Diseases of Aquatic Organisms, 105(1), 45e55. Travers, M. A., Barbou, A., Le Goic, N., Huchette, S., Paillard, C., & Koken, M. (2008). Construction of a stable GFP-tagged Vibrio harveyi strain for bacterial dynamics analysis of abalone infection. FEMS Microbiology Letters, 289(1), 34e40. Vacaru, A. M., Unlu, G., Spitzner, M., Mione, M., Knapik, E. W., & Sadler, K. C. (2014). In vivo cell biology in zebrafish - providing insights into vertebrate development and disease. Journal of Cell Science, 127(3), 485e495. Van Der Sar, A. M., Musters, R. J., Van Eeden, F. J., Appelmelk, B. J., VandenbrouckeGrauls, C. M., & Bitter, W. (2003). Zebrafish embryos as a model host for the real time analysis of Salmonella typhimurium infections. Cellular Microbiology, 5(9), 601e611. Vinoj, G., Jayakumar, R., Chen, J.-C., Withyachumnarnkul, B., Shanthi, S., & Vaseeharan, B. (2015). N-hexanoyl-L-homoserine lactone-degrading Pseudomonas aeruginosa PsDAHP1 protects zebrafish against Vibrio parahaemolyticus infection. Fish & Shellfish Immunology, 42(1), 204e212. Vinoj, G., Vaseeharan, B., & Brennan, G. (2014a). Green fluorescent protein visualization of Vibrio parahaemolyticus infections in Indian white shrimp Fenneropenaeus indicus (H Milne Edwards). Aquaculture Research, 45(12), 1989e1999. Vinoj, G., Vaseeharan, B., Thomas, S., Spiers, A. J., & Shanthi, S. (2014b). Quorumquenching activity of the AHL-Lactonase from Bacillus licheniformis DAHB1 inhibits Vibrio biofilm formation in vitro and reduces shrimp intestinal colonisation and mortality. Marine biotechnology, 16(6), 707e715. Wang, R. Z., Fang, S., Wu, D. L., Lian, J. W., Fan, J., Zhang, Y. F., et al. (2012). Screening for a single-chain variable-fragment antibody that can effectively neutralize the cytotoxicity of the Vibrio parahaemolyticus thermo labile hemolysin. Applied and Environmental Microbiology, 78(14), 4967e4975. Wang, R., Zhong, Y., Gu, X., Yuan, J., Saeed, A. F., & Wang, S. (2015). The pathogenesis, detection, and prevention of Vibrio parahaemolyticus. Frontiers in Microbiology, 6, 144. Yang, Z.-q., Jiao, X.-a., Zhou, X.-h., Cao, G.-x., Fang, W.-m., & Gu, R.-x. (2008). Isolation and molecular characterization of Vibrio parahaemolyticus from fresh, low-temperature preserved, dried, and salted seafood products in two coastal areas of eastern China. International Journal of Food Microbiology, 125(3), 279e285. Zhang, Q. H., Dong, X. H., Chen, B., Zhang, Y. H., Zu, Y., & Li, W. M. (2016). Zebrafish as a useful model for zoonotic Vibrio parahaemolyticus pathogenicity in fish and human. Developmental and Comparative Immunology, 55, 159e168.
