Preparation of Icariin and Deferoxamine Functionalized Poly(l-lactide

Subscriber access provided by UNIV OF DURHAM

Article

Preparation of icariin and deferoxamine functionalized poly(L-lactide)/chitosan micro-nano fibrous membranes with synergistic enhanced osteogenesis and angiogenesis Hua Liu, Wei Wen, Shitian Chen, Changren Zhou, and Binghong Luo ACS Appl. Bio Mater., Just Accepted Manuscript • DOI: 10.1021/acsabm.8b00129 • Publication Date (Web): 16 Jul 2018 Downloaded from http://pubs.acs.org on July 18, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Bio Materials

Preparation of icariin and deferoxamine functionalized poly(L-lactide)/chitosan micro-nano fibrous membranes with synergistic enhanced osteogenesis and angiogenesis Hua Liu 1 & Wei Wen1, Shitian Chen 1, Changren Zhou 1,2, Binghong Luo 1,2* 1

Biomaterial Research Laboratory, Department of Material Science and Engineering, College

of Chemistry and Materials, Jinan University, Guangzhou 510632, PR China 2

Engineering Research Center of Artificial Organs and Materials, Ministry of Education,

Guangzhou 510632, PR China *

Corresponding

authors:

Tel:

+86-20-85226663,

Fax:

[email protected] &

Hua Liu and Wei Wen are co-first authors

1

ACS Paragon Plus Environment

+86-20-85223271,

e-mail:

ACS Applied Bio Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 45

Abstract Osteogenesis is tightly complemented with angiogenesis during the bone regeneration process. In this study, to synergistically enhance the osteogenesis and angiogenesis of poly(L-lactide) (PLLA), PLLA/chitosan (PLLA/CS) composite fibrous membrane was prepared firstly by combining electrospinning and thermally induced phase separation technologies. Then, with the aid of polydopamine (PDA) coating, two types of bioactive molecules of icariin (ICA) and deferoxamine (DFO) were chosen to singly or simultaneously surface

modify

the

as-prepared

PLLA/CS-PDA

membrane,

thereby

fabricating

PLLA/CS-PDA/ICA, PLLA/CS-PDA/DFO as well as PLLA/CS-PDA/ICA/DFO membranes. The morphology and properties of the pristine and modified PLLA fibrous membranes were studied, which revealed that the modified PLLA membranes own hierarchical fibrous structure, improved hydrophilicity as well as better tensile properties by introducing PDA, and ICA or DFO. On account of the synergetic contributions of ICA and DFO as well as the hierarchical fibrous structure, the PLLA/CS-PDA/ICA/DFO membrane exhibited superior cytocompatibility and osteogenic activity of MC3T3-E1 cells than other membranes, which confirmed by the enhanced cell adhesion, proliferation, osteogenic differentiation and mineralization. Besides, compared with those without or singly immobilization of ICA or DFO, the PLLA/CS-PDA/ICA/DFO membrane with ICA and DFO together could significantly promote the growth and expression of angiogenic-related factors of HUVECs. Particularly, ICA not only exhibits favorable osteogenic activity but also shows superior angiogenic activity even than DFO. On the contrary, DFO possesses well-known angiogenic activity but manifests a better osteogenic activity compared with ICA. Overall, our study 2


Page 3 of 45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


demonstrated that the PLLA/CS-PDA/ICA/DFO membrane exerts synergistic effects on osteogenesis and angiogenesis, thereby holding great potentials as a substitute for bone repair. Keywords: Poly(L-lactide); hierarchical fibrous structure; icariin; deferoxamine; synergistic effect; osteogenesis; angiogenesis; 1.

Introduction In account of the structure and composition of natural bone, an ideal bone substitute not

only can mimic the hierarchical architecture of the native bone, but also must own the ability of osteogenesis and angiogenesis 1-3. The blood vessels in a natural bone can provide oxygen as well as nutrients to facilitate the ingrowth of cells and maintain skeletal functionality, which means that bone reconstruction is closely related to angiogenesis 4. Considering the regeneration of the vascularized bone, at least two vital factors should be noticed: (1) the scaffold with a hierarchical porous structure that supports the growth of cells and new vessels; (2) the bioactive factors that direct the effect of osteogenesis and angiogenesis. Reports have demonstrated that a three-dimensional (3D) scaffold, which mimics the extracellular matrix structure, is conducive to regulating cell behavior and promoting the formation of vascular networks. To date, although a range of processing approaches have been employed to fabricate scaffolds with a 3D configuration 5-8, few progress in construction of the hierarchical architecture for a bone substitute is achieved. Electrospinning, a technology using for constructing a fibrous scaffold with interconnected pores as well as fibers ranged from nano to micron size, has been widely reported in recent years 9. In particular, poly(L-lactide) (PLLA), one of the biodegradable and biocompatible polyesters, can be fabricated to a fibrous membrane through electrospinning. However, the less than 3



Page 4 of 45

desirable mechanical properties, not ideal cytocompatibility as well as osteogenic and angiogenic activity of PLLA fibrous membrane can`t reach the target of bone repair

9-12

. In

addition, it’s reported that the fibrous substrate with both microfibers and nanofibers exhibits superior cell affinity than that of the substrate consisting of microfibers or nanofibers alone 13. In these regards, it's necessary to modify PLLA electrospinning membrane in order to obtain a 3D scaffold with a hierarchical fibrous structure. Chitosan (CS), the well-known basic polysaccharide, has also been reported to use as an ideal material for repairing bone defects due to its favorable biological properties such as biocompatibility and osteogenesis. As reported, CS can be constructed as a nanofibrous network through thermally induced phase separation (TIPS) method 14, which directly enlightens us the conception of the combining of PLLA microfibers and CS nanofibers to fabricate a 3D scaffold with the hierarchical fibrous structure. At present, aiming at enhancing the osteogenesis and angiogenesis functions of a material, the most feasible solution is to modify the material surface with multiple bioactive agents. Commonly, the scaffolds are modified with some bioactive factors including vascular endothelial growth factor and bone morphogenetic protein-2 (BMP-2) via ionic complexation and physical entrapment or adsorption

15-18

. Nevertheless, some deficiencies still exist

concerning the clinical application of traditional growth factors, such as price rigidity and short-term biological activities. As a result, it is hoped that some cheap and natural available drugs can be exploited to enhance the bioactivity of biomaterials. Icariin (ICA), a small bioactive molecular compound, is the main active ingredient of Chinese herbal medicine Epimedium for the treatment of osteoporosis in China

19

. Most of researches have revealed

4


Page 5 of 45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


that ICA can enhance osteoblast differentiation 20-22 and play its ossification via up-regulating BMP-2 gene expression 23. By the way, ICA can also promote vascular function by increasing endothelial NO synthase (eNOS) expression to increase nitric oxide (NO) production 24. As a well-known metal chelating agent, deferoxamine (DFO) was considered for clinical use with the approval of Food and Drug Administration (FDA)

25

. DFO possesses the facilitating

effects on angiogenesis by stimulating of the HIF-1α pathway 26. Also, it’s reported that DFO can enhance osteogenic differentiation of mesenchymal stem cells (MSCs) by activating the Wnt/β-Catenin pathway

27

. In most previous studies, both ICA and DFO have been used

either in vitro by adding directly to a cell culture medium or in vivo through injecting repeatedly into a damaged area. However, there is no literature has reported to immobilize ICA and DFO onto the surface of a substrate with the purpose of improving the osteogenesis and angiogenesis capabilities of the substrate. What’s more, no report has investigated the synergistic effect of immobilization of ICA and DFO together to elevate the osteogenic and angiogenic activity of a material. Thus, it's crucially essential and meaningful to develop an exploration strategy to explore and compare the osteogenesis and angiogenesis effects of the two categories of bioactive molecules (ICA and DFO) in the fabricating of a bone-repairing tissue engineering scaffold. The major objectives of this study are to explore the comprehensive influence of the hierarchical fibrous structure of a scaffold as well as the synergetic immobilized ICA and DFO on the osteogenesis and angiogenesis of cells, moreover, the osteogenesis and angiogenesis functions of ICA and DFO are also compared too. For this purpose, first, PLLA/CS composite membranes with a hierarchical fibrous structure were fabricated via 5



combining electrospinning with TIPS technology, then a versatile polydopamine (PDA) coating

28

was exploited to immobilize ICA and DFO singly or together onto the composite

membranes. The surface morphology, hydrophilicity, composition and mechanical properties of pure PLLA as well as functionalized PLLA fibrous membranes were investigated detailly. Furthermore, the adhesion, proliferation, differentiation as well as expression of osteogenesis factors of mouse embryo osteoblast precursor (MC3T3-E1) were studied. In addition, the attachment, growth and expression of angiogenic-related factors of human umbilical vein endothelial cells (HUVECs) were also explored. Based on such studies, the synergistic effects of the hierarchical structure as well as the immobilized ICA and DFO on the osteogenesis and angiogenesis functions of the PLLA based fibrous membrane can expect to be elucidated. 2.

Materials and methods

2.1. Materials and reagents PLLA (Mw = 200,000) was bought from Jinan Daigang Biomaterial Engineering Co., Ltd. CS, with the deacetylation degree of 85%, was supplied by Shandong Institute of Medical Instruments. Tris(hydroxymethyl) aminomethane (Tris), dopamine along with DFO were acquired from Sigma-Aldrich. ICA was gained from Beijing Century Aoke biotechnology Co., Ltd. Obtained from Guangzhou Chemical Reagent Plant, all other reagents are be equipped with analysis grade. 2.2. Electrospinning of PLLA fibrous membrane The dissolution of PLLA into co-solvents (N,N-dimethyl formamide/dichloromethane (DMF/DCM), and the volume ratio of DMF to DCM is 3: 7) was achieved, followed by the solution obtained (10%, w/v) which was straightly electrospun onto the aluminum 6


Page 6 of 45

Page 7 of 45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


foil-covered collector (15kV, with flow rate as 1mL/h, and space between needle and collector as 15±2 cm ). In a vacuum, with temperature up to 40 ℃, the electrospinning fibrous membranes were dried. 2.3. Preparation of PLLA/CS-PDA fibrous membrane Briefly, the solution of CS with a concentration of 0.075% (w/v) was achieved by the dissolution of 0.075 mg CS in 100 mL 0.025% (v/v) acetic acid aqueous solution at 20 ℃, in which, PLLA electrospinning membranes were immersed. After an hour’s soaking, the PLLA/CS complexes were taken out and further dipped into liquid nitrogen immediately for another 1 h. The frozen PLLA/CS membranes underwent freeze drying and put in in a vacuum oven for whole day to be dried, respectively, in which, the temperature was 40 °C. To gain a new dopamine solution with a concentration of 0.5 mg/mL, 50mg dopamine was dissolved in Tris-HCl buffer solution (10 mM, pH=8.5). The PLLA/CS membranes were immersed into the dopamine solution with magnetic stirring and exposed to the air at indoor temperature for 1 h. Followingly, the membranes were brought out followed by the complete cleaning of it with deionized water after the reaction. 2.4. Preparation of PLLA/CS-PDA/ICA/DFO fibrous membrane 1 mg ICA and 3 mg DFO were dissolved in 50 mL deionized water to gain a mixed solution of ICA/DFO. The above obtained PLLA/CS-PDA membranes were further dipped into the ICA/DFO mixed solution, followed by the shaking of it for the whole day to gain PLLA/CS-PDA/ICA/DFO membranes. Meanwhile, to compare the osteogenesis and angiogenesis functions of ICA and DFO, ICA solution and DFO solution were gained, and the concentration of the former is 0.02 mg/mL while that of the latter is 0.06 mg/mL, 7



Page 8 of 45

respectively. The PLLA/CS-PDA membranes were separately dipped into the ICA and DFO solution, shaken for 24 h to gain PLLA/CS-PDA/ICA and PLLA/CS-PDA/DFO membranes. Three groups of PLLA/CS-PDA composite membranes containing ICA and DFO were listed in Table 1. The quantities of ICA and DFO in the PLLA/CS-PDA composite membranes were determined using UV-Vis spectroscopy. ICA has a maximum absorbance at 270 nm, while DFO has a maximum absorbance at 429 nm as conversion to the ferrous sulfate solution. According to standard curves, known quantities of ICA and DFO which were firmly attached to the surface of PLLA/CS-PDA membrane (the membrane proportion was 12.56 cm2) could be measured, respectively. The calculated results were also listed in Table 1. An overview of the experiment procedure was demonstrated in Fig. 1.

Fig. 1. The schemata of the experiment procedure. Table 1 Three groups of PLLA/CS-PDA composite membranes containing ICA and DFO. Sample name

PLLA/CS-PDA/ICA

Bioactive

Deionized

The quantity

The quantity

molecule

water

of ICA

of DFO

(µg/12.56 cm2)

(µg/12.56 cm2)

41.95±1.36

0

1mg ICA

50mL 8


Page 9 of 45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PLLA/CS-PDA/DFO

3mg DFO

50mL

0

121.89±1.64

PLLA/CS-PDA/ICA/DFO

1mg ICA+3mg DFO

50mL

29.84±1.33

82.34±8.08

2.5. Characterization The morphologies of the well-produced fibrous membranes were noticed through field-emission scanning electron microscopy (FESEM, ULTRA 55, Germany Carl Zeiss). Water contact angle (WCA) of the fibrous membranes was observed employing a goniometer (DSA100, Germany, Kruss). The examination of surface chemical composition of the membranes

was

achieved

by

X-ray

photoelectron

spectroscopy

(XPS,

Thermo

ESCALAB-250 System, Australia) with an aluminum (mono) Kα source (1486.6eV), operation of which was 15 kV and 150 W. The measurement of tensile property was performed based on a universal mechanical testing machine (AG-1, SHIMADZU, Japan) with a crosshead rate as 3 mm/min. The immersion of specimens into phosphate buffered saline in the humid environment (PBS, pH=7.4) for two hours, followed by the test to obtain the wet tensile property of the membranes. 2.6. Cells cultivation Samples were put into a 24-well cultivation container, and both sides of the membrane were sterilized through being exposed to Ultra-violet light for one hour. Subsequently, the membranes were treated with prewetting in PBS for 1 h, followed by the seeding of cells onto the membrane surfaces (1×104 cells/well). The propagation of MC3T3-E1 cells on membranes were achieved in regular growth medium which was composed of α-minimum requisite medium (α-MEM), 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) pen-strep solution. HUVECs of human beings were propagated in RPMI-1640 replenished with 10% 9



(v/v) FBS and 1% (v/v) pen-strep solution. 2.6.1. Cell adhesion and proliferation assay The demonstration of cellular adhesion morphology was achieved under laser scanning confocal microscope (LSCM, Zeiss-LSM 510, Germany Carl Zeiss Jena). The immobilization of cells was achieved with 4% formaldehyde lasting fifteen minutes , followed by permeabilization with 0.1% Triton X-100 lasting five minutes. After two hours’ blocking with 3% FBS, the dyeing of cells was operated by sequential incubation as follows: leading antibody (vinculin, 1:100) was used for one hour, secondary antibody (FITC-conjugated 488 goat anti-mouse IgG H&L, 1:250) for one hour, cytoskeleton F-actin (rhodamine phalloidin) for half an hour and 20 minutes’ staining (DAPI) with nuclei. The digital quantification of average cell diffusion part was performed through Image J software. Cellular proliferation was assessed employing Cell Counting Kit-8 (CCK-8) assay, with the measurement of the results of optical density (OD) achieved at λmax 450nm through an enzyme-linked immunosorbent assay plate reader (Multiskan MK3, USA). 2.6.2. Alkaline phosphate (ALP) activity, ALP dyeing and calcium deposition assays of MC3T3-E1 cells on the fibrous membrane The determination of ALP activity of MC3T3-E1 cells was carried out employing ALP and bicinchoninic acid (BCA) protein assay kit. The measurement of OD numbers was performed at 492 and 570 nm, separately. Operated by CAKP staining, under the stereomicroscope (Stemi 2000-C, Carl Zeiss, Germany), the observation of ALP staining was achieved. As to calcium deposition assay, the incubation of MC3T3-E1 cells was performed separately employing standard growth medium and osteogenic medium. The staining of calcium 10


Page 10 of 45

Page 11 of 45 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


precipitation was operated employing 1% alizarin red (AR) for thirty min, followed by the examination under stereomicroscope. The 10% cetylpyridinium chloride (CPC) in PBS was employed to desorb the stained cells, along with measurement of the OD values at λmax 540 nm. 2.6.3. Quantitative real-time polymerase chain reaction (RT-PCR) and western blot The osteogenesis genes expression of runt-connected transcription factor-2 (Runx-2), ALP, type I collagen (COL I), osteocalcin (OCN) of MC3T3-E1 cells, and the angiogenesis genes expression of eNOS, hypoxia-inducing factor-1α (HIF-1α), VEGF and platelet-endothelial cellular adhesion molecule-1 (PECAM-1, namely CD31) of HUVECs cultured on the membranes were evaluated by RT-PCR and western blot. As to RT-PCR tests, the isolation of total RNA was achieved employing Trizol reagent (Invitrogen), along with inverse transcription into cDNA employing Prime Script RT reagent kit (Takara Bio Inc., Shiga, Japan). RT-PCR was implemented in a 7500 Real Time PCR System (Applied Biosystems, Carlsbard, CA, USA) and SYBR Green qPCR kit (Invitrogen). Two minutes were used to the amplification of cDNA samples under the temperature of 50 °C and another two minutes are used under the temperature of 95 °C, along with 40 cycles at 95 °C for 15 s, 60 °C for 32 s subsequently. The relative quantification of target genes was standardized to that of β-actin, and the 2−∆∆CT approach was employed to figure out the expression of gens. The PCR primer sequences were demonstrated in Table 2 and Table 3. For western blot assays, lysis of cells was operated with RIPA buffer. The determination of total protein density was performed employing BCA protein assay kit. With separation on SDS-PAGE, the proteins were shifted to PVDF membranes (Millipore, USA). The 11



Page 12 of 45

membranes were blocked with skim milk (5%) in TBST for 1 h, followed by the investigation with Runx-2, ALP, COL I and OCN antibodies and eNOS, HIF-1α, VEGF and CD31 antibodies throughout the night at 4 °C. Subsequently, the bands were visual after an hour’s incubation

with

horseradish

peroxidase-conjugated

secondary

antibodies

through

chemiluminescence employing an ECL detection kit (Amersham). β-actin and GAPDH antibody played the role of being an inner control, respectively. Table 2 Primers for osteogenic related genes of MC3T3-E1 cells. Primer

Forward sequence (5’- 3’)

Reverse sequence (3’- 5’)

Runx-2 TGCCCAGTGAGTAACAGAAAGAC CTCCTCCCTTCTCAACCTCTAA ALP

CGCTATCTGCCTTGCCTGTA

GGTTGCAGGGTCTGGAGAAT

COL-I

CTTCACCTACAGCACCCTTGT

AAGGGAGCCACATCGATGAT

OCN

AGGGCAATAAGGTAGTGAA

CGTAGATGCGTCTGTAGGC

β-actin

GCTTCTAGGCGGACTGTTAC

CCATGCCAATGTTGTCTCTT

Table 3 Primers for angiogenic related genes of HUVECs. Primer

Forward sequence (5’- 3’)

Reverse sequence (3’- 5’)

eNOS

AAGCGAGTGAAGGCGACAAT

GAGGGACACCACGTCATACT

HIF-1α

GTGGATTACCACAGCTGA

GCTCAGTTAACTTGATCCA

VEGF

GCAGATTATGCGGATCAAACC

TTTCGTTTTTGCCCCTTTCC

CD31

GCTGTCACTGTCCCCTAAGA

GTTAGGCAAAGGCTGAAGCT

GAPDH

GGGAAACTGTGGCGTGAT

GAGTGGGTGTCGCTGTTGA

2.6. Statistical analysis The mean ± standard deviation was used to denote the results of quantitative analysis, which was analyzed employing t-test of students to figure out the degree of importance of the statistics, in which, a value of P

Preparation of Icariin and Deferoxamine Functionalized Poly(l-lactide

Recommend Documents