Probing the HIV-1 NCp7 Nucleocapsid Protein with Site-Specific Gold

Article pubs.acs.org/IC

Probing the HIV‑1 NCp7 Nucleocapsid Protein with Site-Specific Gold(I)−Phosphine Complexes Raphael E. F. de Paiva,†,‡ Zhifeng Du,‡ Erica J. Peterson,‡ Pedro P. Corbi,† and Nicholas P. Farrell*,‡ ‡

Institute of Chemistry, University of Campinas − UNICAMP, P.O. Box 6154, 13083-970 Campinas-SP, Brazil Department of Chemistry, Virginia Commonwealth University, 1001 West Main Street, Richmond, Virginia 23284-2006, United States

†

S Supporting Information *

ABSTRACT: In this work, we examined a series of thiophilic Au(I) compounds based on [Au(L)(PR3)] (L = Cl−, 4dimethylaminopyridine (dmap); R= ethyl (Et), cyclohexyl (Cy)) for chemoselective auration of the C-terminal HIV nucleocapsid protein NCp7 F2 and the “full” HIV NCp7 (NC, zinc finger (ZnF)) as probes of nucleocapsid topography. The choice of phosphine allowed electronic and steric effects to be considered. The use of the heterocycle “leaving group” allowed us to study the effect of possible π-stacking with the essential tryptophan residue of NC on the reactivity and selectivity, mimicking the naturally occurring interaction between the zinc finger and nucleic acids. We also examined for comparison the “standard” gold−phosphine compound auranofin, which contains an S-bound glucose coordinated to the {Au(PEt3)} moiety. Both the nature of the phosphine and the nature of L affect the reactivity with the C-terminal NCp7 F2 and the “full” NC. 31P NMR spectroscopy showed the formation of long-lived {Au(PR3)}−ZnF species in all cases, but in the case of NCp7 F2, a selective interaction in the presence of the dmap ligand was observed. In the case of auranofin, an unusual Au−His (rather than Au−Cys) coordination was indicated on NC. The overall results suggest that it is useful to consider three aspects of zinc finger structure in considering the profile of chemical reactivity: (i) the zinc-bound cysteines as primary nucleophiles; (ii) the zinc-bound histidine as a “spectator” ligand; and (iii) ancillary groups not bound to Zn but essential for ZnF function such as the essential tryptophan in NCp7 F2 and NC. Modification of fully functional NC zinc finger by the Cy3P-containing species confirmed the inhibition of the NC−SL2 DNA interaction, as evaluated by fluorescence polarization.

■

INTRODUCTION One of the most remarkable structural and functional characteristics of the HIV-1 nucleocapsid protein (HIV NCp7, NC) is the presence of two -Cys-X2-Cys-X4-His-X4Cys- (C2HC) zinc f inger (ZnF) domains, typically found on nucleic acid binding proteins.1,2 The presence of ZnF domains is highly conserved among retroviruses, and any mutation of the Zn-bound residues results in loss of biological function.1,3 On the infectious HIV-1, NCp7 appears to be closely and strongly associated with RNA in the viral core.4 The two major functions of NCp7 are RNA binding and viral encapsidation, but evidence also suggests that NCp7 has a role in some other processes such as RNA dimerization, Gag−Gag interactions, membrane binding, reverse transcription, and stabilization of the protein complex preintegration.1,4 The cysteine residues of NCp7 are some of the most nucleophilic of all zinc-bound thiolates in proteins.5−8 As such, they are substrates for alkylation by electrophiles such as maleimide and iodoacetamide.9 In cellular assays, N-ethylmaleimide can inhibit retroviral infectivity in a concentrationdependent manner.10 Modification of cysteine residues by © XXXX American Chemical Society

alkylating agents such as iodoacetamide, 4-vinylpyridine, and acrylamide has also been used in mass spectrometric peptide mapping for protein identification.11 The zinc finger template is a ready source for metal ion replacement.12 The properties of gold compounds and [AuCl(PR3)] in particular make them an ideal system for probing cysteine nucleophilicity in biomolecules, directly analogous to the “organic” electrophiles. Indeed, early studies on Au(I) compounds such as aurothiomalate suggested possible zinc finger inactivation as contributing to their antiarthritic activity.13 The complex [AuCl(PEt3)] has been examined for specificity of reaction with respect to model zinc peptides with differing zinc coordination cores.14 The complex was also used for targeting the de novo-designed coiled coil TRIL23C, binding to Cys residues.15 With [AuCl(PPh3)], both {(PPh3)AuF} and {AunF} species (where F is formally the apo peptide) are formed with the C-terminal finger of NCp7 F2 and the F3 finger of the transcription factor Sp1-F3, where the latter Received: July 10, 2017

A

DOI: 10.1021/acs.inorgchem.7b01762 Inorg. Chem. XXXX, XXX, XXX−XXX

Article

Inorganic Chemistry

Many different methods were attempted to isolate the solid product, but it rapidly decomposes with reduction to Au(0). In order to characterize and use this compound, the synthetic procedure was carried out in solution. For 1H and 31P NMR experiments, 1 equiv of the chloride precursor (1) and 1 equiv of solid AgNO3 were mixed in deuterated acetonitrile. The suspension was stirred for 1 h, and the AgCl that precipitated was removed with a syringe filter. To the remaining solution was added 1 equiv of dmap. Spectral changes confirmed the substitution. The same procedure, but with nondeuterated acetonitrile, was used to prepare the compound for mass spectrometry (MS) assays. 1 H NMR data for compounds 1, 2, 3, and 4 are provided in Figure S1. NCp7 (F2 and “Full Finger” NC) Preparation. Preparation was as previously published.17,20,21 An adequate amount of apo-NCP7 F2 or apo-NC was dissolved in water, and 1.2 equiv of zinc acetate was added per zinc core. The pH was adjusted to 7.2−7.4 using a solution of NH4OH. The solution was incubated for 2 h at 37 °C prior to any other experiments. The ZnF formation was confirmed by circular dichroism (CD) spectroscopy and MS, where the overall CD profile and species distribution in MS were in agreement with data previously reported in both cases.17,20,21 Ligand Scrambling Evaluation. 31P NMR Spectroscopy. A 10 mmol L−1 solution of compounds 1−4 was prepared in deuterated acetonitrile. 31P NMR spectra were recorded on a Varian Mercury 300 MHz (7.05 T) NMR spectrometer, referenced to trimethyl phosphate, using 256 scans at 20, 27, 34, 41, and 48 °C. UV−Vis Spectroscopy. The [AuCl(Cy3P)] (3) (4.3 × 10−4 mol L−1) and [Au(dmap)(Cy3P)]+ (4) (1.7 × 10−4 mol L−1) solutions were prepared in acetonitrile. UV−vis spectra were recorded on an HP 8453 spectrophotometer equipped with a diode array detector. The temperature was set to 20, 27, 34, 41, 48, or 55 °C using a Peltier unit. After 55 °C was reached and the respective spectra were acquired, the temperature was returned to 20 °C and the spectra were recorded once again. Interaction with Model Biomolecules. Ligand Displacement by N-Acetyl-L-cysteine (N-Ac-Cys). NMR Spectroscopy. To a 10 mmol L−1 solution of the Au(I)−phosphine compound in acetonitrile was added 1 equiv of N-Ac-Cys. 1H and 31P NMR spectra were acquired immediately after mixing and over time (after 1, 2, 24, and 96 h). Electrospray Ionization Mass Spectrometry (ESI-MS). To a 14 mmol L−1 of the Au(I)−phosphine compound in acetonitrile was added 1 equiv of N-Ac-Cys dissolved in water. ESI-MS spectra were acquired immediately after mixing and at appropriate time points later where necessary. Tryptophan Fluorescence Quenching Assay. Stock solutions (7.5 mmol L−1) of the dmap-functionalized compounds (2 and 4) were prepared. The quenchers were titrated into a cuvette containing 3.0 mL of a 5 μmol L−1 solution of N-acetyltryptophan to give N-AcTrp:quencer ratios from 1:1 up to 1:100. The spectral window monitored was 300−450 nm with λex = 280 nm. The detector voltage was 750 V, the temperature was 20 °C, and the scan rate was 600 nm/ min. For the Stern−Volmer model, the linearized data were obtained at λmax = 362.9 nm. Interactions with Zinc Fingers. Circular Dichroism Spectroscopy. Samples of NCp7 F2, apo-NCp7 F2, “full” NC, or “full” apo-NC peptides (50 μM) were used. For time-based measurements, 1.3 equiv of the Au(I)−phosphine compound was added, and spectra were recorded immediately after mixing and after 1, 6, and 24 h. For concentration-dependent measurements (titration), [Au(dmap)(Et3P)]+ was added in the range ri = 0.3−1.3, where ri is the Au complex:ZnF molar ratio. Mass Spectrometry. For MS experiments, 1 mM reaction mixtures (1 equiv of Au complex per ZnF core) were prepared in water/ acetonitrile mixtures at pH 7.0 (adjusted using NH4OH). The reaction solutions were incubated at room temperature for 0, 2, 6, or 24 h. The samples were sprayed using a final concentration of ∼100 μM. Experiments were carried out on an Orbitrap Velos from Thermo Electron Corporation operated in positive mode. Samples (25 μL) were diluted with methanol (225 μL) and directly infused at a flow

tends to show a higher propensity for the {AunF} species over the {(PPh3)AuF} species.16 The coordination preferences of linear Au(I) in the cysteine-rich environments of both these individual zinc fingers have been probed by traveling-wave ion mobility mass spectrometry, and conformational isomers have been identified.17 The properties of [AuCl(PR3)] can be further modified by varying the phosphine for both steric and electronic effects. Phosphines and carbenes are particularly well suited as carrier ligands when designing Au(I) complexes, as they form stable and strong bonds with Au(I) and the formed Au(I) complexes retain good air and moisture stability.18,19 The more general structure [Au(L)(PR3)] also allows for modification of L if we consider L as “leaving group” and PR3 as “carrier group” for interactions with biomolecules. The two aromatic residues in the structure of NCp7 (Phe16 and Trp37) are responsible for π-stacking with purine and pyrimidine residues on RNA and DNA.1,3,4 The importance of these ancillary residues in dictating the reactivity can be explored by introducing aromatic coligands with good π-stacking ability such as a purine or 4-dimethylaminopyridine (dmap) in the L position of [Au(L)(PR3)].16 In this work, we combined these two components (phosphine ligands based on basicity and steric hindrance and heterocycle L versus Cl−) to explore the analogy between “organic” and Lewis acid electrophiles and to examine the gold compounds for chemoselective auration and as useful probes of NC topography. We also examined for comparison the “standard” gold−phosphine compound auranofin, which contains an S-linked sugar ligand coordinated to the {Au(PEt3)} moiety. Both the nature of the phosphine and the nature of L affect the reactivity with the C-terminal NCp7 F2 and the fully functional NC.

■

EXPERIMENTAL SECTION

Materials. H[AuCl4] and triethylphosphine (Et3P) were purchased from Acros. Tricyclohexylphosphine, 4-dimethylaminopyridine, 2,2′thiodiethanol, and auranofin were obtained from Sigma-Aldrich. Deuterated solvents were obtained from Cambridge Isotopes or Sigma-Aldrich. Synthesis and ZnF Preparation. Chloro(phosphine)gold(I) Complexes. [AuCl(Et3P)] (1) was synthesized by an adaptation of an already published method.14,17 In brief, H[AuCl4] (0.50 mmol, 194 mg) was dissolved in 1.0 mL of distilled water, and the resulting solution was cooled in an ice bath. 2,2′-Thiodiethanol (1.17 mmol, 117 μL) was dissolved in 360 μL of EtOH, and this solution was added slowly (over ∼4 h, 10 μL per addition) to the Au(III) solution. Throughout the addition, the solution changed from yellow (Au(III)) to colorless (Au(I)), and the brown-orange byproduct was filtered off. Et3P was dissolved in 360 μL of EtOH, and the resulting solution was cooled in the freezer and then added to the Au(I) solution. A white crystalline solid was obtained immediately. The stirring was carried for a further 30 min, and the solid was isolated by filtration and purified by recrystallization from water/EtOH (1:1). δ (31P) in CD3CN = 33.63 ppm. Anal. Calcd for C6H15AuClP (%): C, 20.56; H, 4.31. Found (%): C, 20.58; H, 4.22. [AuCl(Cy3P)] (3) was synthesized following the same procedure as described for [AuCl(Et3P)]. δ(31P) in CD3CN = 55.42 ppm. Anal. Calcd for C18H33AuClP (%): C, 42.16; H, 6.49. Found (%): C, 41.62; H, 6.04. [Au(dmap)(Cy3P)]+ (4) was synthesized following the procedure previously reported by us for [Au(dmap)(Ph3P)]+.21 δ (31P) in CD3CN = 51.82 ppm. Anal. Calcd for [Au(dmap)(Cy3P)](NO3), C25H43AuN3O3P (%): C, 45.39; H, 6.55; N, 6.35. Found (%): C, 44.19; H, 6.02; N, 6.12. The compound [Au(dmap)(Et3P)]+ (2) is light-sensitive in the solid state but stable in solution with δ(31P) in CD3CN = 30.05 ppm. B


Article

Inorganic Chemistry

Figure 1. Designed gold(I) compounds 1−4. Auranofin was studied within the Et3P series because of structural similarities. The Tolman cone angle (in degrees) and pKa values are also given. Triphenylphosphine (PPh3) data are also provided for comparison. The NC “full” zinc finger structure is shown (with NCp7 F2 boxed), highlighting the Zn-bound residues. rate of 0.7 μL/min using a source voltage of 2.30 kV. The source temperature was maintained at 230 °C throughout. 31 P NMR Spectroscopy. NCp7 F2. Aliquots (500 μL) of a 0.3 mM stock solution of NCp7 F2 were mixed with 1.3 equiv of compounds 1−5 dissolved in acetonitrile. The reactions were monitored from t = 0 up to 4 days. Spectra were recorded on a Varian Mercury 300 MHz (7.05 T) spectrometer, referenced to trimethyl phosphate, using 256 scans and standard phosphorus parameters. NC “Full” Finger. Aliquots (375 μL) of a 0.129 mM stock solution of NC “full” zinc finger were mixed with 2.6 equiv of compounds 1−4 and auranofin dissolved in acetonitrile. The reactions were monitored from t = 0 up to 8 days. The final spectra, acquired after 8 days of incubation, were recorded with standard phosphorus parameters and 256 scans as above. NC−SL2 DNA Interaction and Inhibition. The experiments followed our literature protocol.20,21 An NC and SL2 binding control experiment was performed as follows: A range of concentrations of NC (amino acids 1−55) were mixed with 100 nM 3′-fluoresceinlabeled hairpin SL2 DNA (sequence GGGGCGACTGGTGAGTACGCCCC) in a final volume of 50 μL of buffer containing 1.25 mM NaCl and 0.125 mM HEPES (pH 7.2) in a 96-well black, lowbinding microplate (Greiner). Fluorescence polarization (FP) readings were recorded immediately on a Beckman Coulter DTX880 plate reader. To examine inhibition of NC-SL2 binding, compounds 3 and 4 at various concentrations were incubated with 5 μM NC for 1 h before addition of 100 nM SL2 DNA in a final volume of 50 μL of buffer

containing 1.25 mM NaCl and 0.125 mM HEPES (pH 7.2) in a 96well black, low-binding microplate (Greiner). The NC concentration was chosen from the NC−SL2 binding experiment such that 90% of SL2 was bound. FP readings were recorded immediately. Predicting Zinc Finger Auration Sites Using Blue Star STING. The module Java Protein Dossier (JPD) was used to analyze and compare the four zinc-bound ligands of NCp7 F2 (Cys36, Cys39, His44, and Cys49). 22,23 Three parameters were selected for comparison: electrostatic potential at the last heavy atom (LHA), accessibility, and sponge. Electrostatic potential values were calculated using the Delphi program according to the modifications done by Rocchia and further adapted to JPD requirements.24,25 The numerical values are expressed in units of kT/e. The amino acid accessibility was calculated according to the SurfV program.26 JPD shows three values: for the protein chain in isolation, for the protein chain in complex with the other chain (if) present in the PDB file, and finally, a relative accessibility (the last one given by the table of absolute solventaccessible areas for amino acids). Numerical values are expressed in units of Å2. Sponge was calculated as the sum of van der Waals volumes for all atoms encountered within a sphere of a given radius divided by the volume of the sphere. The values reported in Table 2 were obtained for spheres centered on the LHA with radius of 5 Å. The numerical values are dimensionless. The evaluated parameters consider the peptide in its apo form. C


Article

Inorganic Chemistry

Table 1. Summary of 31P NMR Chemical Shifts for the Reaction Products of the Au(I)−Phosphine Compounds with CTerminal NCp7 F2 and “Full” NCa δ(31P)/ppm

a

compound

reagent

[AuCl(Et3P)] [Au(dmap)(Et3P)]+ Auranofin [AuCl(Cy3P)] [Au(dmap)(Cy3P)]+

33.63 30.05 39.05 55.42 51.82

NCp7 F2 products (Δδ) 43.04 46.96 43.04 56.54 57.22

(9.41); 49.62 (15.99) (16.91) (3.99); 34.67 (−4.39) (1.12); 59.80 (4.37) (5.40)

“full” NC product (Δδ) 47.28 47.28 32.40 64.12 64.11

(13.65) (17.23) (−6.65) (8.70) (12.29)

N-Ac-Cys products: [Au(dmap)(Et3P)]+, 47.24 ppm; [Au(dmap)(Cy3P)]+, 57.67 ppm.

Figure 2. (A) 31P NMR spectra of the reaction products obtained after incubation of NCp7 F2 with Au(I)−phosphine compounds for 6 h: (1) [AuCl(Et3P)]; (2) [Au(dmap)(Et3P)]+; (3) [AuCl(Cy3P)]; (4) [Au(dmap)(Cy3P)]+. (B) 31P NMR spectra after 8 days of the reaction products obtained upon incubation of NC with (1) [AuCl(Et3P)], (2) [Au(dmap)(Et3P)]+, (3) [AuCl(Cy3P)], and (4) [Au(dmap)(Cy3P)]+.

■

RESULTS AND DISCUSSION Ligand Scrambling Evaluation. The structures of the compounds of general structure [Au(L)(PR3)] are shown in Figure 1. They were chosen to vary the electronic and steric properties of the phosphine as well as the putative leaving group L. The use of 4-NMe2-pyridine (dmap) allowed evaluation of the influence of a group capable of stacking with the tryptophan of NCp7 F2, while auranofin with the Sbound sugar moiety was expected to be kinetically inert with respect to displacement by the similar S-donor Cys. Ligand Scrambling. Ligand scrambling is an inherent property of Au(I)−phosphine complexes (eq 1):27,28 2[(R3P)AuL]+ → [(R3P)2 Au]+ + [AuL 2]+

chemical shift change (0.457 ppm) was that for compound 4 containing the dmap ligand (Scheme S3). Overall it is possible to affirm that ligand scrambling happens to only a small extent in our systems. Interaction with Model Biomolecules. The interaction of Au(I)−PR3 compounds with N-acetyl-L-cysteine (N-Ac-Cys) as a model for sulfur-containing proteins was followed by ESIMS and 31P NMR spectroscopy. When the chloride precursors 1 and 3 were mixed with N-Ac-Cys, immediate precipitation of a white solid occurred, explained by the possible polymeric nature of the product {Au(I)(N-Ac-Cys)}n, which has been characterized previously.16,30 In contrast, when the dmapfunctionalized compounds were mixed with N-Ac-Cys, the products remained a sufficient time in solution, with 31P NMR shifts from 30.05 to 47.24 ppm and 51.82 to 57.87 ppm for the PEt3 and PCy3 compounds, respectively, consistent with replacement of dmap by a sulfur donor (Figure S3). In the ESI-MS spectra of the chloride precursors 1 and 3 (carried out at much lower concentrations than the NMR experiments), strong peaks at m/z 792.13 and 1116.42 are assigned to a sulfur-bridged [(R3P)Au−μ-(N-Ac-Cys)−Au(PR3)] species for PEt3 and PCy3, respectively (Figures S4 and S5). The ligand scrambling products [Au(PR3)2]+ are also observed. Simple chloride replacement by N-Ac-Cys, corresponding to [(Cy3P)Au(N-Ac-Cys)], is also observed for compound 3 at m/z 640.23 (Figure S5). A trinuclear gold

(1)

The extent of disproportionation depends on intrinsic (steric hindrance and basicity of the phosphine as well as the nature of the coligand) and extrinsic (polarity of the solvent, ionic strength of the medium) factors. The 31P NMR chemical shifts of [Au(PEt3)2]+ and [Au(PCy3)2]+ have been reported as 44.17 and 62.12 ppm, respectively.29 Here we evaluated only the intrinsic factors, with the extrinsic factors kept constant (acetonitrile as the solvent without added electrolytes). UV−vis and 31P NMR spectra of complexes 1−4 at varying temperatures showed only modest changes (Figures S1 and S2 and Schemes S1−S3). The largest D


Article

Inorganic Chemistry

Figure 3. ESI-MS spectra (positive mode) for the reactions between NCp7 F2 (abbreviated ZnF for clarity) and (A) [AuCl(Et3P)] (1), (B) [Au(dmap)(Et3P)]+ (2), (C) [AuCl(Cy3P)] (3), and (D) [Au(dmap)(Cy3P)]+ (4). Spectra for 1, 3, and 4 were obtained immediately after incubation, and that for 2 was obtained after 6 h.

basicity of the PEt3 and PCy3 ligands.16 The stacking is also significantly favored by an order of magnitude in comparison with previously reported [(dmap)(dien)Au(III)]3+ and [(dmap)(dien)Pt(II)]2+ complexes.31,32 In general, Au(I) and Au(III) compounds are too reactive for measurement of their association constants with the zinc fingers themselves, but it is noteworthy that the Ka found is the highest we have observed in our studies and also comparable to those of many organic moieties used to target NCp7.33,34 Electrophilic Attack on Zinc Fingers Studied by 31P NMR Spectroscopy. When interacting with a biomolecule, His versus Cys coordination can be easily distinguished by 31P NMR spectroscopy, which is sensitive to the nature of the L ligand in a R3P−Au−L compound. Table 1 summarizes the data obtained by probing NCp7 F2 and the full NC, and the spectra are shown in Figure 2. Probing NCp7 F2. Upon reaction with NCp7 F2, all of the compounds presented downfield shifts for the 31P signal, consistent with Au−sulfur binding. Two phosphorus-containing species were observed for the chloride-containing [AuCl(Et3P)] and [AuCl(Cy3P)], whereas the dmap-functionalized compounds showed only a single phosphorus-containing signal with the target protein. The pattern is the same for both phosphines, with the signal arising from the dmap compounds intermediate in chemical shift between the two signals resulting from reaction of the chloride species. The results confirm the

species is observed at m/z 1151.13 upon incubation of 1 with N-Ac-Cys, corresponding to [Au3(N-Ac-Cys)2(Et3P)2]+, but this species is no longer present after 24 h (Figure S4B). For the dmap-functionalized compounds (2 and 4), the profile is the same, but the intensities of the thiolate-substituted products relative to [Au(R3P)2]+ are much lower than for 1 and 3 (Figures S6 and S7). [(R3P)Au]+ species corresponding to cleavage of the Au−N bond are also observed in both cases, along with low-intensity peaks corresponding to monodentate thiolate binding [(R3P)Au(N-Ac-Cys)], indicative of a lower reaction rate for compounds 2 and 4 compared with the chloride precursors 1 and 3. Besides the effects of electronic structure and steric demands of the phosphine, a second relevant feature for probe design in the general structure [Au(L)(PR3)] is how potential stacking of the dmap-functionalized compounds 2 and 4 with the single tryptophan entity of NCp7 F2 could affect the overall reaction profile, considering dmap as the leaving group. The association constants (KSV) for [Au(dmap)(Et3P)]+ (2) and [Au(dmap)(Cy3P)]+ (4) with N-Ac-Trp were calculated as 4.0 × 105 and 6.2 × 105 M−1, respectively, from fluorescence quenching assays using the Stern−Volmer model (Figure S8). The straight-line shape of the plots for both systems is indicative of pure static quenching, as expected for π-stacking. The measured association constants are almost an order of magnitude higher than observed for [Au(dmap)(PPh3)]+, reflecting the stronger E


Article

Inorganic Chemistry

Figure 4. ESI-MS spectra (positive mode) for the reactions between NC “full” ZnF and (A) [AuCl(Cy3P)] immediately after incubation, (B) [AuCl(Cy3P)] after 6 h incubation, (C) [Au(dmap)(Cy3P)]+ immediately after incubation, and (D) [Au(dmap)(Cy3P)]+ after 6 h incubation.

persistence of {PR3Au}−protein species previously observed for the PPh3 ligand, but all of the resonances are much sharper, suggesting that the specific environment is less flexible in the present case. These results further imply a greater selectivity as a consequence of replacement of the chloride by the stronger σ donor dmap, allied with possible contributions from the π−π stacking (Figure 2A). ESI-MS. The formation of S-bound products was confirmed by ESI-MS. There are many species observable in the gas phase, but in general a limiting sequence of reactions can be discerned

in all cases, along with multigold species attributed to the presence of the multiple coordination sites on the zinc finger: [Au(L)(PR3)] → [Au(PR3)−ZnF] → [Au(PR3)−apo‐F]

and [Au(PR3)−ZnF] → [Au−ZnF] → {AuF}

The two phosphine compounds show similar profiles with slight differences between the Cl and dmap precursors (Figure 3). For the Cl-containing precursors, in examining the 3+ F


Article

Inorganic Chemistry

6+) upon incubation (Figure 4A). The bisphosphine compound [Au(Cy3P)2]+ is also observed at m/z 757.43, along with the aurated species (Cy3P)Au−Zn1F (8+ at m/z 871.77, 7+ at m/z 996.03). A Zn1F species in multiple charge states (10+, 9+, 8+) is also observed (Figure 4A). After 6 h (Figure 4B), the spectrum is dominated by apo peptide species (11+ to 6+), and AuF is the only Au-containing peptide species (8+, 7+). Production of apo peptide was not observed for the Cterminal finger (Figure 3C). The initial spectrum obtained for the interaction between [Au(dmap)(Cy3P)]+ and NCp7 is similar to that obtained for [AuCl(Cy3P)] (Figure 4C). On the other hand, a much more complex metalation profile was observed after 6 h incubation, with the bisphosphine compound still appearing as the most intense species (Figure 4D). A mixture of Zn2F (8+, 7+), Zn1F (9+, 8+, 7+), and apo peptide (8+, 7+, 6+) was observed. In terms of aurated species, AuF (8+, 7+, 6+) and the bimetallic species Au−Zn1F (8+, 7+) were identified. The profile is again different from that of the Cterminal NCp7 F2, which, combined with the different 31P NMR spectra, suggests that the different environments can lead to different reaction pathways and different products. The “full” NC has a CD profile very similar to that observed for NCp7 F2, with a valley at 200 nm and a positive absorption region with a maximum at 218 nm. Interestingly, a quick reaction (at t = 0) is observed for compound 4, with an increase in intensity of the negative absorption at 200 nm. For both compounds the positive band remains, and the spectra again indicate the presence of ordered structuresthe spectra are similar but not identical to those generated using Au(III) compounds20 (Figure S14). The Case of Auranofin: Is Histidine a Spectator Ligand? Auranofin remains the prototypical gold-based drug and is structurally related to compounds 1 and 2. In vivo, loss of the sugar moiety is part of the activation of the drug, but in biophysical studies, the presence of the S-bound ligand would a priori suggest lower reactivity toward S-rich ligands such as zinc fingers compared with Cl− and even N-based leaving groups. There is some discrepancy in the literature on the reactivity of auranofin with zinc fingers, which is possibly a reflection of the techniques and conditions employed. Auranofin reacts slowly with a Cys2His2 model apo peptide but does not displace Zn from the Zn peptide.36 On the other hand, monoadduct {AuF} species were identified by mass spectrometry when auranofin reacts with a Zn(Cys2HisCys) modeled from a PARP sequence but not with the apo peptide.37 Interactions of auranofin with zinc fingers corresponding to the C-terminal HIV-2 NC protein (Cys2HisCys) from two different isolates also showed Zn displacement using spectrophotometric and mass spectrometric techniques.38 In the system studied here, ESI-MS (Figure S15) and CD spectra with NCp7 ZnF2 demonstrated features similar to those found for compounds 1 and 2. The 31P NMR spectra are very instructive: weak signals are observed for both zinc fingers (Figure S16) but a shielding effect is observed in both cases. For the C-terminal finger, signals at 43.04 and 34.67 ppm are relative to auranofin itself at 39.05 ppm. The low-field shift is easily attributed to Cys displacement and is identical to that observed for reaction with 1. The upfield shifts have been observed in reactions of auranofin with bovine serum albumin and have been attributed to [(PEt3)Au−N-donor)] species.39,40 In our case, therefore, these resonances are reasonably attributed to His (N) rather than Cys (S) binding, comparing all of the chemical shifts. In agreement, MS−MS data for the

charge state species, the presence of the {(PR3)Au} moiety bound to the peptide is confirmed by the presence of peaks attributed to Au(PR3)−ZnF and Au(Et3P)−apo-NCp7 species, the latter presumably caused by ejection of zinc from the former. A multinuclear Au2(Et3P)−apo-NCp7 species, equivalent to that found with N-Ac-Cys, is also observed for 1 (Figure 3A). At longer reaction times (2, 6, and 24 h), the spectra are quite similar. The presence of an interesting Au− ZnF species is seen for both phosphine cases, and in the PEt3 case it is accompanied by a weak peak for the simple “gold finger” AuF. Slightly different profiles are seen for the dmap derivatives (Figure 3B,D). Especially, while the [Au(PR3)−apo-F] and Au−ZnF species are seen, the companion [Au(PR3)−ZnF] is not observed in either case. This may suggest that the expected initial stacking of the dmap moiety assists in weakening the affinity of the peptide for the structural zinc atom. For [Au(dmap)(Et3P)]+ (2), the auration of the peptide is much slower, and the products are not observed immediately; zinc ejection is only observed after 6 h, but the profile otherwise remains similar to those of the chloride products (Figure 3B). Circular Dichroism. Circular dichroism spectroscopy can be used to evaluate conformational changes caused by zinc ejection. The characteristic CD profile of NCp7 (ZnF2) has a negative signal centered around 205 nm, which is shifted to 200 nm upon zinc ejection.31,35 The most prominent change in the CD spectrum of the apo peptide compared with NCp7 (ZnF2) is the loss of the positive absorption bands at ∼190 nm and in the range 215−225 nm. All of the compounds cause some degree of conformational change in the NCp7 F2 secondary structure upon interaction, with a decrease in the intensity of the positive bands and a slight blue shift for the negative one (Figure S9). However, the spectra over time show neither a total decrease of the positive band nor an increase in intensity indicative of the apo peptide as the major species. CD spectroscopy reflects the contributions of multiple species, and these observations overall suggest the formation of structured gold finger products with an organized secondary structure. Upon further analysis of the intensity of the positive band at 215−230 nm, it is possible to observe that the dmap-containing compounds (Figure S9B,E) seem to be less reactive than the chloride counterparts (Figure S9A,D). Probing the NC “Full” Zinc Finger. The fully functional two-finger NC relies on the cooperation between the two zinc finger domains, which are linked by a flexible, highly basic sequence RAPRKKG, for recognizing specific nucleic acid sequences. Figure 2B shows the spectra obtained for the reaction products, where a single, identical 31P signal was observed for the pairs 1 and 2 and also 3 and 4. Furthermore, this 31P signal is different from those observed for the Cterminal NCp7 F2 (individual comparisons are shown in Figures S10−S13). This is indicative that the phosphine ligand appears in different chemical environments when interacting with the two peptides (C-terminal and “full” zinc finger) and that the cysteine environments are also not identical. The only case where the chemical shifts of the reaction products with both peptides are almost identical is for [Au(dmap)(Et3P)]+ (Figure S11). ESI-MS and CD Spectroscopy. Because of the photosensitivity of compound 2 and its lack of isolation, further spectroscopic studies were carried out only for the PCy3 compounds and the “full” NC (Figure 4). For [AuCl(PCy3)], unreacted Zn2F is observed in multiple charge states (8+, 7+, G


Article

Inorganic Chemistry

Figure 5. Fluorescence-polarization-based binding assays. (A) Fully functional NC−SL2 binding. (B) [AuCl(Cy3P)] (triangles) and [Au(dmap)(Cy3P)]+ (squares) inhibition of NC−SL2 complex formation.

Scheme 1. Schematic of NC Auration Leading to Inhibition of Nucleic Acid Binding

compounds discovered from library screening of organic moieties.33,34 The proposed mechanism of inhibition caused by the Cy3P series is presented in Scheme 1. Predicting the Auration Sites in Zinc Fingers. We have previously used traveling-wave ion mobility MS to examine the conformational preferences of AuF from NCP7 F2, with two major Cys-Au-Cys conformations identified through Cys36Cys49 and Cys39-Cys49 binding.17 One minor conformation was also found.17 It is reasonable to consider that the origin of the conformers may arise from loss of PR3 from the initial {PR3Au−F} species. In this case the observation of two 31P NMR signals could indicate the two different environments dictated by the difference in the electrostatic potentials of the cysteines, and it is furthermore now reasonable to suggest that different conformations of {AuF} arise from the loss of the PR3 from distinct {PR3Au−F} species and auration of a second cysteine. We previously used the bioinformatics software Blue Star STING (Sequence To and withIN Graphics) (see the Experimental Section) to evaluate potential binding site preferences of the {Pt(en)} moiety in Sp1 transcription factor zinc fingers.22,23,42 The analysis was broadly in agreement with previous analyses showing Cys39 and Cys49 as most likely sites for electrophilic attack.5,6 In the present case, Table 2 summarizes the accessibility properties as well as the electrostatic potentials of the individual Zn-bound peptide residues. The cysteines in the zinc coordination sphere can be grouped into two different categories: Cys36, with an electrostatic potential at the LHA (E.P.@LHA) of −18.3, and Cys39 and Cys49, with E.P.@LHA close to −35. Taking into account how crowded the neighborhood of each residue is, we suggest that

modified C-terminal NCp7 F2 show aurated fragments indicative of Au−His binding as well as fragments associated with the expected Au−Cys binding. (Figure S17) In the case of NC, the product peak at 32.40 ppm is also attributable to a [(PEt3)Au−His] moiety, along with unreacted auranofin, observed even after 8 days. The observation of only (PEt3)Au−His binding in the full NC whereas the C-terminal finger shows both [(PEt3)Au−Cys] and [(PEt3)Au−His] peaks again suggests that the environment of the cysteines is subtly changed compared with that in the fully functional peptide. NC “Full” Zinc Finger−SL2 DNA Interaction Inhibition. As shown in Figure 5A, fluorescence polarization (FP) was used to assay complex formation between the NCp7 “full” zinc finger and SL2 DNA.20,21 A Kd of 899 ± 46 nM was determined using the Michaelis−Menten/Hill model (n = 1) (Figure 5A), similar to published results.20,21,41 Figure 5B shows the results when [AuCl(Cy3P)] (3) and [Au(dmap)(Cy3P)]+(4) were added to reactions containing 5 μM NC, where 90% of SL2 was bound. Dissociation of the NCp7−SL2 complex was observed, and inhibition constants of 28.6 and 22.0 μM were obtained for [AuCl(Cy3P)] and [Au(dmap)(Cy3P)]+, respectively, using an exponential regression model. FP demonstrates the final outcome of the auration process, since the natural function of the NC “full” zinc finger relies on its interaction with the viral RNA. The large Au(I)−PCy3 moiety seems to be required for the inhibition, since Et3P-containing compounds caused no significant inhibition (data not shown). In the case of auranofin, at least this can be attributed to its kinetic inertness. The compounds display similar efficiency to [Au(dien)(9EtGua)]3+.20 The micromolar inhibition in all cases is somewhat weaker but still within the range of some inhibitory H


Article

Inorganic Chemistry Table 2. Java Protein Dossier (JPD) Descriptors for ZincCoordinated Residues Found in the NCp7 Structure (from PDB Entry 1MFS)a description

residue

E.P.@ LHA

accessibility

sponge

HIV-1 nucleocapsid protein, F1

C15 C18 H23 C28 C36 C39 H44 C49

−18.68 −27.16 −84.13 −10.76 −18.3 −33.35 −90.22 −35.91

0 66.84 42.85 17.19 2.42 52.88 41.04 15.17

0.99 0.53 0.53 0.70 0.73 0.53 0.69 0.66

HIV-1 nucleocapsid protein, F2

a

See the Experimental Section for details of the parameters.

22,23,42

in this case through the slow displacement of the S-bound thioglucose. We are currently pursuing further details of this reaction. It is relevant in this context to note the work of Meade, who has used DNA-tethered Co(III) chelates (with known high affinity for nitrogenous ligands) to selectively modify histidines in a model Cys2HisCys zinc finger peptide as well as the Cys2His2 Sp1 transcription factor.43−45 The combined results clearly show that histidine is not simply a “spectator” ligand in zinc finger coordination spheres and opens up interesting targeting possibilities for coordination compounds based on their kinetic inertness.

■

SUMMARY In this work, we explored structural variations in the phosphine ligand to fine-tune the reactivity of a series of Au(I) Lewis acid electrophiles for probing zinc finger proteins. By combining MS with 31P NMR spectroscopy, we were able to follow the interaction products formed within a couple of seconds up to a few days, since the PR3−Au−peptide species appear remarkably robust. Whereas the reaction of compounds 1 and 4 with NCp7 F2 yielded phosphines in more than one chemical environment, as observed by 31P NMR spectroscopy, one single signal was observed for the dmap-functionalized compounds. These features may be attributed to its enhanced π-stacking properties, mimicking the naturally occurring interaction between NCp7 and nucleic acids, as well as its expected slower displacement. The π-stacking observed may also enhance Zn ejection. Only one signal is observed for the full NC, and the final products of the pairs 1 and 2 and also 3 and 4 suggest some shielding of cysteines in the full peptide. The linking basic residues and the zinc fingers have been proposed to cooperate

.

Cys49 should be slightly more prone to initial electrophilic attack than Cys39 but also less accessible (Figure 6). Histidine as the Site of Binding. To our knowledge, the observation of histidine binding is the first for the reactions of the HIV nucleocapsid protein with electrophiles. The vast majority of discussions on NC reactivity, especially in relation to drug targeting, have focused on the nucleophilicity and availability of the cysteines.5−8 However, the bioinformatics parameters do show that the histidines are reasonably accessible with good electrostatic potential. Comparison of the histidine accessibilities in the two fingers strongly suggests the Cterminal His 44 as the potential specific site of binding for auranofin. The observation of the histidine-bound auranofin adduct raises the possibility that kinetic preferences may dictate the initial binding sites followed by formation of the most thermodynamically stable Au−Cys species, perhaps observable

Figure 6. Contact interaction map for the zinc-coordinated residues in the zinc finger nucleocapsid NC protein: (A) N-terminal finger; (B) Cterminal finger. The protein structure was taken from PDB entry 1MFS. Cys18 and Cys39 have significantly reduced calculated contacts. I


Article

Inorganic Chemistry to select and package RNA in vivo.46 Probing the topography of NCp7 using gold compounds shows that the cysteines are in slightly different environments in the full peptide, which may affect their nucleophilicitythis is important since these residues have been extensively targeted for drug intervention. The slow formation of a Au−histidine adduct on the “full” NC by auranofin may also be interpreted in terms of selectivity through kinetic preferences. Overall, the use of the series has elucidated a number of steric and electronic features of the nucleocapsid zinc cores that could eventually be used in targeting.47,48 The analysis of ZnF interactions with the gold complexes studied here suggests that it is generally useful to consider three aspects of zinc finger structure in considering the profile of chemical reactivity: (i) the zinc-bound cysteines as primary nucleophiles; (ii) the role of histidine as a “spectator” ligand and secondary nucleophile; and (iii) ancillary groups not bound to Zn but essential for ZnF function, such as the essential tryptophan in NCp7 F2 and NC. All of these features can be seen to play a role in some of the interactions observed in this work. The inhibition of NC−SL2 binding was closely associated with the steric hindrance of the phosphine ligands with the PCy3-containing compounds capable of inhibiting the biomolecular interaction, as evaluated by fluorescence polarization. Although the phosphine can be surely lost throughout the reaction, as evidenced by MS data, it still plays an important role in the inhibition mechanism, as it may dictate conformational preferences in the expected preferred Cys−Au−Cys conformation.

■

reverse transcription and molecular mechanism. Prog. Nucleic Acid Res. Mol. Biol. 2005, 80, 217−286. (2) Klug, A. The discovery of zinc fingers and their applications in gene regulation and genome manipulation. Annu. Rev. Biochem. 2010, 79, 213−221. (3) Wu, H.; Mitra, M.; McCauley, M. J.; Thomas, J. A.; Rouzina, I.; Musier-Forsyth, K.; Williams, M. C.; Gorelick, R. J. Aromatic residue mutations reveal direct correlation between HIV-1 nucleocapsid protein’s nucleic acid chaperone activity and retroviral replication. Virus Res. 2013, 171, 263−277. (4) Keane, S. C.; Heng, X.; Lu, K.; Kharytonchyk, S.; Ramakrishnan, V.; Carter, G.; Barton, S.; Hosic, A.; Florwick, A.; Santos, J.; Bolden, N. C.; McCowin, S.; Case, D. A.; Johnson, B.; Salemi, M.; Telesnitsky, A.; Summers, M. F. Structure of the HIV-1 RNA Packaging Signal. Science 2015, 348, 917−921. (5) Maynard, A. T.; Covell, D. G. Reactivity of Zinc Finger Cores: Analysis of Protein Packing and Electrostatic Screening. J. Am. Chem. Soc. 2001, 123, 1047−1058. (6) Maynard, A. T.; Huang, M.; Rice, W. G.; Covell, D. G. Reactivity of the HIV-1 nucleocapsid protein p7 zinc finger domains from the perspective of density-functional theory. Proc. Natl. Acad. Sci. U. S. A. 1998, 95, 11578−11583. (7) Lee, Y.-M.; Lim, C. Physical Basis of Structural and Catalytic ZnBinding Sites in Proteins. J. Mol. Biol. 2008, 379, 545−553. (8) Lee, Y.-M.; Lim, C. Factors Controlling the Reactivity of Zinc Finger Cores. J. Am. Chem. Soc. 2011, 133, 8691−8703. (9) Chertova, E. N.; Kane, B. P.; McGrath, C.; Johnson, D. G.; Sowder, R. C.; Arthur, L. O.; Henderson, L. E. Biochemistry 1998, 37, 17890−17897. (10) Morcock, D. R.; Thomas, J. A.; Gagliardi, T. D.; Gorelick, R. J.; Roser, J. D.; Chertova, E. N.; Bess, J. W.; Ott, D. E.; Sattentau, Q. J.; Frank, I.; Pope, M.; Lifson, J. D.; Henderson, L. E.; Crise, B. J. J. Virol 2005, 79, 1533−1542. (11) Sechi, S.; Chait, B. T. Modification of Cysteine Residues by Alkylation. A Tool in Peptide Mapping and Protein Identification. Anal. Chem. 1998, 70, 5150−5158. (12) Quintal, S. M.; dePaula, Q. A.; Farrell, N. P. Zinc Finger Proteins as Templates for Metal Ion Exchange and Ligand Reactivity. Chemical and Biological Consequences. Metallomics 2011, 3 (2), 121− 139. (13) Larabee, J. L.; Hocker, J. R.; Hanas, J. S. Mechanisms of Aurothiomalate−Cys2 His2 Zinc Finger Interactions. Chem. Res. Toxicol. 2005, 18 (12), 1943−1954. (14) Franzman, M. A.; Barrios, A. M. Spectroscopic Evidence for the Formation of Goldfingers. Inorg. Chem. 2008, 47, 3928−3930. (15) Peacock, A. F. A.; Bullen, G. A.; Gethings, L. A.; Williams, J. P.; Kriel, F. H.; Coates, J. Gold-Phosphine Binding to de Novo Designed Coiled Coil Peptides. J. Inorg. Biochem. 2012, 117, 298−305. (16) Abbehausen, C.; Peterson, E. J.; De Paiva, R. E. F.; Corbi, P. P.; Formiga, A. L. B.; Qu, Y.; Farrell, N. P. Gold(I)-Phosphine-NHeterocycles: Biological Activity and Specific (Ligand) Interactions on the C-Terminal HIVNCp7 Zinc Finger. Inorg. Chem. 2013, 52 (19), 11280−11287. (17) Du, Z.; de Paiva, R. E. F.; Nelson, K.; Farrell, N. P. Diversity in Gold Finger Structure Elucidated by Traveling-Wave Ion Mobility Mass Spectrometry. Angew. Chem., Int. Ed. 2017, 56 (16), 4464−4467. (18) Wurm, T.; Asiri, A. M.; Hashmi, A. S. K. NHC−Au(I) Complexes: Synthesis, Activation, and Application. In N-Heterocyclic Carbenes: Effective Tools for Organometallic Synthesis; Nolan, S. P., Ed.; Wiley-VCH: Weinheim, Germany, 2014; pp 243−270. (19) Schwerdtfeger, P.; Hermann, H. L.; Schmidbaur, H. Stability of the Gold(I)−Phosphine Bond. A Comparison with Other Group 11 Elements. Inorg. Chem. 2003, 42 (4), 1334−1342. (20) Spell, S. R.; Mangrum, J. B.; Peterson, E. J.; Fabris, D.; Ptak, R.; Farrell, N. P. Au(III) compounds as HIV nucleocapsid protein (NCp7)−nucleic acid antagonists. Chem. Commun. 2017, 53, 91−94. (21) Tsotsoros, S. D.; Lutz, P. B.; Daniel, A. G.; Peterson, E. J.; de Paiva, R. E. F.; Rivera, E.; Qu, Y.; Bayse, C. A.; Farrell, N. P. Enhancement of the physicochemical properties of [Pt(dien)-

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.inorgchem.7b01762. Characterization of compounds and data on scrambling effects; 1H NMR and MS spectra for reactions with NAc-Cys; calculation of fluorescence quenching; CD and individual 31P NMR spectra; ESI-MS spectrum of auranofin−NCp7 F2 adducts (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Raphael E. F. de Paiva: 0000-0003-2549-0344 Nicholas P. Farrell: 0000-0001-7160-7182 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was funded by the National Science Foundation (NSF) Grant CHE-1413189. We also thank Ciência Sem Fronteiras CAPES PVES 154/2012, the Brazilian Council of Technological and Scientific Development (CNPq) 442123/ 2014-0, and the Brazilian Coordination Agency for the Improvement of High-Level Personnel (CAPES) PVES 0580/2013 for support.

■

REFERENCES

(1) Levin, J. G.; Guo, J.; Rouzina, I.; Musier-Forsyth, K. Nucleic acid chaperone activity of HIV-1 nucleocapsid protein: critical role in J


Article

Inorganic Chemistry (nucleobase)]2+ for HIVNCp7 targeting. Chem. Sci. 2017, 8, 1269− 1281. (22) Neshich, G.; Mancini, A. L.; Yamagishi, M. E.; Kuser, P. R.; Fileto, R.; Pinto, I. P.; Palandrani, J. F.; Krauchenco, J. N.; Baudet, C.; Montagner, A. J.; Higa, R. H. STING Report: convenient web-based application for graphic and tabular presentations of protein sequence, structure and function descriptors from the STING database. Nucleic Acids Res. 2005, 33, D269−D274. (23) Neshich, G.; Rocchia, W.; Mancini, A. L.; Yamagishi, M. E. B.; Kuser, P. R.; Fileto, R.; Baudet, C.; Pinto, I. P.; Montagner, A. J.; Palandrani, J. F.; Krauchenco, J. N.; Torres, R. C.; Souza, S.; Togawa, R. C.; Higa, R. H. JavaProtein Dossier: a novel web-based data visualization tool for comprehensive analysis of protein structure. Nucleic Acids Res. 2004, 32, W595−W601. (24) Honig, B.; Nicholls, A. Classical Electrostatics in Biology and Chemistry. Science 1995, 268 (5214), 1144−1149. (25) Rocchia, W.; Sridharan, S.; Nicholls, A.; Alexov, E.; Chiabrera, A.; Honig, B. Rapid Grid-Based Construction of the Molecular Surface and the Use of Induced Surface Charge to Calculate Reaction Field Energies: Applications to the Molecular Systems and Geometric Objects. J. Comput. Chem. 2002, 23, 128−137. (26) Sridharan, S.; Nicholls, A.; Honig, B. A New Vertex Algorithm To Calculate Solvent Accessible Surface Areas. Biophys. J. 1992, 61, A174. (27) Shaw, C. F., III Gold-Based Therapeutic Agents. Chem. Rev. 1999, 99, 2589−2600. (28) Ahmad, S. The chemistry of cyano complexes of gold(I) with emphasis on the ligand scrambling reactions. Coord. Chem. Rev. 2004, 248, 231−243. (29) Isab, A. A.; Hussain, M. S.; Akhtar, M. N.; Wazeer, M. I. M.; AlArfaj, A. R. 13C, 15N and 31P NMR study of the disproportionation of cyanogold(I) complexes: [R3PAu13C15N]. Polyhedron 1999, 18, 1401− 1409. (30) Corbi, P. P.; Quintão, F. a.; Ferraresi, D. K. D.; Lustri, W. R.; Amaral, a. C.; Massabni, a. C. Chemical, Spectroscopic Characterization, and in Vitro Antibacterial Studies of a New gold(I) Complex with N -Acetyl- L -Cysteine. J. Coord. Chem. 2010, 63 (8), 1390−1397. (31) Spell, R. S.; Farrell, N. P. Reactivity with Biomolecules and Zinc Finger Peptides. Inorg. Inorg. Chem. 2015, 54, 79−86. (32) Tsotsoros, S. D.; Bate, A. B.; Dows, M. G.; Spell, S. R.; Bayse, C. A.; Farrell, N. P. Modulation of the stacking interaction of MN4 (M= Pt, Pd, Au) complexes with tryptophan through N-heterocyclic ligands. J. Inorg. Biochem. 2014, 132, 2−5. PMID 24206773 (33) Stephen, A. G.; Worthy, K. M.; Towler, E.; Mikovits, J. A.; Sei, S.; Roberts, P.; Yang, Q.; Akee, R. K.; Klausmeyer, P.; McCloud, T. G.; Henderson, L.; Rein, A.; Covell, D. G.; Currens, M.; Shoemaker, R. H.; Fisher, R. J. Identification of HIV-1 nucleocapsid protein: nucleic acid antagonists with cellular anti-HIV activity. Biochem. Biophys. Res. Commun. 2002, 296, 1228−1237. (34) Shvadchak, V.; Sanglier, S.; Rocle, S.; Villa, P.; Haiech, J.; Hibert, M.; Van Dorsselaer, A.; Mély, Y.; de Rocquigny, H. Identification by high throughput screening of small compounds inhibiting the nucleic acid destabilization activity of the HIV-1 nucleocapsid protein. Biochimie 2009, 91, 916−923. (35) de Paula, Q. A.; Mangrum, J. B.; Farrell, N. P. Zinc finger proteins as templates for metal ion exchange: Substitution effects on the C-finger of HIV nucleocapsid NCp7 using M(chelate) species (M = Pt, Pd, Au). J. Inorg. Biochem. 2009, 103, 1347−1354. (36) Laskay, U. A.; Garino, C.; Tsybin, Y. O.; Salassa, L.; Casini, A. Gold Finger Formation Studied by High-Resolution Mass Spectrometry and in Silico Methods. Chem. Commun. 2015, 51, 1612−1615. (37) Castiglione Morelli, M. A.; Ostuni, A.; Matassi, G.; Minichino, C.; Flagiello, A.; Pucci, P.; Bavoso, A. Spectroscopic Investigation of Auranofin Binding to Zinc Finger HIV-2 Nucleocapsid Peptides. Inorganica Chim. Inorg. Chim. Acta 2016, 453, 330−338. (38) Mendes, F.; Groessl, M.; Nazarov, A. A.; Tsybin, Y. O.; Sava, G.; Santos, I.; Dyson, P. J.; Casini, A. Metal-based inhibition of poly(ADPribose) polymerase−the guardian angel of DNA. J. Med. Chem. 2011, 54, 2196−2206.

(39) Coffer, M. T.; Shaw, C. F., III; Eidsness, M. K.; Watkins, J. W., II; Elder, R. C. Reactions of Auranofin and Et3PAuCl with Bovine Serum Albumin. Inorg. Chem. 1986, 25, 333−339. (40) Kinsch, E. M.; Stephan, D. W. 31P nuclear magnetic resonance and fluorescence study of the interaction of an anti-arthritic gold phosphine drug with albumin. Inorg. Chim. Acta 1984, 91, 263−297. (41) Breuer, S.; Chang, M. W.; Yuan, J.; Torbett, B. E. identification of HIV-1 inhibitors targeting the nucleocapsid protein. J. Med. Chem. 2012, 55, 4968−4977. (42) Du, Z.; de Paiva, R. E. F.; Qu, Y.; Farrell, N. P. Tuning the reactivity of Sp1 zinc fingers with platinum complexes. Dalton Trans. 2016, 45, 8712−8716. (43) Louie, A. Y.; Meade, T.J. A. Cobalt complex that selectively disrupts the structure and function of zinc fingers. Proc. Natl. Acad. Sci. U. S. A. 1998, 95, 6663−6668. (44) Heffern, M. C.; Kurutz, J. W.; Meade, T. J. Spectrosocpic characterization of the inhibitory mechanism of Cys2His2 zinc finger transcription factors by cobalt(III) Schiff bases. Chem. - Eur. J. 2013, 19, 17043−17053. (45) Vistain, L. F.; Yamamoto, N.; Rathore, R.; Cha, P.; Meade, T. J. Targeted Inhibition of Snail Activity in Breast Cancer Cells by Using a CoIII-Ebox Conjugate. ChemBioChem 2015, 16, 2065−2072. (46) De Rocquigny, H.; Gabus, C.; Vincent, A.; Fournié-Zaluski, M.C.; Roques, B.; Darlix, J.-L. Viral RNA annealing activities of human immunodeficiency virus type 1 nucleopcapsid protein require only peptide domains outside the zinc fingers. Proc. Natl. Acad. Sci. U. S. A. 1992, 89, 6472−6476. (47) Mori, M.; Kovalenko, L.; Lyonnais, S.; Antaki, D.; Torbett, B. E.; Botta, M.; Mirambeau, G.; Mély, Y. Nucleocapsid Protein: A Desirable Target for Future Therapies Against HIV-1. Curr. Top. Microbiol. Immunol. 2015, 389, 53−92. (48) Garg, D.; Torbett, B. E. Advances in targeting nucleocapsidnucleic acid interactions in HIV-1 Therapy. Virus Res. 2014, 193, 135− 143.

K


Probing the HIV-1 NCp7 Nucleocapsid Protein with Site-Specific Gold

Recommend Documents