Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif

Subscriber access provided by MT ROYAL COLLEGE

Article

Probing the Ionic Atmosphere and Hydration of the c-MYC i-motif Lutan Liu, Byul G. Kim, Ujala Feroze, Robert B Macgregor, and Tigran V. Chalikian J. Am. Chem. Soc., Just Accepted Manuscript • DOI: 10.1021/jacs.7b11537 • Publication Date (Web): 22 Jan 2018 Downloaded from http://pubs.acs.org on January 22, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of the American Chemical Society is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of the American Chemical Society

Probing the Ionic Atmosphere and Hydration of the cMYC i-motif

Lutan Liu, Byul G. Kim, Ujala Feroze, Robert B. Macgregor, Jr., and Tigran V. Chalikian* Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, 144 College Street, Toronto, Ontario M5S 3M2, Canada

Tel: (416)946-3715 Fax: (416)978-8511 E-mail: [email protected] * Author to whom correspondence should be addressed

1 ACS Paragon Plus Environment

Journal of the American Chemical Society 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract G-quadruplexes and i-motifs are non-canonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce of G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at high pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5′-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5′-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5′-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our combined results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pHdependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.


Page 2 of 43

Page 3 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Guanine-rich sequences with a potential to adopt the G-quadruplex conformation exist throughout the genome in hundreds of thousand loci including telomeres, centromeres, and promoter regions of oncogenes 1-8. A growing body of evidence suggests that DNA and RNA G-quadruplexes do, in fact, form in the cell and are implicated in transcriptional and translational regulation, cellular function, and disease6, 9-23. The presence of G-quadruplexes in the genome is further corroborated by the presence of G-quadruplex-interacting proteins such as G-quadruplex-specific nucleases, helicases, and resolvases 4, 24. Many research groups have been searching for drugs that would lock promoter and/or telomeric DNA in the G-quadruplex conformation thereby inhibiting oncogene expression and/or telomere synthesis and preventing immortalization of cancerous cells 5-6, 12-13, 25-34

. However, within the cell, the majority of guanine-rich domains exist in

promoter regions. The mechanism that would lead to the formation of G-quadruplexes in these double-stranded regions is necessarily different from that of the single-stranded telomeric 3'-overhangs. Formation of G-quadruplexes in non-telomeric domains requires a prior dissociation of the guanine-rich strand from the complementary cytosine-rich strand. The fate of the dissociated, single stranded C-rich strand is important, since the net energetics of drug-induced G-quadruplex formation will be coupled with the energetics of structural transition of the dissociated C-rich strand. Under favorable conditions, C-rich strands fold to form the i-motif, a noncanonical secondary structure in which two parallel duplexes are intercalated in an antiparallel manner 35-39. The building block of the i-motif is a base pair stabilized by three



hydrogen bonds between one neutral (unprotonated) cytosine and one positively charged cytosine (protonated at N3 position) 37, 39. Although the formation of i-motif structures is favored by slightly acidic pH, there is a body of evidence suggesting that this conformation may exist in vivo at neutral pH 35, 37, 40-42 which makes studies of imotifs of biological significance. In fact, in some cases, an i-motif may act as a more effective inhibitor of DNA replication than G-quadruplexes 43. It should be noted that imotifs also find increasing applications in nanotechnology as highly sensitive pHresponsive switches 39, 44. Physical characterization of the forces stabilizing G-quadruplexes and i-motifs is required for understanding the molecular origins of the conformational preferences of guanine- and cytosine-rich DNA sequences and for developing the ability to induce Gquadruplex and/or i-motif structures at selected genomic loci in a controlled manner. The stability of i-motif structures depends on the number of C·C+ base pairs, the loop sequence and length, and environmental factors including solution pH and the presence of co-solvents and crowding agents 35, 38, 45-52. The conformational preferences of DNA and RNA molecules, including their propensity to fold into an i-motif, are modulated by interactions they form with water molecules and counterions 53-57. Although being of fundamental importance, these factors are still poorly understood. In the presence of the co-solvent polyethylene glycol (PEG), the i-motifs formed by several DNA sequences exhibit greater stability as reflected in increases in the midpoint of the pHinduced folding transition and the transition temperature, TM 46, 48. This suggests that the i-motif conformation is less hydrated than the unfolded conformation. However, hydration is not the only factor influenced by the presence of PEG 58-61. In addition to


Page 4 of 43

Page 5 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


decreasing the activity of water, PEG influences the reaction equilibrium by exerting the excluded volume effect and by affecting the values of the pKa of cytosine. On the other hand, the effect of cation concentration on i-motif stability does not appear to be uniform but may depend on the DNA sequence. In this respect, two works have reported a slight decrease in the melting temperature, TM, of i-motifs with an increase in the concentration of sodium ions 51, 62. Other authors, however, have reported that the TM increases with the concentration of monovalent cations 63-64. In this work, we carry out pH-dependent acoustic and densimetric measurements and UV melting experiments at high pressures which are aimed at scrutinizing changes in hydration and ionic atmosphere associated with i-motif formation by a single stranded DNA sequence from the coding strand of the promoter region of the human c-MYC oncogene. C-rich sequences from the c-MYC promoter fold into i-motif at slightly acidic pH 45, 51, 65-68. The i-motif-forming sequence we study is the 22-base oligodeoxyribonucleotide 5′-d(TTACCCACCCTACCCACCCTCA) DNA (ODN) which is complementary to the mutated MYC22-G14T/G23T sequence that, in the presence of potassium ions, forms a highly stable parallel-stranded G-quadruplex 69-70. Ultimately, we wish to characterize the equilibrium between the canonical double helical form and the non-canonical tetra-helical forms of the promoter region of c-MYC and other oncogenes to exist in the canonical double helical form or adopt non-canonical tetrahelical forms as a function of environmental conditions and the presence of small organic molecules (drugs). ODN has two single-nucleotide linkers A7 and A16 between adjacent C-runs. Although stable i-motif structures with single-nucleotide linker have been reported 48, it



has been suggested that a single nucleotide is insufficient to span the groove of an intramolecular i-motif and, therefore, cannot act as a loop unless coupled with an adjacent cytosine from one of the two C-runs being linked 71. In agreement with this notion, all reported i-motifs formed by the c-MYC promoter sequences display two- or threenucleotide loops (sometimes, including a cytosine) between intercalated pairs of hemiprotonated cytosines 68. Figure 1 shows a possible folding pattern of an ODN with twonucleotide loops. In general, the influence of the length and composition of the loops on the i-motif stability is complex 35, 38-39, 48-50, 72. We measure changes in volume, ∆V, and relative molar sound velocity, ∆[U], of ODN accompanying a decrease in pH from basic to highly acidic values. We subsequently use the values of ∆V and ∆[U] to calculate a change in adiabatic compressibility, ∆KS, accompanying acidification of the ODN solution. A decrease in pH from basic to acidic causes a folding transition of ODN to the i-motif conformation at ~pH 6.0 followed by an unfolding transition to the coil state at ~pH 3.5 73. The measured values of ∆V, ∆[U], and ∆KS result from these transitions and from nonspecific effects that originate from the protonation of cytosine bases and the concomitant release of counterions to the bulk. To account for nonspecific pH-dependent volumetric effects, we use two DNA oligomers with shuffled sequences 5′-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5′-d(CACACTCCTCACCTCTCCACAC) (ODN2) which, although compositionally identical to ODN, do not fold into the i-motif conformation. The pH-dependent changes in the volumetric properties of ODN1 and ODN2 are devoid of the specific effects related to i-motif formation and mainly reflect the nonspecific effects related to cytosine


Page 6 of 43

Page 7 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


protonation and counterion release. Given the compositional identity of ODN, ODN1, and ODN2, their nonspecific volumetric effects should be very similar.

Materials and Methods Materials. The oligonucleotides 5′-d(TTACCCACCCTACCCACCCTCA) (ODN), 5′d(CTCTCACCACACCACACCTCTC) (ODN1), and 5′-d(CACACTCCTCACCTCTCCACAC) (ODN2) were purchased from Integrated DNA Technologies (Coralville, IA). Cytosine, deoxycytidine, and sodium chloride were obtained from Sigma-Aldrich Canada (Oakville, ON). EDTA (free acid) was purchased from Fisher Biotech (Fair Lawn, NJ). The DNA samples were initially dissolved in 10 mM NaCl, exhaustively dialyzed against distilled water, and lyophilized. Dialysis was carried out with 1000 Da cut-off Tube-O-Dialyzers from G Biosciences (St. Louis, MO). For pH-titration experiments, the lyophilized DNA’s were dissolved in an unbuffered solution containing 10 mM NaCl and 0.1 mM EDTA rather than a buffer to avoid complications related to the ionization-neutralization equilibria. The pHdependent volumetric characterizations of cytosine and deoxycytidine were performed in pure water. The concentrations of the oligonucleotides were determined spectrophotometrically at 25 °C with molar extinction coefficients, ε260, of 191,500 M−1cm−1 for the unfolded conformation of ODN and 188,200 M−1cm−1 for the unfolded conformations of ODN1 and ODN2. The extinction coefficients were computed using a nearest-neighbor procedure as described by Owczarzy 74.



UV spectrophotometry. UV light absorption measurements were used to determine the DNA concentrations and to assess the temperature stability of the i-motif conforma–tion of ODN. In these experiments, ODN was dissolved in a 10 mM pH 5.0 acetate buffer containing the desired concentration of NaCl. In UV melting experiments, the temperature was changed at a rate of 1 °C per minute, and the light absorption at 260 nm was measured as a function of temperature in a DNA sample contained in a 0.1- or 1-cm path-length cuvette. The heat-induced i-motif-to-coil transition profiles were analyzed within the framework of a two-state thermodynamic model using standard procedures 75-79. All measurements were performed by a Cary 300 Bio spectrophotometer (Varian Canada, Inc., Mississauga, Ontario, Canada).

Circular dichroism spectropolarimetry. The circular dichroism (CD) spectra of the DNA samples were recorded at 25 °C in a 1-mm path-length cuvette using an Aviv model 62 DS spectropolarimeter (Aviv Associates, Lakewood, NJ). CD spectroscopic measurements were used for conformational characterization of the oligomers under each solution condition employed in this study. CD pH titration experiments were performed by adding aliquots of HCl to the cuvette which contained 0.25 mL of the DNA solution in water. The initial volume was delivered by a 1-mL Hamilton Syringe, while titrant solutions (50, 100, or 500 mM HCl) were added with a 10-µL Hamilton syringe (Hamilton Co. Reno, NV). The syringes were equipped with Chaney adapter that allowed a delivery accuracy of ±0.1%. The pH values were measured separately with four-fold larger volumes of the ODN solutions and the added aliquots of HCl using a VWR brand Benchtop model 8015 pH-meter equipped with an Accumet Ag/AgCl


Page 8 of 43

Page 9 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


combination microelectrode. The absolute error in these pH measurements was ±0.01 pH unit.

High precision densimetry and ultrasonic velocimetry. Solution densities were measured with a precision of ±1.5 × 10-6 g cm-3 using a vibrating tube densimeter (DMA-5000, Anton Paar, Graz, Austria) 80. The partial molar volume, V°, of a solute was calculated from density measurements using the relationship V° =

-

,

where ρ and ρ0 are the densities of the solution and the neat solvent, respectively; C is the molar concentration of a solute; and M is the molecular weight of the DNA. Solution sound velocity measurements were carried out at a frequency of 7.2 MHz using the resonator method and a previously described differential technique 81-85. The analysis of the frequency characteristics of the ultrasonic resonator cells required for sound velocity measurements was carried out by a Hewlett Packard model E5100A network/spectrum analyzer (Mississauga, ON, Canada). For the type of ultrasonic resonators used in this work, the relative precision of the sound velocity measurements is about ±1×10-4 % 81, 86-87. The key characteristic of a solute directly derived from ultrasonic velocimetric measurements is the relative molar sound velocity increment, [U] =

, where U and U0 are the sound velocities in the DNA solution and the neat

solvent, respectively. The values of the relative molar sound velocity increment, [U], were used in conjunction with the measured partial molar volume data, V°, to calculate the partial molar adiabatic compressibility, K°S, of a solute from the following relationship: 9 ACS Paragon Plus Environment


K°S = βS0(2V° - 2[U] -

)

Page 10 of 43

(1)

where βS0 is the coefficient of adiabatic compressibility of the solvent 88-90. In volumetric experiments, the concentrations of cytosine and deoxycytidine were on the order of ~2 mg/mL, while the concentrations of the DNA’s were around ~0.15 mM. The densimetric and ultrasonic velocimetric experiments were performed at least three times; the average values of [U] and V° were used in the analysis. The pHtitration densimetric and acoustic experiments were carried out following a previously described protocol 91.

High pressure UV melting. The UV melting profiles for ODN at pH 5.0, as monitored by the temperature dependence of light absorption at 260 nm, were recorded at pressures between 1 and 1,600 bar in a high pressure optical cell 92. The optical cell is filled with silicon oil as the pressure-transmitting medium. Within the optical cell, the samples are contained in a quartz cuvette designed to allow for pressure equilibration between the exterior and interior of the cuvette.

Results CD spectroscopy. Figure 2 shows the CD spectra of ODN (panel A), ODN1 (panel B), and ODN2 (panel C) at solution pH ranging from basic to acidic values. As is seen from Figure 2a, ODN folds into i-motif at ~pH 5 as revealed by a positive band at 286 nm and a negative band at 258 nm 38-39, 45, 47, 51, 93-94. In contrast, ODN1 and ODN2 do


Page 11 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


not display these CD spectroscopic features, which is consistent with the notion that they do not form i-motif structures (see Figures 2b and c). Although not folding into i-motif, ODN1 and ODN2, being oligomers rich in cytosines, may still form a variety of DNA secondary structures, especially, at acidic pH. To explore this possibility, we spectrophotometrically melted ODN1 and ODN2 in an acetate buffer at pH 5 and monitored the melting at 260 nm (data not shown). We observed very broad, non-sigmoidal increases in absorption (hyperchromicity). This observation, while suggesting that ODN1 and ODN2 are not exactly in the coil state, excludes the possibility that they form stable, single-conformation secondary structures.

Thermal stability. In Figure 3a, we present the normalized UV melting profiles of ODN at 5.2 µM and 52.8 µM in a pH 5.0 buffer consisting of 10 mM acetic-sodium acetate and 10 mM NaCl. We also measured UV melting profiles of ODN samples with a concentration of ~ 5 µM in solutions containing 10, 50, 100, 200, and 400 mM NaCl (data not shown). The UV melting profiles were approximated by the two-state model of thermal denaturation: α=

[

(2)

∆ ( ))]

where TM and ∆HM are the transition temperature and van’t Hoff enthalpy, respectively. By fitting the melting profiles in Figure 3a by Eq. (2), we obtain TM values of 55.3 ± 0.5 and 54.7 ± 0.5 °C for the ODN concentrations of 5.2 and 52.8 µM, respectively, with an average van’t Hoff enthalpy of 47.3 ± 1.7 kcal mol-1. We draw two important inferences. Firstly, at room temperature and pH 5.0, ODN predominantly exists in the i11 ACS Paragon Plus Environment


motif conformation. This conclusion is based on the stability of the i-motif conformation, ∆G° = ∆HM(1 -

), of 4.3 ± 0.2 kcal mol-1 at 25 °C. Secondly, within experimental

uncertainty, there is no difference in melting temperature, TM, between the two ODN concentrations (5.2 and 52.8 µM). Based on the lack of concentration dependence of the thermal stability of ODN, we propose that it forms a monomolecular i-motif structure. By approximating the melting profiles of ODN at various NaCl concentrations (data not shown) with Eq. (2), we obtained melting temperatures, TM, of 55.3 ± 0.5, 56.9 ± 0.5, 57.9 ± 0.5, 58.1 ± 0.5, and 57.8 ± 0.5 °C for 10, 50, 100, 200, and 400 mM NaCl. In Figure 3b, we have plotted the TM against the logarithm of the salt concentration. Inspection of Figure 3b reveals a very weak salt dependence of the conformational stability of the i-motif formed by ODN which is in agreement with a previous report 52. In contrast, the i-motif formed by the human telomeric DNA sequence has been found to exhibit a strong increase in TM with salt with the value of ∆TM/∆log[K+] of 7.90 64. However, in another publication, the TM, of an i-motif formed the 31-base oligonucleotide d(CCCCACCTTCCCCACCCTCCCCACCCTCCCC) from the promoter site of human c-MYC gene very slightly decreases with an increase in sodium ion concentration 51. Clearly, there is a sequence-specific heterogeneity of i-motif stability, and more studies are needed to unveil its molecular origins.

Cytosine and deoxycytidine. Figure 4 shows the pH-dependent changes in the partial molar volume, ∆V (panel A), and relative molar sound velocity increment, ∆[U] (panel B), of cytosine. Figure 5 presents the pH-dependent changes in the partial molar


Page 12 of 43

Page 13 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


volume, ∆V (panel A), and relative molar sound increment, ∆ [U] (panel B), of deoxycytidine. The pH-dependences in Figures 4 and 5 were fitted by a sigmoidal function:

∆ ( ) =

∆

(3)

!

where ∆X(pH) refers to ∆V or ∆[U] at some arbitrary pH; ∆X is the total change in volume or relative molar sound velocity increment accompanying the full protonation of cytosine or deoxycytidine; and pKa is the dissociation constant of cytosine or deoxycytidine. Table 1 presents the protonation-induced changes in volume, ∆V, and relative molar sound velocity increment, ∆[U], of cytosine or deoxycytidine. We use Eq. (1) to calculate the protonation-induced changes in partial molar adiabatic compressibility, ∆KS = 2βS0(∆V - ∆[U]), of cytosine and deoxycytidine. The values of ∆KS are also shown in Table 1.

pH-dependences of the volumetric properties of ODN, ODN1, and ODN2. Figure 6 presents the pH-dependent changes in the partial molar volume, ∆V (Panel A), and relative molar sound velocity increment, ∆[U] (panel B), of ODN (), ODN1 (), and ODN2 (). Inspection of Figure 6 reveals that, within the error of measurements, the pH-dependent volumetric profile of the i-motif-forming ODN do not differ from those of the oligodeoxyribonucleotides with the shuffled sequences, ODN1 and ODN2.

High pressure melting. Figure 7 shows UV-detected transition profiles of ODN in a pH 5.0 acetate buffer at 1 (), 800 (), 1200 (), and 1600 () bar. The data in Figure



7 show that pressure does not cause an appreciable change in the thermal stability of ODN.

Discussion ODN forms a stable intramolecular i-motif. We have recently applied CD spectroscopic measurements to characterization of pH-induced transitions of ODN at 25 °C 73. As the pH of the solution is lowered from basic values to ~pH 2, two transitions are observed (see inset in Figure 6a) 73. In the first transition with a midpoint at pH 6.0, ODN undergoes a coil-to-i-motif transition, while, in the second transition with a midpoint at pH 3.6, it unfolds to the coil state 73. The CD spectral data shown in Figure 2a are consistent with and reflect the two transitions. The sequence of ODN [5′-d(TTACCCACCCTACCCACCCTCA)] features two single-nucleotide linkers between the first and second C-runs and the third and fourth Cruns. This is an important detail, since the stability of i-motif structures depends in a complex manner on the length and nucleotide sequence of the loops separating the intercalated C-runs 38-39, 48-50. Cytosine-rich sequences with a single-nucleotide loop(s) show a tendency to fold into a mixture of mono- and bi-molecular i-motifs 71. Formation of bimolecular complexes should exhibit enhanced stability as the DNA concentration increases although the data in Figure 3 do not reveal a noticeable difference in the thermal stability of the two ODN samples with a ten-fold difference in their concentrations. From this, we conclude that ODN predominantly forms a monomolecular i-motif. However, Loops 1 and 3 do not necessarily consist of a single nucleotide but may involve adjacent cytosines as shown in Figure 1.


Page 14 of 43

Page 15 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


pH-dependent volumetric properties of ODN1 and ODN2. CD spectra presented in Figures 2b and c are consistent with the absence of major pH-induced structural transitions of the two mixed-sequence oligonucleotides ODN1 and ODN2. Thus, the pH-dependent volumetric properties of ODN1 and ODN2 predominantly reflect changes in their interactions with the components of solvent and not structural transitions. Two features can be envisaged. Firstly, protonation of cytosines at acidic pH and the ensuing alteration in hydration, should be reflected in the measured volume and compressibility changes. Secondly, the positive charge acquired by protonated cytosines should lead to a decrease in the charge density around the oligonucleotides with a concomitant release of counterions to the bulk solvent. The volumetric effect of protonation of cytosines in ODN1 and ODN2 can be modeled by pH-dependent changes in volume, relative molar sound velocity increment, and adiabatic compressibility of isolated cytosine and deoxycytidine. Based on the data presented in Table 1, average changes in volume, ∆V, and adiabatic compressibility, ∆KS, accompanying protonation of cytosine and deoxycytidine are 2.3 ± 0.7 cm3mol-1 and –(5.3 ± 1.2) × 10-4 cm3mol-1bar-1, respectively. Since ODN1 and ODN2 each have 13 cytosine residues, the net effect of cytosine protonation on ∆V(prot) and ∆KS(prot) are 29.9 ± 9.1 cm3mol-1 (= 2.3 × 13) and -(68.9 ± 15.6) × 10-4 cm3mol-1bar-1 (= -5.3×10-4 × 13), respectively. As can be seen from Figures 6a and b, a decrease in pH from basic values to ~pH 3.0 causes changes in volume, ∆V, and relative molar sound velocity increment, ∆[U], of -170 ± 10 cm3mol-1 and 390 ± 20 cm3mol-1, respectively. Using Eq. (1), we compute 15 ACS Paragon Plus Environment


a change in adiabatic compressibility, ∆KS = 2βS0(∆V – ∆[U]), of -(500 ± 20)×10-4 cm3mol-1bar-1. These values are qualitatively (volume) and quantitatively (compressibility) distinct from our estimates of ∆V(prot) and ∆KS(prot). The differential values [∆V – ∆V(prot) = -200 ± 28 cm3mol-1] and [∆KS – ∆KS(prot) = -(430 ± 26) × 10-4 cm3mol-1bar-1] originate from and reflect the volumetric contributions of counterion release. Although counterions in the vicinity of DNA are not dehydrated and retain some of their hydration shell 95, the release of sodium ions (counterions) from the vicinity of DNA to the bulk should be accompanied by a significant enhancement in their hydration. Also, hydration of negatively charged phosphates of the DNA molecules may increase in the absence of the neutralizing influence of the counterions. Hydration of a sodium ion has been estimated to cause changes in volume (electrostriction) and adiabatic compressibility of -15 cm3mol-1 and -33.5 × 10-4 cm3mol-1bar-1, respectively 96-98. Under the extreme assumption that counterions are fully dehydrated in the vicinity of DNA while becoming fully hydrated in the bulk, each counterion released to the bulk should lead to decreases in volume and compressibility of 15 cm3mol-1 and 33.5 × 10-4 cm3mol-1bar-1, respectively. With this assumption, ignoring the effect of enhanced phosphate hydration, the volume-based [= -200 / (-15)] and compressibility-based [= -430×10-4 / (-33.5×10-4)] estimates both yield ~13 counterions being released to the bulk solution upon protonation of the cytosine residues. This extreme estimate exceeds the total number of undissociated counterions in the vicinity of a 22-base single stranded DNA. The latter can be evaluated based on physical degree of dissociation, α, defined as the fraction of DNA cations that are physically dissociated from it. For a single stranded DNA, the value of α is 0.63 99. The fraction of cations that remain 16 ACS Paragon Plus Environment

Page 16 of 43

Page 17 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


associated (condensed) with DNA equals (1 - α). Hence, neglecting the Coulombic end effects, the number of condensed counterions around a 22-base oligomer is ~8 [= 22×(1 – 0.37)]. Despite the crudeness of these estimates, our volumetric results unequivocally suggest that protonation of cytosines causes release of the majority if not all of the condensed counterions from the vicinity of ODN1 and ODN2. This observation is consistent with the notion that oligonucleotides with protonated cytosines cease to behave as polyelectrolytes. Their charge density decreases below a threshold value that is necessary for maintaining the cloud of counterions around the DNA. This notion is corroborated by our observation that the stability of the i-motif conformation of ODN at pH 5.0 is essentially independent of the cation concentration (see Figure 3b).

pH-dependent volumetric properties of ODN. Inspection of Figures 6a and b reveals no significant distinctions between the pH-dependent profiles of ODN (undergoing the coil-to-i-motif and i-motif-to-coil transitions) and those of ODN1 and ODN2 (not undergoing transitions). This important observation suggests that the pHinduced coil-to-i-motif folding (at pH 6.0) and i-motif-to-coil unfolding (at pH 3.6) transitions of ODN detected using CD (see inset in Figure 6a) are volumetrically “silent” - they do not lead to changes in either volume or compressibility. This striking result is corroborated by the thermal transition profiles measured as a function of pressure (presented in Figure 7) which reveal that an increase in pressure does not affect the thermal stability of ODN. Recall that the pressure slope of the melting temperature, TM, is related to a change in volume, ∆V, accompanying the heat-



Page 18 of 43

induced i-motif-to-coil state of ODN (or any other macromolecular transition) via the Clapeyron equation, ∆V = (dTM/dP)∆HM/TM, where ∆HM is the transition enthalpy. No change in TM accompanying an increase in pressure is indicative of ∆V of zero. In other words, there is no volume difference between the i-motif and coil states of ODN, consistent with our densimetric results. It should be noted that ∆V ≈ 0 for i-motif formation is not a general phenomenon. In a recent paper from the Sugimoto group, the imotif formation by d[CGG(CCT)10CGG] was found to cause a negative change in volume with a significant increase in TM with pressure 100. Thus, the i-motif appears to be heterogeneous with respect to its volumetric response to folding/unfolding transitions depending on sequence and, possibly, structural features. In the absence of structural data, it is not a simple task to rationalize the volumetric similarity of the i-motif and coil conformations of ODN. The partial molar volume, V°, and adiabatic compressibility, K°S, of a specific conformation of a nucleic acid depend on a complex interplay between the hydration and intrinsic properties 57, 101-106. More specifically, changes in volume, ∆V, and compressibility, ∆KS, associated with a DNA transition can be described by the relationships:

∆V = ∆VM + ∆∆Vh

(4)

∆KS = ∆KM + ∆∆Kh

(5)


Page 19 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


where ∆VM and ∆KM are the changes in intrinsic volume and compressibility, respectively; and ∆∆Vh and ∆∆Kh are the changes in the hydration contributions to volume and compressibility, respectively. The intrinsic term, ∆VM, in Eq. (4) represents the differential molecular volume of the folded and the unfolded conformations of ODN. In the absence of structural data, we cannot reliably estimate of the magnitude or the sign of ∆VM. The hydration term, ∆∆Vh, in Eq. (4) is equal to the sum of changes in thermal, ∆VT, and interaction, ∆VI, volumes 106-108. Thermal volume, VT, represents an increase in solution volume originating from thermally activated mutual vibrational motions of solute and solvent molecules 107. Interaction volume, VI, is a change in the volume of solvent due its interactions with solute. The values of VI are negative for polar and charged solute groups while being nearly zero for nonpolar groups 107, 109-111. As a first approximation, VT correlates with solute-solvent molecular contacts and, hence, with the solventaccessible surface area, SA, of solute. Since the i-motif conformation is more compact than the unfolded conformation (∆SA is negative), a change in thermal volume, ∆VT, accompanying i-motif formation is expected to be negative. The magnitude and the sign of ∆VI are more difficult to assess. On the one hand, polar groups of hemiprotonated cytosine residues that are hydrogen-bonded with water in the coil state become somewhat buried within the interior of the i-motif thereby diminishing the extent of solute-solvent interactions. On the other hand, the close proximity of negatively charged phosphate groups within the constraints of the compact i-motif conformation should increase the charge density thereby enhancing the volume-reducing effect of



solute-solvent interactions, ∆VI. Our measured ∆V ~ 0 suggests a near perfect compensation between the ∆VM, ∆VT, and ∆VI terms in Eq. (4). Intrinsic compressibility, KM, in Eq. (5) represents the compressibility of the waterinaccessible interior of solute. The value of KM is near zero for rigid molecules, such as single- or double-stranded DNA. However, it is significant for molecules that contain interior voids, such as globular proteins and G-quadruplexes 105, 112-115. While the intrinsic compressibility, KM, of the ensemble of unfolded conformations should be close to zero, that of the i-motif conformation is less certain and, in principle, may be significant. The hydration contribution to compressibility in Eq. (5), ∆Kh = nh(Kh – K0), is proportional to the hydration number, nh (the total number of solute-affected solvent molecules), and the difference in the partial molar adiabatic compressibilities of water of hydration, Kh, and bulk water, K0. The differential compressibility, (Kh – K0), is a measure of the strength of solute-solvent interactions; the stronger solute-solvent interactions the more negative the value of (Kh – K0). Compaction of ODN accompanying its folding into the i-motif state is expected to bring about a decrease in the hydration number, nh. For the term (Kh – K0) in Eq. (5), neither the sign nor the magnitude of the change is clear. It may increase in magnitude becoming more negative due to bringing negatively charged phosphates closer together, may not change, or may decrease in magnitude, e. g., due to a more effective mutual neutralization of the positively charged cytosines and negatively charged phosphates. Should the change in intrinsic compressibility, ∆KM, in Eq. (5) be near zero, which is tantamount to the assumption of the rigidness of the i-motif conformation, the observation that ∆KS ≈ 0 suggests the similarity of the hydration of the i-motif and coil


Page 20 of 43

Page 21 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


states of ODN (with ∆∆Kh ≈ 0). Although, we, presently, do not attempt to discriminate between the various scenarios, the observed ∆KS ≈ 0 unambiguously indicates a highly efficient offsetting of the ∆KM and ∆∆Kh terms in Eq. (5). In the aggregate, our volumetric data suggest that fortuitous compensations between the intrinsic and hydration contributions to volume and compressibility result in ∆V and ∆KS of zero. Interestingly, a compressibility change of zero implies that the compensations leading to ∆V being zero are not restricted to ambient pressure but also act at elevated pressures. More studies involving a wide range of i-motif structures are needed to understand the generality of our results and their molecular origins.

Pressure-related considerations. The pressure dependence of the stability of the imotif conformation of ODN, or any conformation of a DNA or other macromolecule, at a constant temperature is given by the relationship:

∆G = ∆V(P – P0) – 0.5∆KT(P – P0)2

(6)

where P0 is the reference pressure which is, conventionally, chosen to be ambient pressure; and ∆KT is the change in isothermal compressibility associated with the imotif-to-coil transition (in aqueous solution, ∆KT ≈ ∆KS). Formation of i-motif by ODN is not accompanied by changes in either volume or compressibility. This, according to Eq. (6), makes the stability of the i-motif conformation of ODN insensitive to pressure which contrasts the behaviour of Gquadruplex structures. Recall that the formation of monomolecular G-quadruplexes is 21 ACS Paragon Plus Environment


accompanied by positive changes in volume, ∆V, and compressibility, ∆KS 112-113, 116. Hence, an increase in pressure leads to a decrease in G-quadruplex stability. In contrast, most polymeric duplexes are stabilized by pressure with small negative values of ∆V 117. Although mechanisms involving DNA-transitions are not invoked in the current concepts of pressure-induced cell death 118, we propose that the differential pressure sensitivity of the duplex, G-quadruplex, and i-motif constructs in the genome may be a factor governing survival of deep-water organisms functioning under high hydrostatic pressure or contributing to pressure-induced cell death and injury in microorganisms. There is a growing body of evidence suggesting that i-motifs act as transcriptional and translational regulatory elements in the genome in a way that mirrors or complements that played by G-quadruplexes 41-43. Given the pressure insensitivity of imotifs, tetraplex-based transcriptional and translational regulatory elements in barophilic organisms may, preferably, involve i-motifs instead of G-quadruplexes. In contrast, destabilization of G-quadruplexes in the genome at elevated pressures and, hence, compromising their regulatory functions may be a factor that facilitates pressureinduced cell death.

Concluding Remarks Coil-to-i-motif transitions of C-rich DNA should be accompanied by alterations in hydration and changes in the ionic atmosphere around the DNA. These properties are important, since the conformational preferences of all DNA molecules are guided and modulated in a subtle manner by the energetics of DNA interactions with solvent and


Page 22 of 43

Page 23 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


counterions. Volumetric measurements offer an attractive avenue for characterizing changes in hydration and ionic atmosphere accompanying i-motif formation. Volumetric parameters are both sensitive to solute-solvent interactions and nonselective; they sense the entire spectrum of solute-solvent interactions. Consequently, judiciously designed volumetric experiments can be used to characterize global changes in solutesolvent interactions associated with a coil-to-i-motif transition and any accompanying release or uptake of counterions. In this study, we carried pH-dependent acoustic and densimetric measurements and UV melting experiments at high pressures to assess changes in hydration and ionic atmosphere accompanying i-motif formation by the 5′-d(TTACCCACCCTACCCACCCTCA) DNA molecule (ODN) from the coding chain of the promoter region of the human c-MYC oncogene. We also conducted pH-dependent acoustic and densimetric characterizations of the 5′-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5′-d(CACACTCCTCACCTCTCCACAC) (ODN2) oligonucleotides with shuffled sequences that are compositionally identical to ODN but not capable of folding into i-motif. Our acoustic and densimetric results reveal virtually identical pH-dependent profiles of ODN, ODN1, and ODN2 suggesting that i-motif formation by ODN is volumetrically silent, i.e., it is not accompanied by changes in volume or compressibility. This conclusion is supported by our high-pressure UV melting data which reveal no change in the thermal stability of the ODN i-motif conformation at pH 5.0 as pressure increases from 1 to 1600 bar. The volumetric similarity of the i-motif and coil states of ODN implies a serendipitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1,



and ODN2, in conjunction with the data on volumetric changes accompanied by the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosine residues in the oligonucleotides leads to the release of the majority or all of the counterions to the bulk. Thus, at the acidic pH range that favors i-motif formation, the oligomers cease to behave as polyelectrolytes, lacking the cloud of counterions in their vicinity. To our knowledge, this is the first observation of such non-polyelectrolyte behaviour of any oligomeric nucleic acid structure. The biomedical importance of our results stems from the fact that, in the genome, G-quadruplex formation is often paired with putative i-motif formation with both events contributing to the net energetics of the duplex-to-tetraplex transitions. Hence, when developing ways to control induction of G-quadruplexes at selected genomic loci, for example, through intervention with small molecules, one needs to take into account the energetics of both the G-quadruplex formation by the G-rich strand and the possible imotif formation by the complementary C-rich strand. Importantly, i-motif formation can make the process energetically more favorable. Our data enable one to more rationally discriminate between the environmental conditions that favor coexisting G-quadruplex and i-motif structures. We also outline a possible link between the differential pressuresensitivity of i-motifs and G-quadruplexes and the pressure resistance of barophilic organisms and pressure-induced cell death.

Acknowledgements This work was supported by grants from the Natural Sciences and Engineering Research Council of Canada (to T. V. C. and R. B. M). 24 ACS Paragon Plus Environment

Page 24 of 43

Page 25 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


References 1.

Huppert, J. L. Philos. Trans. Royal Soc. A 2007, 365, 2969-2984.

2.

Shafer, R. H.; Smirnov, I. Biopolymers 2000, 56, 209-227.

3.

Hurley, L. H. Nat. Rev. Cancer 2002, 2, 188-200.

4.

Oganesian, L.; Bryan, T. M. Bioessays 2007, 29, 155-165.

5.

De Cian, A.; Lacroix, L.; Douarre, C.; Temime-Smaali, N.; Trentesaux, C.; Riou,

J. F.; Mergny, J. L. Biochimie 2008, 90, 131-155. 6.

Balasubramanian, S.; Hurley, L. H.; Neidle, S. Nat. Rev. Drug Disc. 2011, 10,

261-275. 7.

Maizels, N. EMBO Rep. 2015, 16, 910-22.

8.

Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2005, 33, 2908-2916.

9.

Lam, E. Y.; Beraldi, D.; Tannahill, D.; Balasubramanian, S. Nat. Commun. 2013,

4, 1796. 10.

Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S. Nat. Chem. 2013, 5,

182-186. 11.

Biffi, G.; Di, A. M.; Tannahill, D.; Balasubramanian, S. Nat. Chem. 2014, 6, 75-

80. 12.

Husby, J.; Todd, A. K.; Platts, J. A.; Neidle, S. Biopolymers 2013, 99, 989-1005.

13.

Neidle, S. Curr. Opin. Struct. Biol. 2009, 19, 239-250.

14.

Neidle, S.; Read, M. A. Biopolymers 2000, 56, 195-208.

15.

Kelland, L. R. Eur. J. Cancer 2005, 41, 971-979.

16.

Simone, R.; Fratta, P.; Neidle, S.; Parkinson, G. N.; Isaacs, A. M. FEBS Lett.

2015, 589, 1653-68.



17.

Millevoi, S.; Moine, H.; Vagner, S. Wiley Interdiscip. Rev. RNA 2012, 3, 495-507.

18.

Cammas, A.; Dubrac, A.; Morel, B.; Lamaa, A.; Touriol, C.; Teulade-Fichou, M.

P.; Prats, H.; Millevoi, S. RNA Biol. 2015, 12, 320-9. 19.

Henderson, A.; Wu, Y.; Huang, Y. C.; Chavez, E. A.; Platt, J.; Johnson, F. B.;

Brosh, R. M., Jr.; Sen, D.; Lansdorp, P. M. Nucleic Acids Res. 2014, 42, 860-9. 20.

Fay, M. M.; Lyons, S. M.; Ivanov, P. J. Mol. Biol. 2017, 429, 2127-2147.

21.

Bochman, M. L.; Paeschke, K.; Zakian, V. A. Nat. Rev. Genet. 2012, 13, 770-

780. 22.

Tateishi-Karimata, H.; Isono, N.; Sugimoto, N. PLoS One 2014, 9, e90580.

23.

Endoh, T.; Kawasaki, Y.; Sugimoto, N. Angew. Chem. Int. Ed. Engl. 2013, 52,

5522-6. 24.

Brazda, V.; Haronikova, L.; Liao, J. C.; Fojta, M. Int. J. Mol. Sci. 2014, 15, 17493-

517. 25.

Huppert, J. L. Chem. Soc. Rev. 2008, 37, 1375-1384.

26.

Waller, Z. A.; Sewitz, S. A.; Hsu, S. T. J. Am. Chem. Soc. 2009, 131, 12628-

12633. 27.

Haudecoeur, R.; Stefan, L.; Denat, F.; Monchaud, D. J. Am. Chem. Soc. 2013,

135, 550-3. 28.

Luedtke, N. W. Chimia 2009, 63, 134-139.

29.

Burger, A. M.; Dai, F.; Schultes, C. M.; Reszka, A. P.; Moore, M. J.; Double, J.

A.; Neidle, S. Cancer Res. 2005, 65, 1489-1496. 30.

Ma, D. L.; Lai, T. S.; Chan, F. Y.; Chung, W. H.; Abagyan, R.; Leung, Y. C.;

Wong, K. Y. Chem. Med. Chem. 2008, 3, 881-4.


Page 26 of 43

Page 27 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


31.

Ohnmacht, S. A.; Marchetti, C.; Gunaratnam, M.; Besser, R. J.; Haider, S. M.; Di

Vita, G.; Lowe, H. L.; Mellinas-Gomez, M.; Diocou, S.; Robson, M.; Sponer, J.; Islam, B.; Pedley, R. B.; Hartley, J. A.; Neidle, S. Sci. Rep. 2015, 5, 11385. 32.

Dhamodharan, V.; Harikrishna, S.; Jagadeeswaran, C.; Halder, K.;

Pradeepkumar, P. I. J. Org. Chem. 2012, 77, 229-42. 33.

Boschi, E.; Davis, S.; Taylor, S.; Butterworth, A.; Chirayath, L. A.; Purohit, V.;

Siegel, L. K.; Buenaventura, J.; Sheriff, A. H.; Jin, R.; Sheardy, R.; Yatsunyk, L. A.; Azam, M. J. Phys. Chem. B 2016, 120, 12807-12819. 34.

Hu, M. H.; Chen, S. B.; Wang, B.; Ou, T. M.; Gu, L. Q.; Tan, J. H.; Huang, Z. S.

Nucleic Acids Res. 2017, 45, 1606-1618. 35.

Brooks, T. A.; Kendrick, S.; Hurley, L. FEBS J. 2010, 277, 3459-3469.

36.

Collie, G. W.; Parkinson, G. N. Chem. Soc. Rev. 2011, 40, 5867-92.

37.

Day, H. A.; Pavlou, P.; Waller, Z. A. Bioorg. Med. Chem. 2014, 22, 4407-4418.

38.

Benabou, S.; Avino, A.; Eritja, R.; Gonzalez, C.; Gargallo, R. RSC Adv. 2014, 4,

26956-26980. 39.

Alba, J. J.; Sadurni, A.; Gargallo, R. Crit. Rev. Anal. Chem. 2016, 46, 443-54.

40.

Sun, D.; Hurley, L. H. J. Med. Chem. 2009, 52, 2863-2874.

41.

Kang, H. J.; Kendrick, S.; Hecht, S. M.; Hurley, L. H. J. Am. Chem. Soc. 2014,

136, 4172-4185. 42.

Kendrick, S.; Kang, H. J.; Alam, M. P.; Madathil, M. M.; Agrawal, P.; Gokhale, V.;

Yang, D.; Hecht, S. M.; Hurley, L. H. J. Am. Chem. Soc. 2014, 136, 4161-4171. 43.

Takahashi, S.; Brazier, J. A.; Sugimoto, N. Proc. Natl. Acad. Sci. U. S. A. 2017,

114, 9605-9610.



44.

Krishnan, Y.; Simmel, F. C. Angew. Chem. Int. Ed. 2011, 50, 3124-3156.

45.

Cui, J. J.; Waltman, P.; Le, V. H.; Lewis, E. A. Molecules 2013, 18, 12751-12767.

46.

Rajendran, A.; Nakano, S.; Sugimoto, N. Chem. Commun. 2010, 46, 1299-1301.

47.

Bhaysar-Jog, Y. P.; Van Dornshuld, E.; Brooks, T. A.; Tschumper, G. S.;

Wadkins, R. M. Biochemistry 2014, 53, 1586-1594. 48.

Reilly, S. M.; Morgan, R. K.; Brooks, T. A.; Wadkins, R. M. Biochemistry 2015,

54, 1364-70. 49.

Fujii, T.; Sugimoto, N. Phys. Chem. Chem. Phys. 2015, 17, 16719-16722.

50.

Gurung, S. P.; Schwarz, C.; Hall, J. P.; Cardin, C. J.; Brazier, J. A. Chem.

Commun. 2015, 51, 5630-2. 51.

Mathur, V.; Verma, A.; Maiti, S.; Chowdhury, S. Biochem. Biophys. Res.

Commun. 2004, 320, 1220-1227. 52.

Selvam, S.; Mandal, S.; Mao, H. Biochemistry 2017, 56, 4616-4625.

53.

Auffinger, P.; Hashem, Y. Curr. Opin. Struct. Biol. 2007, 17, 325-333.

54.

Anderson, C. F.; Record, M. T. Annu. Rev. Phys. Chem. 1995, 46, 657-700.

55.

Gebala, M.; Giambasu, G. M.; Lipfert, J.; Bisaria, N.; Bonilla, S.; Li, G.; York, D.

M.; Herschlag, D. J. Am. Chem. Soc. 2015, 137, 14705-15. 56.

Jacobson, D. R.; Saleh, O. A. Nucleic Acids Res 2017, 45, 1596-1605.

57.

Chalikian, T. V.; Volker, J., Hydration of nucleic acids. In Wiley Encyclopedia of

Chemical Biology, Begley, T. P., Ed. Wiley and Sons, Inc.: 2008. 58.

Chalikian, T. V. Biophys. Chem. 2016, 209, 1-8.

59.

Nordstrom, L. J.; Clark, C. A.; Andersen, B.; Champlin, S. M.; Schwinefus, J. J.

Biochemistry 2006, 45, 9604-14.


Page 28 of 43

Page 29 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


60.

Knowles, D. B.; LaCroix, A. S.; Deines, N. F.; Shkel, I.; Record, M. T., Jr. Proc.

Natl. Acad. Sci. U. S. A. 2011, 108, 12699-12704. 61.

Shkel, I. A.; Knowles, D. B.; Record, M. T., Jr. Biopolymers 2015, 103, 517-527.

62.

Mergny, J. L.; Lacroix, L.; Han, X. G.; Leroy, J. L.; Helene, C. J. Am. Chem. Soc.

1995, 117, 8887-8898. 63.

Kaushik, M.; Suehl, N.; Marky, L. A. Biophys. Chem. 2007, 126, 154-164.

64.

Nguyen, T.; Fraire, C.; Sheardy, R. D. J. Phys. Chem. B 2017, 121, 7872-7877.

65.

Dettler, J. M.; Buscaglia, R.; Cui, J.; Cashman, D.; Blynn, M.; Lewis, E. A.

Biophys. J. 2010, 99, 561-567. 66.

Dai, J.; Ambrus, A.; Hurley, L. H.; Yang, D. J. Am. Chem. Soc. 2009, 131, 6102-

6104. 67.

Reilly, S. M.; Lyons, D. F.; Wingate, S. E.; Wright, R. T.; Correia, J. J.; Jameson,

D. M.; Wadkins, R. M. Biophys. J. 2014, 107, 1703-1711. 68.

Dai, J.; Hatzakis, E.; Hurley, L. H.; Yang, D. PLoS One 2010, 5, e11647.

69.

Ambrus, A.; Chen, D.; Dai, J. X.; Jones, R. A.; Yang, D. Z. Biochemistry 2005,

44, 2048-2058. 70.

Kim, B. G.; Evans, H. M.; Dubins, D. N.; Chalikian, T. V. Biochemistry 2015, 54,

3420-3430. 71.

Li, T.; Famulok, M. J. Am. Chem. Soc. 2013, 135, 1593-9.

72.

Lieblein, A. L.; Furtig, B.; Schwalbe, H. Chembiochem 2013, 14, 1226-30.

73.

Kim, B. G.; Chalikian, T. V. Biophys. Chem. 2016, 216, 19-22.

74.

Tataurov, A. V.; You, Y.; Owczarzy, R. Biophys. Chem. 2008, 133, 66-70.

75.

Marky, L. A.; Breslauer, K. J. Biopolymers 1987, 26, 1601-1620.



76.

Breslauer, K. J. Methods Enzymol. 1995, 259, 221-242.

77.

Rachwal, P. A.; Fox, K. R. Methods 2007, 43, 291-301.

78.

Mergny, J. L.; Phan, A. T.; Lacroix, L. FEBS Lett. 1998, 435, 74-78.

79.

Mergny, J. L.; Lacroix, L. Oligonucleotides 2003, 13, 515-537.

80.

Kratky, O.; Leopold, H.; Stabinger, H. Methods Enzymol. 1973, 27, 98-110.

81.

Sarvazyan, A. P. Ultrasonics 1982, 20, 151-154.

82.

Eggers, F.; Funck, T. Rev. Sci. Instrum. 1973, 44, 969-977.

83.

Kaatze, U.; Eggers, F.; Lautscham, K. Meas. Sci. Technol. 2008, 19, 062001.

84.

Eggers, F. Acustica 1992, 76, 231-240.

85.

Eggers, F.; Kaatze, U. Meas. Sci. Technol. 1996, 7, 1-19.

86.

Sarvazyan, A. P.; Selkov, E. E.; Chalikyan, T. V. Sov. Phys. Acoust. 1988, 34,

631-634. 87.

Sarvazyan, A. P.; Chalikian, T. V. Ultrasonics 1991, 29, 119-124.

88.

Barnartt, S. J. Chem. Phys. 1952, 20, 278-279.

89.

Owen, B. B.; Simons, H. L. J. Phys. Chem. 1957, 61, 479-482.

90.

Sarvazyan, A. P. Annu. Rev. Biophys. Biophys. Chem. 1991, 20, 321-342.

91.

Chalikian, T. V.; Gindikin, V. S.; Breslauer, K. J. J. Mol. Biol. 1995, 250, 291-306.

92.

Wu, J. Q.; Macgregor, R. B., Jr. Biochemistry 1993, 32, 12531-12537.

93.

Lannes, L.; Halder, S.; Krishnan, Y.; Schwalbe, H. Chembiochem 2015, 16,

1647-56. 94.

Guo, K.; Gokhale, V.; Hurley, L. H.; Sun, D. Nucleic Acids Res. 2008, 36, 4598-

4608. 95.

Tikhomirova, A.; Chalikian, T. V. J. Mol. Biol. 2004, 341, 551-563.


Page 30 of 43

Page 31 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


96.

Hirata, F.; Arakawa, K. Bull. Chem. Soc. Jpn. 1973, 46, 3367-3369.

97.

Conway, B. E. J. Solution Chem. 1978, 7, 721-770.

98.

Mathieson, J. G.; Conway, B. E. J. Solution Chem. 1974, 3, 455-477.

99.

Manning, G. S. Q. Rev. Biophys. 1978, 11, 179-246.

100.

Takahashi, S.; Sugimoto, N. Phys. Chem. Chem. Phys. 2015, 17, 31004-10.

101.

Chalikian, T. V.; Sarvazyan, A. P.; Plum, G. E.; Breslauer, K. J. Biochemistry

1994, 33, 2394-2401. 102.

Chalikian, T. V.; Sarvazyan, A. P.; Breslauer, K. J. Biophys. Chem. 1994, 51, 89-

107. 103.

Chalikian, T. V.; Volker, J.; Srinivasan, A. R.; Olson, W. K.; Breslauer, K. J.

Biopolymers 1999, 50, 459-471. 104.

Chalikian, T. V.; Breslauer, K. J. Biopolymers 1998, 48, 264-280.

105.

Chalikian, T. V.; Breslauer, K. J. Curr. Opin. Struct. Biol. 1998, 8, 657-664.

106.

Chalikian, T. V.; Macgregor, R. B. Phys. Life Rev. 2007, 4, 91-115.

107.

Kharakoz, D. P. J. Solution Chem. 1992, 21, 569-595.

108.

Terasawa, S.; Itsuki, H.; Arakawa, S. J. Phys. Chem. 1975, 79, 2345-2351.

109.

Edward, J. T.; Farrell, P. G. Can. J. Chem. 1975, 53, 2965-2970.

110.

Patel, N.; Dubins, D. N.; Pomes, R.; Chalikian, T. V. J. Phys. Chem. B 2011, 115,

4856-4862. 111.

Patel, N.; Dubins, D. N.; Pomes, R.; Chalikian, T. V. Biophys. Chem. 2012, 161,

46-49. 112.

Fan, H. Y.; Shek, Y. L.; Amiri, A.; Dubins, D. N.; Heerklotz, H.; Macgregor, R. B.;

Chalikian, T. V. J. Am. Chem. Soc. 2011, 133, 4518-4526.



113.

Shek, Y. L.; Noudeh, G. D.; Nazari, M.; Heerklotz, H.; Abu-Ghazalah, R. M.;

Dubins, D. N.; Chalikian, T. V. Biopolymers 2014, 101, 216-227. 114.

Chalikian, T. V. Annu. Rev. Biophys. Biomol. Struct. 2003, 32, 207-235.

115.

Taulier, N.; Chalikian, T. V. Biochim. Biophys. Acta 2002, 1595, 48-70.

116.

Takahashi, S.; Sugimoto, N. Angew. Chem. Int. Ed. 2013, 52, 13774-13778.

117.

Macgregor, R. B., Jr. Biopolymers 1998, 48, 253-263.

118.

Ganzle, M.; Liu, Y. Front. Microbiol. 2015, 6, 599.


Page 32 of 43

Page 33 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1 Changes in volume, ∆V, relative molar sound velocity increment, ∆[U], and adiabatic compressibility, ∆KS, accompanying protonation of cytosine or deoxycytidine at 25 °C. --------------------------------------------------------------------------------------------------------------------∆V, cm3mol-1

∆[U], cm3mol-1

∆KS, 10-4 cm3mol-1bar-1

--------------------------------------------------------------------------------------------------------------------Cytosine

1.6±0.2

6.2±0.3

-4.1±0.4

--------------------------------------------------------------------------------------------------------------------Deoxycytidine

3.0±0.2

10.3±0.3

-6.5±0.4

---------------------------------------------------------------------------------------------------------------------



Figure Legends Figure 1 Schematic illustration of a possible folding topology of ODN in the i-motif conformation. Adenine = green, thymine = blue, cytosine = yellow.

Figure 2 CD spectra of ODN (panel A), ODN1 (panel B), ODN2 (panel C) in water at various pH.

Figure 3 (a) Normalized UV melting profiles at 260 nm of 5.2 () and 52.8 () µM ODN in a pH 5.0 buffer containing 10 mM acetate buffer and 10 mM NaCl; (b) Salt dependence of the i-motif-to-coil transition temperature of ~5 µM ODN at pH 5.0.

Figure 4 pH-dependent changes in the partial molar volume (panel A) and relative molar sound velocity increment (panel B) of cytosine. Experimental data in panels A and B were approximated by Eq. (3) (solid lines).

Figure 5 pH-dependent changes in the partial molar volume (panel A) and relative molar sound velocity increment (panel B) of deoxycytidine. Experimental data in panels A and B were approximated by Eq. (3) (solid lines).


Page 34 of 43

Page 35 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6 pH-dependent changes in the partial molar volume (panel A) and relative molar sound velocity increment (panel B) of ODN (), ODN1 (), and ODN2 (). Inset in panel A: the pH-dependence of the molar ellipticity of ODN at 284 nm.

Figure 7 Normalized UV melting profiles at 260 nm of 5 µM ODN in a pH 5.0 buffer containing 10 mM acetate buffer and 10 mM NaCl at 1 (), 800 (), 1200 (), and 1600 () bar.



Figure 1

Figure 2a

8 9.55 6.61

6 3 -1 -1 [θ θ], 10 deg M cm

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

6.09 5.29 4.46

4

3.92 3.37 2.90

2

2.30

0

-2

-4 200

220

240

260

280

300

320

λ, nm


Page 36 of 43

Page 37 of 43

Figure 2b

6 9.16 7.32 5.78

3 -1 -1 [θ θ ], 10 deg M cm

4

4.8 4.42 3.98

2

2.83

0

-2

-4 200

220

240

260

280

300

320

λ, nm

Figure 2c

6 10.81 8.07 5.08

4 3 -1 -1 [θ θ], 10 deg M cm

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4.46 4.02 3.92

2

3.00

0

-2

-4 200

220

240

260

280

300

λ, nm


320


Figure 3a

1.0

5 µM 50 µM

0.8

α

0.6

0.4

0.2

0.0 10

20

30

40

50

60

70

80

90

100

T, °C

Figure 3b

60 59 58

TM, °C

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

57 56 55 54 53 -2.5

-2.0

-1.5

-1.0

-0.5

log[Na+]


0.0

Page 38 of 43

Page 39 of 43

Figure 4a

2.0

1.0

3

∆V, cm mol

-1

1.5

0.5

0.0

-0.5

2

3

4

5

6

7

8

6

7

8

pH

Figure 4b

8 7 6

-1

5 4

3

∆[U], cm mol

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3 2 1 0 -1

2

3

4

5

pH



Figure 5a

4

2

3

∆V, cm mol

-1

3

1

0

-1

1

2

3

4

5

6

7

8

pH

Figure 5b

12 10

-1

8

3

∆ [U], cm mol

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

6 4 2 0 -2 1

2

3

4

5

6

pH


7

Page 40 of 43

Page 41 of 43

Figure 6a

50 ODN

0

ODN1

-50

-100 8

-1

7

[θ ]284, 10 deg M cm

-1

-150

6

5

3

∆ V, cm3mol-1

ODN2

4

3

-200

2 2

3

4

5

6

7

8

9

10

11

pH

-250

1

2

3

4

5

6

7

8

9

10

11

pH

Figure 6b

500

ODN ODN1 ODN2

400

∆[U], cm3mol-1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


300

200

100

0

-100

1

2

3

4

5

6

7

8

9

10

11

pH


12


Figure 7

1.0

0.8

0.6

α

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

0.4

0.2

0.0 10

20

30

40

50

60

70

80

90

T, °C


100

Page 42 of 43

Page 43 of 43 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC Graphic


Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif

Recommend Documents