PRODUCTION AND TRANSDUCTION OF HUMAN RECOMBINANT Î²

Subscriber access provided by Kaohsiung Medical University

Article

PRODUCTION AND TRANSDUCTION OF HUMAN RECOMBINANT #-GLOBIN CHAIN INTO PROERYTHROID K-562 CELLS TO REPLACE MISSING ENDOGENOUS #- GLOBIN Lefkothea C. Papadopoulou, Alexandra Ingendoh-Tsakmakidis, Christina N. Mpoutoureli, Lamprini D. Tzikalou, Efthymia D. Spyridou, George J. Gavriilidis, Georgios C. Kaiafas, Agoritsa #. Ntaska, Efthymia Vlachaki, George Panayotou, Martina Samiotaki, and Asterios S Tsiftsoglou Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/ acs.molpharmaceut.8b00857 • Publication Date (Web): 30 Oct 2018 Downloaded from http://pubs.acs.org on November 3, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

PRODUCTION AND TRANSDUCTION OF HUMAN RECOMBINANT β-GLOBIN CHAIN INTO PROERYTHROID K-562 CELLS TO REPLACE MISSING ENDOGENOUS β- GLOBIN Lefkothea C. Papadopoulou1, Alexandra Ingendoh-Tsakmakidis1,2, Christina N. Mpoutoureli1, Lamprini D. Tzikalou1, Efthymia D. Spyridou1, George J. Gavriilidis1, Georgios C. Kaiafas1, Agoritsa Τ. Ntaska1, Efthymia Vlachaki3, George Panayotou4, Martina Samiotaki4, Asterios S. Tsiftsoglou1 1. Laboratory of Pharmacology, School of Pharmacy, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki 54124, Macedonia, Greece 2. Current address: Department of Prosthetic Dentistry and Biomedical Materials Sciences, Hannover Medical School, Carl-Neuberg-Str. 1, 30625 Hannover, Germany 3. Adult Thalassemia Unit, Hippokrateion General Hospital, Thessaloniki, Greece 4. B.S.R.C. Alexander Fleming, Vari Attikis, Greece Running title: Transduction of recombinant TAT-β-globin into K-562 cells

Correspondence should be addressed to: 1. Lefkothea C. Papadopoulou, Department of Pharmacology, School of Pharmacy, Aristotle University of Thessaloniki, Thessaloniki, GR 54124, Macedonia, GREECE Tel: +30 2310 997636; e-mail: [email protected] 2. Asterios S. Tsiftsoglou, Department of Pharmacology, School of Pharmacy, Aristotle University of Thessaloniki, Thessaloniki, GR 54124, Macedonia, GREECE Tel: +30 2310 997631; e-mail: [email protected] 1

ACS Paragon Plus Environment

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 44

Graphic Abstract

ABSTRACT Protein

Replacement

Therapy

(PRT)

has

been

applied

to

treat

severe

monogenetic/metabolic disorders, characterized by a protein deficiency. In disorders, where an intracellular protein is missing, PRT is not easily feasible due to the inability of proteins to cross the cell membrane. Instead, gene therapy has been applied, although still with limited success. β-thalassemias are severe congenital hemoglobinopathies, characterized by deficiency or reduced production of the adult β-globin chain. The resulting imbalance of α-/β- globin chains of adult hemoglobin (α β ) leads to 2 2

precipitation of unpaired α-globin chains and, eventually, to defective erythropoiesis. Since protein transduction domain (PTD)-technology has emerged as a promising therapeutic approach, we produced a human recombinant β-globin chain in fusion with the TAT peptide and successfully transduced it into human proerythroid K-562 cells, deficient in mature β-globin chain. Notably, the produced human recombinant β-globin chain without the TAT peptide, used as internal negative control, failed to be transduced 2


Page 3 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


into K-562 cells under similar conditions. In-silico studies complemented by SDSPAGE, western blotting, co-immunoprecipitation and LC-MS/MS analysis indicated that the transduced recombinant fusion TAT-β-globin protein interacts with the endogenous native α-like globins to form hemoglobin α2β2-like tetramers to a limited extent. Our findings provide evidence that recombinant TAT-β-globin is transmissible into proerythroid K-562 cells and can be potentially considered as an alternative protein therapeutic approach for β-thalassemias.

KEY-WORDS:

TAT-β-globin; PTDs; transduction; K-562 cells; thalassemia

INTRODUCTION A large variety of genetic and/or metabolic disorders are characterized by deficiency or malfunction of a specific protein (structural or functional) that carries out an intended physiological process. Several of such disorders (like diabetes mellitus) are treated successfully by Protein Replacement Therapy (PRT) via administration of corresponding recombinant protein (like human biosynthetic insulin in the case of diabetes mellitus). In all these cases, the missing protein is acting at the cell surface via a receptor or as a protein/enzyme, catalyzing a biochemical reaction in the plasma 1. In cases of monogenetic or metabolic disorders, where the missing or malfunctioning protein acts inside the cells, the PRT is not feasible, unless the produced recombinant protein is functional and able to be delivered intracellularly. The transduced protein is then able to perform the intended function. Hemoglobinopathies are hematological disorders attributed to globin gene variants, appearing in 5-7% of the world’s population

2-4.

Human β-thalassemias are severe

congenital hemoglobinopathies, classified according to the absence (β0) or reduced (β+) 3



Page 4 of 44

β-globin synthesis. More than 200 mutations (point mutations, insertions or inversionsdeletions) have been discovered, introducing premature stop codons or leading to aberrant splicing 5-7. The resulting imbalance of α-/β- globin chains of adult hemoglobin (HbA: α β ) leads to precipitation of unpaired α-globin chains in the bone marrow (BM) 2 2

erythroid precursor cells as well as in mature erythrocytes (Red Blood Cells; RBCs). This ineffective erythropoiesis in BM leads to hemolysis of peripheral RBCs

4, 8, 9.

Defects in both β-globin genes lead to either intermedia β-thalassemia or β0-thalassemia major

10.

Patients with β0-thalassemia major (HbA levels lower than 70 g/L) require

lifelong safe, compatible transfusions with fresh units of RBCs and iron chelation treatment. Alternatively, selected patients with β0-thalassemia are treated effectively by haplo-BM transplantation (hBMT) or hematopoietic stem cell transplantation (HSCT), despite long term adverse effects of GvHD. Attempts to radically cure β0-thalassemias with lentiviral-mediated β-globin gene therapy as well as genome editing technologies seem promising. However, the evaluation of benefit / risk / cost ratio, the ethical issues attributed to the risk of off-target mutagenesis as well as the possible immunoresponses should be taken under serious consideration prior to clinical application

5, 6, 11-17.

Protein transduction domain (PTD) technology for intracellular delivery of therapeutic proteins refers to small peptides, which facilitate penetration of almost all biological membranes and delivery of a variety of cargos, including proteins

18-23.

PTDs can be

either covalently attached to the cargo or form non-covalent complexes with cargos. Several models have been proposed concerning the mechanism of internalization, such as inverted micelle driven delivery, direct penetration and endocytosis driven delivery as well as a sum of relatively weak interactions 24-29. PTD technology has contributed to the intracellular delivery of proteins, thus allowing replacement of endogenous proteins, which are either missing or malfunctioning in certain disorders. The major 4


Page 5 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


advantage of this technology is that it does not interfere with endogenous genetic information. Data derived from Phase I and Phase II clinical trials of proteins, transduced via PTD technology, indicated no serious adverse effects18, 22, 28. Our group has delivered successfully the human recombinant mitochondrial protein Sco2 into a cytochrome c oxidase deficient cell culture model and corrected the mitochondrial dysfunction 30, 31. In case of β-thalassemias, PRT via PTD-mediated transduction of the recombinant βglobin could be feasible, presuming that this protein is very stable, able to be delivered intracellularly in substantial quantities as well as to interact properly with the excess of α-like globins and form a functional α2β2-like hemoglobin tetramer. Here, we have produced human recombinant β-globin chain via the PTD technology and, for its transduction, we employed the human proerythroid K-562 cells, as a suitable model system. These cells increase the production of embryonic [Hb Gower-1 (ζ2ε2), Ηb Portland (ζ2γ2), Hb Gower-2 (α2ε2)] and fetal hemoglobin [HBF (α2γ2)] upon exposure to hemin, but not that of adult HbA (α2β2), due to their failure to produce mature βglobin nascent chains. Furthermore, K-562 cells synthesize de novo heme and then attach it upon the globin nascent chains as prosthetic group via the HSP90 chaperone 32-35.

Our data indicate that the produced recombinant human β-globin chain, fused to TAT peptide

24,

is indeed stable, transdusable and can potentially form an α2β2-like

hemoglobin tetramer in K-562 cells. This finding opens the possibility of applying a protein therapy approach at the proerythroid progenitors or mature thalassemic RBCs. Our cloning strategy for production and transduction of fused human TAT- β-globin chain is illustrated in Figure 1.

5



MATERIALS AND METHODS Cell cultures: Human CML K-562 cells

32

produce embryonic and fetal hemoglobins but fail to

produce the mature adult β-chain

36.

These cells were seeded in suspension culture at

2–3×105 cells/ml in RPMI-1640 (Gibco-Invitro-gen, Life Technologies, Inc., U.S.A.), supplemented with 10% v/v FBS, 5% Gibco® Antibiotic-Antimycotic and maintained in exponential growth at 37 °C, in 5% CO2 humidified atmosphere. Cell numbers and cell viability was assessed, as previously described 37. Cloning and construction of recombinant plasmids: The TA Cloning Kit with pCR®2.1 vector was used in a one-step cloning strategy for the direct insertion of a PCR product into a plasmid vector (Invitrogen Life Technology Inc, U.S.A.). The fusion expression pET-16b vector (Novagen, Germany) contains an IPTG-inducible T7 promoter and an N-terminal 10xHis peptide, followed by a XaSITE, a cleavage site for Xa protease, adjacent to the multiple cloning site (QIAGEN GmbH, Germany), allowing the removal of extra tags, if desirable. Preparation of β-globin cDNA from peripheral blood via RT-PCR and cloning into recombinant plasmid expression vectors in E. coli: The β-globin cDNA (GenBank ΗΒΒ accession no: BC007075) was derived from total RNA, isolated from healthy donor’s blood (WBCs: 6,200/µL), by using the QIAampRNA blood mini kit (QIAGEN). By using the RobusT I RT-PCR kit (FINZYMES), the β-globin cDNA (458 bps) was amplified using the primers bGLOF1:5'-atggtgcacctgactcctga-3'and bGLOB2: 5'-agcaagaaagcgagcttagtgatac-3'. Preparation of DNA fragments, construction of recombinant plasmids, transformation of competent E. coli [TOP10F΄ and C43(DE3)] cells and plasmid DNA isolation (Nucleospin Plasmid kit, Macherey-Nagel) were carried out as previously described 31. 6


Page 6 of 44

Page 7 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


pCR®2.1-β-globin

vector:

By

using

the

5′-

GCAGGTTCATATGGTGCACCTGACTCCTGAG-3′ (32mer, containing a NdeI site) as forward primer and the 5′-GAACTCGAGTCAGTGATACTTGTGGGCCAG-3′ (30mer, containing a XhoI site) as reverse primer, β-globin cDNA fragment was amplified by PCR (annealing temperature at 55 °C) and then ligated into the pCR®2.1 vector to create the pCR®2.1 β-globin vector. pCR®2.1-TAT-β-globin vector: By using

the

5′-

GCAGGTTCTATGCGCAAGAAACGCCGCCAGCGCCGCCGCGTGCACCTGAC TCCTGAG-3′ (57mer, containing a NdeI site) as forward primer and the 5′GAACTCGAGTCAGTGATACTTGTGGGCCAG-3′ (30mer, containing a XhoI site) as reverse primer, β-globin cDNA fragment was amplified (annealing temperature at 58 °C) and then ligated into the pCR®2.1 vector to create the pCR®2.1 TAT-β-globin vector.

pCR®2.1-TAT-β-globin-HA

vector:

By

using

the

5′-

GCAGGTTCTATGCGCAAGAAACGCCGCCAGCGCCGCCGCGTGCACCTGAC TCCTGAG-3′ (57mer, containing a NdeI site) as forward primer and the 5′GAACTCGAGTCAAGCATAGTCTGGGACGTCATATGGATAGTGATACTTGT GGGCCAG-3′ (57mer, containing a XhoI site) as reverse primer, β-globin cDNA fragment was amplified (annealing temperature at 55 °C) and then ligated into the pCR®2.1 vector to create the pCR®2.1 TAT-β-globin-HA vector. Clones containing the correct construct were selected by RFLP analysis and verified by automatic sequence analysis (Macrogen Inc, South Korea; Lark Technologies, Inc, U.K. or CeMIA SA, Larissa, Greece). NdeI / XhoI fragments of constructed recombinant pCR®2.1 vectors were then ligated into the pET-16b vector to generate the recombinant plasmids: (i) pET-16b-β-globin, (ii) pET-16b-TAT-β-globin and (iii) pET-16b-TAT-β-globin-

7



HA. PCR products used for cloning and protein products, expressed by recombinant pET-16b vectors, are shown in Figure 2 (A-B). Transformation of bacterial E. coli cells and induction of expression of recombinant β-globin fusion proteins: Selected colonies derived from transformed (with recombinant pET-16b-β-globin, pET-16b-TAT-β-globin and pET-16b-TAT-β-globin-HA vectors) E. coli C43(DE3) cells were cultured in L.B. medium, containing ampicillin (70 μg/mL). Induction was performed with 0.5 mM IPTG at 37°C for 2-4 h and bacterial pellets were collected and processed to isolate and purify inclusion bodies (IBs) 31, 38. Next, IBs were solubilized in 1 M L-Arg (Sigma-Aldrich, St. Louis, U.S.A.) solution, as previously described 31. Analysis of the recombinant human β-globin fusion proteins: SDS-PAGE and Western blotting immunostaining analysis were carried out, as previously described 38, 39, by using the following antibodies: Mouse monoclonal antiHA(anti-hemagglutinin).IgG 16B12 antibody (1: 4,000) (Alexa Fluor conjugate) was from Molecular Probes-Invitrogen Life Technologies Inc., U.S.A. Mouse monoclonal anti-hemoglobin β.IgG (1: 1,000), rabbit polyclonal anti-hemoglobin α.IgG (1: 1,000) and anti-c-Abl.IgG (1: 1,000) were from Santa Cruz Biotechnology Inc. CA, USA. Anti-alpha-tubulin.IgG (1: 400) mouse monoclonal antibody (clone TU-16) was from BioVentor Laboratory Medicine, Inc., CTPark Modrice, Czech Republic. Goat antirabbit IgG-AP (1: 2,500) from Sigma-Aldrich, St. Louis, U.S.A. and goat anti-mouse IgG-AP (1: 1,000) from Santa Cruz Biotechnology, CA, U.S.A. were used as secondary antibodies. The signal was detected either with the BCIP/NBT color development assay or by chemiluminescence, using the CDP-Star Reagent (Bio-Labs). The membranes were exposed at R/T and autoradiographed using Fujifilm X-ray film as well as Kodak Developer and Fixer solutions. Image J (http://rsbweb.nih.gov/ij/), a public domain 8


Page 8 of 44

Page 9 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Java image processing program, was used to analyze the density of the bands on X-ray films after the chemiluminescence analysis. LC-MS/MS Technology for protein sequence identification of 10xHis-XaSITETAT-β-globin-HA: a) Tryptic digestion: IBs, enriched in 10xHis-XaSITE-TAT-β-globin-HA, were digested with trypsin using the filter-aided sample preparation (FASP) digestion protocol 40. Proteins were dissolved in a solution of 8 M urea and 100 mM Tris, pH 8.6 (UA) and added on top of a centrifugal filtering unit with a 10 kDa molecular mass cutoff (Sartorius). The filters were centrifuged at 12,000 × g and washed twice with the UA solution. The proteins were then reduced with 10 mM DTT, alkylated for 30 min in the dark with 0.05 M iodoacetamide, washed three times with 25 mM ammonium bicarbonate and finally subjected to an overnight tryptic digestion at 37°C (0.5 μg gold trypsin (Promega) in 25 mM ammonium bicarbonate). The next day, the digested peptides were eluted twice with 100 µL water from the filter. The extracted peptide solution was dried down in a vacuum centrifuge (Savant). The samples were reconstituted with 30 μL of 2% (v/v) acetonitrile / 0.1% (v/v) formic acid solution, sonicated in a water bath for 3 min and analyzed with LC-MS/MS. b) LC-MS/MS analysis: The purified peptides were analyzed by nanoHPLC-MS/MS., using a LTQ Orbitrap XL Mass spectrometer (Thermo Fisher Scientific, Waltham, MA, U.S.A.), equipped with a nanospray source. 10 μL of the peptide mixtures were preconcentrated at a flow-rate of 5 μL /min for 10 min using a C18 trap column (Acclaim PepMap) and then loaded onto a 50 cm C18 column (75 μm ID, particle size 2 μm, 100Å, Acclaim PepMap RSLC, Thermo Scientific). The binary pumps of the HPLC (RSLCnano, Thermo Scientific) contained solution A (2% (v/v) ACN in 0.1% (v/v) formic acid) and solution B (80% ACN in 0.1% formic acid). The peptides were 9



Page 10 of 44

separated using a linear gradient of 4% - 40% B in 160 min at a flow rate of 300 nL/min. The column was placed in an oven operating at 35 °C. Full scan MS spectra were acquired in the orbitrap (m/z 300–1,600) in profile mode and data-dependent acquisition with the resolution set to 60,000 at m/z 400 and automatic gain control target at 106. The six most intense ions were sequentially isolated, and multistage activation was used to generate more sequence-informative fragments detected in the linear ion trap. Dynamic exclusion was set to 60 sec. Ions with single charge states were excluded. Lock mass of m/z 445,120025 was used for internal calibration. The software Xcalibur (Thermo Scientific) was used to control the system and acquire the raw files. Transduction of recombinant proteins into human K-562 cells and analysis of cell lysates by Western blotting and immunoprecipitation: K-562 cells (6–8 × 105 cells/mL) were first washed with PBS and then incubated in OptiMEM®I medium (Gibco-Invitrogen, Life Technologies Inc., U.S.A.) with IBs (enriched in 10xHis-XaSITE-TAT-β-globin-HA), solubilized in 1M L-Arg

41, 42. L-Arg

solution was used as a control. For incubation times, longer than 2 h, 1 × volume of RPMI-1640 medium (supplemented with FBS and antibiotics) was added. The intracellular pools of transduced 10xHis-XaSITE-TAT-β-globin-HA protein in K-562 cells were analyzed by Western blotting, carried out as previously described. At this point, we must mention that at this stage we used only solubilized IBs, enriched in 10xHis-XaSITE-TAT-β-globin-HA, instead of purified 10xHis-XaSITE-TAT-β-globinHA, since we considered that only recombinant proteins bearing the TAT domain could enter cells and not the other bacterial proteins from the IBs. A similar successful transduction experiment with solubilized IBs, enriched in human recombinant TATSco2 fusion protein was reported earlier by our group

31.

10


Page 11 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Benzidine staining assay: The amount of hemoglobin accumulation was assessed cytochemically with benzidineH2O2 solution, as previously described 43. Briefly, benzidine solution, containing 0,2% (w/v) dichlorhydrate benzidine (Sigma) in 0,5% glacial acetic acid (Scharlau) and ddH20 was previously prepared and stored at 4°C for up to 2 months. Just before use, 6% Η2Ο2 solution from hydrogen peroxide 30% (AppliChem, A1134,0250) was also prepared. For the staining, one volume of 0,2% benzidine solution was incubated with one volume of 6% Η2Ο2 for 5 min and then one volume of the corresponding resuspended cell culture was added to be incubated for about 20-30 min, in the dark, at RT. To assess erythroid differentiation, we counted the dark, smaller cells under a light microscope (Zeiss PrimoStar, 415500-1800-000). In-silico prediction of protein structures: The sequence of each recombinant fusion protein produced was submitted, with default parameters, to I-TASSER (Iterative Threading ASSEmbly Refinement), a hierarchical approach

for

protein

structure

(http://zhanglab.ccmb.med.umich.edu/I-TASSER/)

and 44-46.

function

prediction

The IDs of the submitted

protein sequences were: idS266790 for 10xHis-XaSITE-β-globin, idS264844 for 10xHisXaSITE-TAΤ-β-globin and idS264023 for 10xHis-XaSITE-TAΤ-β-globin-HA. Besides the produced recombinant fusion proteins, their analogs without the His-tag were also submitted for protein structure prediction. The IDs of the submitted protein sequences were: idS374355 for β-globin, idS374488 for TAΤ-β-globin and idS375229 for TAΤβ-globin-HA. The best proposed structure models from I-TASSER of each fusion protein were structurally superimposed (weighted type) to the β (beta) chain of the wildtype hemoglobin A protein PDB (Protein Data Bank):1BZ0, using the BioSuper (a web tool for the superimposition of biomolecules and assemblies with rotational symmetry) 11



Page 12 of 44

web tool (http://wwww-ablab.ucsd.edu/BioSuper/index.cgi) (Rueda, Orozco et al. 2013), with selected parameters as following: atom selection (CA), rotational symmetry (No), and chain mapping (Original). The resulting superimpositions were visualized through

ICM-Browser

v.3.8-4

(MolSoft,

http://www.molsoft.com/icm_browser.html)

47, 48.

San

Diego

CA,

In addition, the distances between

the heme binding sites of β-globin and the extension peptides (TAT and HA) were calculated in-silico, using the distance-tool. Co-immunoprecipitation - Western blotting of cell lysates: Co-immunoprecipitation was carried out to demonstrate whether 10xHis-XaSITE-TATβ-globin-HA, transduced in K-562 cells, can interact and bind intracellularly with endogenous α-globin chain. Briefly, K-562 cells, incubated with 10 μg/mL of solubilized IBs for 4 h, were harvested and washed 3× with PBS (SIGMA). 600 μL lysis buffer [150 mM NaCl, 50 mM Tris-HCl pH 7.5, 0.5% v/v NP-40, 0.5% v/v deoxycholic acid(Na)] per 0.5-1 × 107 cells, supplemented with 6 μL of protease inhibitor cocktail (SIGMA), was used for cell lysis. The whole cell lysates were vortexed, placed for 15 min on ice, sonicated (Elma, Transonic 660/H) for 3 × 20sec and centrifuged at 10,000 × g for 15 min at 4˚C. The supernatant was collected and used for further experimentation. One portion of the supernatant, designated as “Input” was kept for electrophoresis, while the rest was treated with 30 μL protein G agarose beads (Millipore) for 2 h at 4˚C, under rotation, to remove proteins non-specifically bound to the agarose beads. After centrifugation at 1,000 × g for 1 min, cleaned cell lysate was taken, and protein concentration was determined. Protein G agarose beads (40 μL) were pre-incubated with 3 μg anti-hemoglobin β.IgG for 16 h at 4°C under rotation. Then, 1 mg of total protein from the cleaned cell lysate was added to the protein G agarose beads and incubated for 2 h under the same conditions. Immuno-precipitates were 12


Page 13 of 44 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


collected as a pellet by centrifugation at 1,000 × g for 1 min (supernatant was kept as “IgG control” for the SDS-PAGE). Beads in the pellet were washed 3 × with PBS (washes were also kept and pooled for the SDS-PAGE). 5 × loading buffer with 5% βmercaptοethanol was added τo the washed beads, followed by incubation for 5 min at 95°C. The supernatant, after centrifugation at 1,000 × g for 1 min, yielded the immunoprecipitant. Whole cell lysates, immunoprecipitants and supernatants (mentioned above) were analyzed by SDS-PAGE under reducing conditions, subjected to Western blotting with anti-hemoglobin α.IgG and visualized by chemiluminescence (CDP-Star, Bio-Labs). The above co-immunoprecipitation experiment was repeated with the Pierce Classic IP Kit (26146, Thermo Scientific), following manufacturer’s instructions. Briefly, K562 cells (untreated or treated with 50 µg/mL solubilized IBs, enriched in 10xHis-XaSITETAΤ-β-globin-HA protein, for 48 h) were lysed with 500 μL IP Lysis/Wash Buffer supplemented with protease/phosphatase inhibitors (Pierce™ Protease and Phosphatase Inhibitor Mini Tablets, 88668, Thermo Scientific) and the cell lysates were quantified with Pierce™ BCA Protein Assay Kit (23225, Thermo Scientific). For the formation of the immunocomplexes, 1 mg from each cell lysate was pre-cleared with 80 μL of Control Agarose Resin slurry, using the designated spin columns at 4oC for 1 h under constant rotation. The pre-cleared lysate was mixed with 10 μg of anti-hemoglobin β.IgG and the mixture was incubated under constant rotation at 4oC overnight. In each antibody/lysate sample, 20 μL of Pierce Protein A/G Agarose (pre-washed with IP Lysis/Wash Buffer) was added. The antibody/lysate/Protein A/G Agarose mixtures were incubated at 4oC under constant rotation for 1 h. The supernatants were discarded, and the resins were washed with TBS 1 × supplemented with protease/phosphatase inhibitors. The elution of the immune complexes (immunoprecipitants) from the 13



samples was performed by: (a) adding 50 μL of 2 × reducing Lane Marker Sample Buffer, supplemented with 20mM DTT to each sample; (b) heating up the samples at 99oC for 5 min; and (c) isolating the supernatants from the samples after centrifugation. All centrifugations were performed at 1,000 × g for 1 min. An isotypic control was included in this secondary IP experiment containing only 10 μg of anti-hemoglobin β.IgG and 20 μL of Pierce Protein A/G Agarose. The immunoprecipitants were analyzed by SDS-PAGE and Western Blot (probing with anti-hemoglobin α.IgG), as mentioned above. HPLC analysis of hemoglobin variants Bio-Rad VARIANT II HbA2/HbA1C hemoglobin analyzer utilizes principles of ion exchange high performance liquid chromatography (HPLC) and is programmed to give as report the percentage of hemoglobin variants vs produced HbA2. In case no HbA2 can be identified, the report is given as volts in the Y-axis49. Statistical analysis For the experiment concerning the Bz+ K-562 cells, at least three independent biological repetitions were performed. Statistical significance was achieved through a paired, parametric T-test (*p

PRODUCTION AND TRANSDUCTION OF HUMAN RECOMBINANT Î²

Recommend Documents