Promoting immune efficacy of oral Helicobacter pylori vaccine by

Subscriber access provided by University of South Dakota

Article

Promoting immune efficacy of oral Helicobacter pylori vaccine by HP55/PBCA nanoparticles against gastrointestinal environment Tao Xi, Hai Liu, Wei Liu, Zhoulin Tan, Zhiqin Zeng, Huimin Yang, Shuanghui Luo, Linlin Wang, and Yingying Xing Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.8b00251 • Publication Date (Web): 16 Jul 2018 Downloaded from http://pubs.acs.org on July 17, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Promoting immune efficacy of oral Helicobacter pylori vaccine by HP55/PBCA nanoparticles against gastrointestinal environment Hai Liu1,2, Wei Liu1,2, Zhoulin Tan1,2, Zhiqin Zeng1,2, Huimin Yang1,2, Shuanghui Luo1,2, Linlin Wang1,2, Tao Xi*1,2, Yingying Xing*1,2 1

School of Life Science and Technology, China Pharmaceutical University, No.24 Tongjia xiang, Nanjing 210009, PR China

2

Jiangsu Key Laboratory of Carcinogenesis and Intervention, China Pharmaceutical University, No.24 Tongjia xiang, Nanjing 210009, PR China *Corresponding authors : Tao Xi and Yingying Xing, School of Life Science and Technology, China Pharmaceutical University, No.24 Tongjia xiang, Nanjing 210009, PR China; E-mail: [email protected] (Tao Xi), [email protected] (Yingying Xing)

ACS Paragon Plus Environment

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract The immunogenicity of oral subunit vaccines is poor partly due to the harsh milieu of gastrointestinal (GI) tract. For some pathogens that restrictedly inhabit in GI tract, a vaccine that works in situ may provide more potent protection than that vaccinates parenterally. Yet, none appropriate delivery system is available for oral subunit vaccines. In this study, we designed HP55/Poly(n-butylcyanoacrylate) (PBCA) nanoparticles (NPs) to carry Helicobacter pylori (H. pylori) subunit vaccine CCF for oral administration in a prophylactic mice model. These NPs that synthesized using interfacial polymerization method protected CCF antigen not only from the acidic pH in simulated gastric fluid (SGF, pH 1.2), but also from the proteolysis in simulated intestinal fluid (SIF, pH 7.4). Oral vaccination of mice with HP55/PBCA-CCF NPs promoted the productions of serum antigen-specific antibodies, mucosal secretory IgA and pro-inflammatory cytokines. Moreover, a Th1/Th17 response and augmented lymphocytes were found in the gastric tissue of HP55/PBCA-CCF NPs-immunized mice, which might eventually limit H. pylori colonization. Collectively, these results indicate that HP55/PBCA NPs are promising carriers against the severe situation of GI tract and thereby, may be further utilized for other orally administrated vaccines or drugs. Keywords: Helicobacter pylori; oral vaccine carrier; acid-resistance; proteolysis-resistance; Nanoparticles


Page 2 of 21

Page 3 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction Helicobacter pylori (H. pylori), one of Gram-negative bacteria, that persistently colonizes in human gastric mucosa, is highly connected with the progress of gastritis, gastric ulcers and gastric adenocarcinoma [1-3]. Conventional antibiotic combination therapy is an effective method to quickly control H. pylori infection, but challenged by rising resistance of antibiotics, poor patient compliance, repeated infection and high cost [4-6]. Therefore, developing an alternative therapy such as vaccination may be desirable to prevent the prevalence of this pathogen [7, 8]. Additionally, oral immunization via the intestinal mucosa may provide more potent protection for those pathogens that infect through gastrointestinal (GI) mucosal membranes [9, 10]. However, many peroral vaccines are easily destructed in the GI tract owing to the strong acid as well as rich enzymes, it is an inefficient pathway for oral administration of vaccines [11]. Thereby, an appropriate delivery system is desired for protecting antigens from the destruction and degeneration induced by extremely acidic pH and GI proteases [12, 13]. Poly(n-butylcyanoacrylate) (PBCA), a kind of extensively investigated polymeric material, which employed clinically in Canada, Europe and USA as tissue adhesives, has captured broad attention due to its biocompatibility, biodegradability and minimal cytotoxicity [14, 15]. Moreover, PBCA can be synthesized as nanoparticles to deliver various drug ingredients, such as antibiotics, anti-cancer drugs, genes and peptides [16-19]. In the field of oral administration, PBCA nanoparticles (NPs) were reported to protect 75–95% of the insulin from pepsin- or chymotrypsin-medicated proteolysis in vitro [20]. Hence, PBCA NPs might be ideal candidates for delivering orally administered vaccines against proteolysis within the GI tract. As a favorable enteric coating agent, Hydroxypropyl methylcellulose phthalate (HPMCP) is widely used to protect drug ingredients from destruction by the acid in stomach [21]. Farhadian et al. have fabricated trimethyl chitosan nanoparticles formulated with HPMCP to orally deliver hepatitis B surface antigen, resulting in an elevated flexibility to the acidic environment [22]. HP55 is a special type of HPMCP with the characteristic of solubility beyond pH 5.5, which can improve the stability of PBCA NPs in the gastric fluid. In our previous studies, the subunit vaccine CCF was constructed and mixed with aluminum hydroxide adjuvant for oral co-administration to prevent H. pylori infection [23]. Further, the acid-resistant HP55/PLGA nanoparticles were formulated with CCF to promote immune protection [12]. However, in addition of the acid environment in the stomach, the milieu of GI tract remains harsh because of abundant digestive proteases, which also lead to the degradation of antigens and fair immune efficacy. In the present study, we showed that formulating HP55/PBCA NPs, which employed the characteristics of acid-resistance and proteolysis-resistance, with subunit vaccine CCF induced a protective response against H. pylori in mice. In simulated gastric fluid (SGF, pH 1.2) and simulated intestinal fluid (SIF, pH 7.4), we demonstrated that HP55/PBCA NPs could dramatically delay the degradation of antigen CCF. In addition, vaccination of mice with HP55/PBCA-CCF NPs triggered local and systemic humoral immune response and elicited a Th1/Th17 response which might be responsible for the infiltration of lymphocytes and reduction of H. pylori colonization after challenge. Finally, these findings suggest that HP55/PBCA NPs are promising carriers for delivering orally administered vaccine and may be further utilized for other peroral biological active drugs. 2. Experimental Section



2.1. Chemicals and reagents The HP55 was provided by Shin-Etsu Chemical Company (Tokyo, Japan). The monomer of n-butylcyanoacrylate (BCA) was purchased from Beijing Compont Medical Devices Company (Beijing, China). Poloxamers 188 (average molecular weight 8400) was obtained from BASF (Shanghai, China). Porcine pepsin (3000 U/mg) and porcine pancreatin (4 NF/USP) were provided by Biofroxx GmbH (Einhausen, Germany). Native urease of H. pylori was purchased from Linc-bio Science Company (Shanghai, China). The qPCR reagent was obtained from Nanjing Vazyme Biotech Company. (ChamQTM SYBR, Nanjing, China). 2.2. Synthesis of nanoparticles The method for synthesizing CCF-encapsulated HP55/PBCA NPs was the interfacial polymerization [24] with some modifications. Briefly, the water phase was composed of poloxamers 188 (1% w/v) and CCF solution. BCA monomers (1% v/v) and HP55 (0.5% w/v) were dissolved in acetone as the organic phase. The water phase and organic phase were mixed at the volumetric ratio of 1:1 (5:5 mL). For prevention of protein degradation, the following procedures were maintained the temperature of 4 °C by using an ice bath. The organic phase was slowly added into the water phase with a syringe under magnetic stirring with speed of 350 rpm and further stirred with 4.5 hours to remove the organic solvent by evaporation. Then the mixed colloidal solution was filtered by a 0.45 μm organic membrane for removing aggregates. 2.3. Characteristics of nanoparticles 2.3.1. Morphology and particle size The morphology of nanoparticles was observed by transmission electron microscopy (TEM) (HT7700, Hitachi, Tokyo, Japan). The Zetasizer (3000SH, Malvern Instruments, Worcestershire, UK) was used for measuring the polydispersity index (PDI) and average particle size. The nanoparticles solution diluted 100-fold with distilled water for determination. 2.3.2. Encapsulation efficiency To determine the protein encapsulation efficiency, the nanoparticles were concentrated by centrifugation and then washed with purified water three times. The amount of CCF encapsulated to nanoparticles was analyzed using densitometry testing of Coomassie brilliant blue-stained SDS-PAGE as reported previously [25]. For calculating the encapsulation efficiency (EE) of CCF, the following formula was used: EE%=WE/WT x 100%. Where WE is the amount of CCF encapsulated in nanoparticles, and WT is the amount of total CCF initially added. 2.3.3. In vitro release rate To test the protective effect provided by the nanoparticles, HP55/PBCA-CCF NPs, PBCA-CCF NPs and CCF stander were incubated in simulated gastric fluid (SGF, pH 1.2) and simulated intestinal fluid (SIF, pH 7.4), respectively. 100 mL SGF was consisted of 0.2 g NaCl, 0.32 g pepsin and distilled water, then pH was adjusted to 1.2 with 0.1M HCl. 100 mL SIF was composed of 0.68 g KH2PO4, 1 g pancreatin and distilled water, then the pH was adjusted to 7.4 with 0.1M NaOH. Briefly, 20 mg of the CCF stander, PBCA-CCF NPs and HP55/PBCA-CCF NPs were added in 4 mL SGF and SIF respectively and shaken by a thermostatic shaker at 110 rpm under 37 °C. 20 μL


Page 4 of 21

Page 5 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


sample was removed from the simulated medium at predetermined time intervals, then equal amount of fresh medium was supplemented. After centrifugation at 13000 rpm for 20 min, the resulting samples were analyzed using densitometry testing as the above mentioned. Finally, the cumulative release rate was calculated. All experiments were performed in triplicate. 2.4. Cytotoxicity assay The MTT assay was employed to test the viability of mouse macrophages (RAW 264.7 cells) and human gastric epithelial cells (GES-1 cells) in the presence of HP55/PBCA-CCF NPs, with cells without NPs being used as a control. RAW 264.7 and GES-1 cells lines were obtained from ATCC and then preserved in our laboratory. RAW 264.7 and GES-1 cells were cultured in DMEM (Gibco, Grand Island, NY, USA) and RPMI-1610 medium (Gibco), respectively with 10% fetal bovine serum (FBS, Gibco) under a 5% CO2 atmosphere at 37 °C. Briefly, the cells were seeded into 96-well plates at the concentration of 5 x 104 cells/mL (200 μL/well). After 24 hours of incubation, the cells were further cultured for 24 hours in fresh culture medium containing different concentrations of HP55/PBCA-CCF NPs. Then the culture medium was replaced by fresh culture medium with another 20 μL MTT solution (5 mg/mL) for further incubation with 4 hours. After carefully removing the supernatant, 150 μL of DMSO solution was added into the wells. The microplate reader was used to measure the absorbance values at 570 nm. 2.5. In vivo fluorescence images analysis To evaluate the biodistribution of HP55/PBCA NPs, the CCF was labeled with FITC (CCF-FITC) and then was encapsulated by HP55/PBCA NPs (HP55/PBCA-CCF-FITC NPs). Six weeks old male BALB/c mice were used to accurately visualize the position of HP55/PBCA-CCF-FITC NPs after oral administration. 100 μg of CCF-FITC or equal amount of HP55/PBCA-CCF-FITC NPs was injected into mice by gavage. Then mice were sacrificed by excess ether anesthetic to assess the biodistribution of HP55/PBCA-CCF-FITC NPs in gastrointestinal (GI) tract at predetermined time intervals. The in vivo fluorescence images were collected using the IVIS imaging system (Perkin Elmer, IVIS Spectrum, MA, USA). 2.6. Bacteria culture and animal experiments H. pylori strain SS1 was obtained from the National Center for Disease Control and Prevention then cultured as described before [26]. Briefly, the brain-heart infusion plates were used to culture H. pylori SS1 under microaerophilic atmospheres for 3 days at 37°C. Next, the H. pylori SS1 were collected and resuspended in PBS for adjusting the concentration about 1 x 109 CFUs/mL (estimated based on turbidimetry) before inoculation. Male BALB/c mice (Six weeks old) were bred under the standard pathogen-free condition in Animal Experimental Center of China Pharmaceutical University. Mice were randomly assigned into five groups (normal control-NC group, HP55/PBCA- NPs group, HP55/PBCA-CCF NPs group, PBCA-CCF NPs group, Alum-CCF group), and each group contained two cages (6-8 mice per cage). Then each group was vaccinated four times at weekly intervals by oral administration with PBS plus 500 μL aluminum adjuvant, HP55/PBCA- NPs, HP55/PBCA-CCF NPs, PBCA-CCF NPs, CCF plus 500 μL aluminum adjuvant, respectively. 100 μg of CCF was used to vaccinate in the Alum-CCF, PBCA-CCF NPs and HP55/PBCA-CCF NPs groups. Two weeks after last vaccination, all mice were challenged using 0.4 mL H. pylori SS1 by gavage with 0.2 mL 0.2% sodium bicarbonate solution



for one time. Last, the mice were sacrificed by excess ether anesthetic to assess immune efficacy. The serology samples, spleen tissues and gastric tissues were obtained as reported previously with some modifications [27, 28]. The schedule of challenge, immunization and sampling were depicted in Fig. 3A. 2.7. Determination of serum antigen-specific antibody Serum samples were collected from mice angular vein for detecting the levels of antigen-specific antibody by ELISA as we described previously [29]. Briefly, 0.5 μg native urease of H. pylori was coated overnight with carbonate buffer in 96-well plates at 4 °C. After 2 hours of being blocked at 37 °C, 1:500 diluted mouse sera were added into the plates. Then 1:2000 diluted goat anti-mouse IgA, IgM, IgG, IgG1 or IgG2a antibodies (Santa Cruz, CA, USA) were added into the plates for an hour at 37 °C. After being incubated with the TMB substrate for 15 min at room temperature, ELISA stop solution was added to terminate the reaction. Last, the microplate reader was used to measure absorbance at 450 nm. 2.8. Determination of gastric secretory IgA (sIgA) To assess the specific mucosal sIgA in stomach, 20 mg gastric tissue was homogenized with 500 μL PBS by the blade-blender homogenizer. After centrifugation at 3000 rpm for 15 min, the supernatant was obtained and further diluted 1:5 in PBS. Last, the 1:2000 diluted goat anti-mouse IgA antibody was utilized to detect the mucosal sIgA by ELISA as mentioned above. 2.9. Quantitative culture of H. pylori in the gastric tissue Quantitative culture of H. pylori in the gastric tissue was implemented as reported previously with some modifications [27]. 20 mg gastric tissue from each mouse was homogenized with 500 μL PBS by the blade-blender homogenizer. Then the tissue homogenates were serially diluted of 1:10, 1:100, 1:1000 and then added into H. pylori selective plates. After culturing under microaerophilic atmospheres at 37°C for 3 days, the bacterial colonies were counted based on the typical colony identification of H. pylori by microscopy, urease test, oxidase test and catalase test in according with the approaches described by Ferrero et al. [30]. 2.10. Cytokines profiles in splenic lymphocytes Splenic lymphocytes were isolated from spleen tissues in lymphocytes separation medium and then cultured using RPMI-1610 medium containing 10% FBS at the concentration of 2 × 105 cells/well with 2 μg/mL native urease of H. pylori in 96-well plates. After 72 hours of incubation under a 5% CO2 atmosphere at 37°C, the supernatant of culture was collected and detected using IL-17 and IFN-γ ELISA Kit (BOSTER, Wuhan, China). 2.11. Gastric RNA extraction and qRT-PCR To determine the expression levels of the IL-17, IFN-γ and CXCL1 in gastric tissue, total RNA extraction, cDNA Synthesis and quantitative real time PCR (qRT-PCR) were implemented as we described previously [12]. The primers sequences of this experiment were summarized in Table 1. GAPDH was used as a suitable reference gene. 2.12. Preparing the single-cell suspensions and flow cytometry


Page 6 of 21

Page 7 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The procedures of preparing gastric single-cell suspensions and mesenteric lymph nodes cells for flow cytometry analysis were performed as we described previously [31]. Rat anti-mouse antibodies of Ly6G (clone 1A8), CD45 (clone 30-F11), CD4 (clone GK1.5) and intracellular stained antibodies of IL-17 (clone 9B10), IFN-γ (clone XMG1.2) were purchased from Biolegend (San Diego, CA, USA). FACSCalibur flow cytometer (BD Bio-sciences, San Jose, CA, USA) was utilized for flow cytometric analysis. 2.13. Statistical analyses GraphPad Prism 5 software was utilized for statistical analyses. All data were presented as mean ± standard deviation (SD). The statistical significance of difference among the all groups was evaluated using one-way ANOVA. The value of P < 0.05 was considered statistically significant.

3. Results 3.1. Characteristics of PBCA-CCF NPs and HP55/PBCA-CCF NPs In this research, we synthesized uniform-sized HP55/PBCA-CCF NPs by the interfacial polymerization method. The TEM of HP55/PBCA-CCF NPs were presented in Figure 1A. These NPs were spherical shape with smooth surface. The average particle size, polydispersity index and encapsulation efficiency (EE) of different NPs formulations were summarized in Table 2. The average particle size of HP55/PBCA-CCF NPs was 218.6±4.7 nm, which was an appropriate magnitude for the uptake by DCs (below 500 nm) [32]. As shown in Figure 1B, the amount of CCF encapsulated to nanoparticles was quantitated by normalizing to CCF standard using densitometry analysis and the EE of HP55/PBCA-CCF NPs and PBCA-CCF NPs were 55.04% and 49.74% respectively. The release profiles of HP55/PBCA-CCF NPs and PBCA-CCF NPs were evaluated in simulated physiological conditions of the gastrointestinal (GI) tract using a dynamic analysis method. Samples were removed from the simulated medium at predetermined time intervals for detecting the remaining amount of CCF in HP55/PBCA-CCF NPs and PBCA-CCF NPs (Figure 1D). Then the cumulative release rate of antigen CCF was calculated using densitometry analysis (Figure 1C). An hour later, only 13.4% CCF in HP55/PBCA-CCF NPs was degraded in SGF, which was much lower than that 48.3% in PBCA-CCF NPs. Compared with CCF stander, HP55/PBCA-CCF NPs and PBCA-CCF NPs showed proper protections in SIF, which cumulative release rates were 57.8% and 61.5% respectively after 24 hours. These results suggested that HP55/PBCA-CCF NPs could protect larger amount of antigen from degradation in gastric environment and presented a sustained-release performance in enzymatic situation that mimicked intestine. 3.2. In vitro cytotoxicity study and in vivo biodistribution of HP55/PBCA NPs The cytotoxicity study of HP55/PBCA-CCF NPs was evaluated in RAW 264.7 and GES-1 cells by MTT assay. As depicted in Figure 2A and B, no significant cytotoxicity of HP55/PBCA-CCF NPs was found at concentrations from 10 to 100 μg/mL after 24 hours both in RAW 264.7 and GES-1 cells, indicating that the HP55/PBCA NPs were biocompatible and the feasibility of its use as drug carriers. Besides, in order to investigate biodistribution of HP55/PBCA NPs after oral administration, the CCF was labeled with FITC (CCF-FITC) and then was encapsulated by



HP55/PBCA NPs (HP55/PBCA-CCF-FITC NPs) for fluorescence imaging. After 0.5 hour, the fluorescence intensity of CCF-FITC was hardly found in the stomach of mice, but for HP55/PBCA-CCF-FITC NPs, the fluorescence intensity was still found in the stomach after 1 hour (Figure 2C and D). Similarly, fluorescence signal of HP55/PBCA-CCF-FITC NPs, rather than that of CCF-FITC, could be observed in the small intestine of mice at 4 hours after oral administration (Figure 2C and D). All these results demonstrated that HP55/PBCA NPs could prolong the residence time of antigen CCF in GI tract. 3.3. Vaccination of mice with HP55/PBCA-CCF NPs elevates the levels of antigen-specific antibodies in the serum For evaluating vaccine immunogenicity and the response of humoral immunity, sera were collected on day 29 and 43 (a week before and after challenge) to detect antigen-specific IgG, IgM and IgA by ELISA. As shown in Figure 3B, the levels of urease-specific IgG, IgM and IgA were significantly increased in the HP55/PBCA-CCF NPs group before challenge, suggestting that HP55/PBCA-CCF NPs triggered a systemic humoral response. After challenge, although the levels of IgG and IgM in HP55/PBCA-CCF NPs group were slightly decreased, the level of IgA was elevated. Besides, the production of IgG, IgM, and IgA in HP55/PBCA- NPs, PBCA-CCF NPs and Alum-CCF groups showed no significant difference before and after challenge. Therefore, vaccination of mice with HP55/PBCA-CCF NPs enhanced the humoral immune response. 3.4. Immunization of mice with HP55/PBCA-CCF NPs induces local Th1/Th17 response after challenge The relative levels of IgG2a and IgG1 approximately reflect systemic Th1/Th2 polarization of CD4+ Th cells. After investigating profiles of IgG2a and IgG1, we observed that the IgG1 was slightly higher than IgG2a in all groups before challenge, then the gaps between IgG1 with IgG2a in HP55/PBCA- NPs and PBCA-CCF NPs were expanded (except for Alum-CCF and HP55/PBCA-CCF NPs groups) after challenge (Figure 4A). Next the ratio of log2 (IgG2a/IgG1) was calculated for evaluating immune bias (Figure 4B). The elevated ratios in HP55/PBCA-CCF NPs and Alum-CCF groups indicated that H. pylori infection might impact the systemic Th1-polarized immune response. Next, we determined antigen-specific T-cell response in spleen tissues by detecting the production of IFN-γ and IL-17. Splenic lymphocytes were isolated from mice in each group, and stimulated by native urease of H. pylori in vitro. Then the supernatants of cultured splenic lymphocytes were collected to determine the levels of IFN-γ and IL-17, the indicators of Th1 and Th17 response. Immunization of mice with HP55/PBCA-CCF NPs and Alum-CCF induced higher levels of IFN-γ and IL-17 (Figure 4C-D), demonstrating a stronger Th1/Th17 memory response. To further confirm the existence of Th1/Th17 memory response in immunized mice, the mesenteric lymph nodes (MLN) were isolated to measure the proportions of IFN-γ and IL-17 positive CD4+ cells by flow cytometry. As expected, IFN-γ and IL-17 producing CD4+ cells in HP55/PBCA-CCF NPs group were significantly higher than that in other groups (Figure 5A-B and F), suggesting that the increased production of Th1 and Th17 cells from MLN might enhance Th1/Th17 response after challenge. Moreover, the gastric mRNA expression levels of IFN-γ, IL-17 and CXCL1 were assessed by qRT-PCR. Similarly, significantly increased expression of IFN-γ and IL-17 mRNA were both detected in HP55/PBCA-CCF NPs and Alum-CCF groups (Figure 5C-D).


Page 8 of 21

Page 9 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Besides, the Th17 immunity was reported to drive a pro-inflammatory response [33, 34]. While CXCL1 is one of the important chemokines for the recruitment of neutrophils, we examined the CXCL1 mRNA level in gastric tissue. Interestingly, the elevated CXCL1 mRNA expression was only found in HP55/PBCA-CCF NPs group (Figure 5E). 3.5. Local humoral and cellular responses contribute to immune protection Mucosal sIgA is critical for the control of mucosal pathogens. We found an increased sIgA production in both HP55/PBCA-CCF NPs and Alum-CCF groups (Figure 6A), indicating a strong local immune response. Of note, conversely related to the sIgA level, the colonization densities in HP55/PBCA-CCF NPs and Alum-CCF groups both reduced as compared with control groups (Figure 6B). Therefore, these results demonstrated that after challenge, the protective response induced by HP55/PBCA-CCF NPs and Alum-CCF might be associated with the vigorous local humoral immunity. Moreover, the infiltration of lymphocytes into gastric mucosa suggests a strong local cellular response. We analyzed the participators of gastric inflammation by flow cytometry. The gastric single-cell suspensions were used to determine the infiltration of the main types of inflammatory cells. Obviously, the immune cells, containing CD45+ cells (leukocytes), CD4+ cells (T-helper cells) and Ly6G+ cells (neutrophils), were significantly augmented only in HP55/PBCA-CCF NPs group (Figure 6C-F), indicating an elevated local recall immune response in gastric mucosa. In summary, these findings suggested that oral vaccination with HP55/PBCA-CCF NPs could elicit enhanced local humoral and cellular responses, which might both contribute to immune protection against H. pylori infection in mice.

4. Discussion Administration of vaccines by mucosa is an important method for inducing proper immune responses to control pathogenic bacteria in peripheral blood, systemic sites and in most external mucosal surfaces [35]. However, oral delivery of vaccines is extremely difficult duo to the severe situation in GI tract, such as gastric acid, digestive enzymes, uncontrolled release, short transit time and low-efficient uptake by microfold cells (M cells) [36]. Jain et al. formulated PEG-PLA-PEG block copolymeric nanoparticles to encapsulate hepatitis B surface antigen for oral immunization, and induced effective levels of humoral immunity and cellular immune response in mice [37]. Harde et al. used glucomannosylated chitosan nanoparticles to orally deliver vaccine and enhanced the immune responses in mice [38]. Gao et al. selected carboxymethyl chitosan/chitosan nanoparticles as an oral delivery vehicle in the fish vaccination, which increased the specific antibodies and lysozyme activity after immunization [39]. Therefore, designing a proper carrier to protect antigen against the harsh milieu of GI tract is a promising strategy to deliver oral vaccines [13, 40]. In this research, we synthesized the HP55/PBCA NPs to load H. pylori subunit vaccine CCF for oral administration in a prophylactic mice model. HP55/PBCA-CCF NPs showed proper properties of acid-resistance and proteolysis-resistance when incubated in SGF and SIF. However, PBCA-CCF NPs performed a rapid-release behavior in SGF, especially in the first hour. The reason of initial burst release might be some antigen adsorbed onto the surface of PBCA NPs [15, 41, 42], which finally led to more vaccine destruction in the gastric contents and less vaccine delivery to intestine. In addition, the average particle size of HP55/PBCA-CCF NPs was about 220 nm, which



was a suitable magnitude for recognizing by M cells in gut mucosa and then presented to DCs [43]. M cells played important roles in antigen uptake and transfer in mucosal sites of the intestinal epithelium [44]. Furthermore, an increased production of mucosal sIgA was observed both in HP55/PBCA-CCF NPs and Alum-CCF groups. Accordingly, a visible reduction of H. pylori colonization was found both in HP55/PBCA-CCF NPs and Alum-CCF groups. However, an elevated level of humoral immunity was only detected in HP55/PBCA-CCF NPs group. These results suggested mucosal sIgA rather than systemic antigen-specific antibodies might be more helpful to control H. pylori infection [31, 45]. To further confirm the major participators for defending H. pylori infection inducing by our vaccine, we investigated splenic memory immune response and the levels of cytokines in MLN as well as in gastric tissue. The levels of IFN-γ and IL-17 were both elevated in spleen, MLN and gastric tissues in HP55/PBCA-CCF NPs group, indicated that an enhanced Th1/Th17 response was occurred in the immunized mice, which contributed to immune protection against H. pylori infection [46, 47]. In the previous research, Amedei et al. demonstrated that IL-17 was a key cytokine to drive gastric inflammatory responses, mainly consisting of neutrophils and T cells [48]. Meanwhile, IL-17 was reported to affect gastric epithelial cells to produce chemokines, resulting in recruitment of inflammatory cells and promotion of granulopoiesis [31, 49]. As a chemokine induced by Th17 response, increased expression of gastric CXCX1 mRNA was detected in HP55/PBCA-CCF NPs group, and CXCL1/CXCR2 axis was important for the recruitment of neutrophils to participate in gastritis [50]. Furthermore, the augmented infiltration of leukocytes, T-helper cells and neutrophils were observed in gastric mucosa, which also involved in defending H. pylori infection. In conclusion, HP55/PBCA NPs were ideal carriers to orally deliver H. pylori vaccine, which showed an appropriate protection of antigen CCF in SGF and SIF. Meanwhile, the mice vaccinated with HP55/PBCA-CCF NPs reduced H. pylori colonization, which was mainly owing to induction of the Th1/Th17 response as well as the infiltration of lymphocytes into gastric mucosa, partly associated with the local mucosal sIgA level. In addition, Alum-CCF group performed a mild protection against H. pylori infection, which indicated a proper vaccine adjuvant might have a promoted effect on the immune response [51-53]. Therefore, in the further study, we will choose a suitable mucosal adjuvant to decorate our NPs for enhancing the properties of mucosal targeting and controlled release, which will widen the application to other orally administrated vaccines or drugs.

Acknowledgements This research was sponsored by the National Natural Science Foundation of China (No. 81502970), National key R&D Program of China (No. 2017YFD0400303), and the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions.

References [1] A. Nomura, G.N. Stemmermann, P.H. Chyou, I. Kato, G.I. Perez-Perez, M.J. Blaser, Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii, The New England journal of medicine, 325 (1991) 1132-1136.


Page 10 of 21

Page 11 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


[2] H. Suzuki, Y. Saito, T. Hibi, Helicobacter pylori and Gastric Mucosa-associated Lymphoid Tissue (MALT) Lymphoma: Updated Review of Clinical Outcomes and the Molecular Pathogenesis, Gut and liver, 3 (2009) 81-87. [3] A. Sokic-Milutinovic, T. Alempijevic, T. Milosavljevic, Role of Helicobacter pylori infection in gastric carcinogenesis: Current knowledge and future directions, World journal of gastroenterology, 21 (2015) 11654-11672. [4] Y. Glupczynski, Antimicrobial resistance in Helicobacter pylori: a global overview, Acta gastro-enterologica Belgica, 61 (1998) 357-366. [5] T.U. Wheeldon, T.T. Hoang, D.C. Phung, A. Bjorkman, M. Granstrom, M. Sorberg, Long-term follow-up of Helicobacter pylori eradication therapy in Vietnam: reinfection and clinical outcome, Alimentary pharmacology & therapeutics, 21 (2005) 1047-1053. [6] A. Ghasemi, N. Mohammad, J. Mautner, M.T. Karsabet, A. Ardjmand, R. Moniri, Immunization with recombinant FliD confers protection against Helicobacter pylori infection in mice, Molecular immunology, 94 (2018) 176-182. [7] P. Sutton, At last, vaccine-induced protection against Helicobacter pylori, Lancet, 386 (2015) 1424-1425. [8] K. Robinson, K. Kaneko, L.P. Andersen, Helicobacter: Inflammation, immunology and vaccines, Helicobacter, 22 Suppl 1 (2017). [9] H. Sijun, X. Yong, Helicobacter pylori vaccine: mucosal adjuvant & delivery systems, The Indian journal of medical research, 130 (2009) 115-124. [10] B. Devriendt, B.G. De Geest, B.M. Goddeeris, E. Cox, Crossing the barrier: Targeting epithelial receptors for enhanced oral vaccine delivery, Journal of controlled release : official journal of the Controlled Release Society, 160 (2012) 431-439. [11] F. Chen, Z.R. Zhang, F. Yuan, X. Qin, M. Wang, Y. Huang, In vitro and in vivo study of N-trimethyl chitosan nanoparticles for oral protein delivery, International journal of pharmaceutics, 349 (2008) 226-233. [12] Z. Tan, W. Liu, H. Liu, C. Li, Y. Zhang, X. Meng, T. Tang, T. Xi, Y. Xing, Oral Helicobacter pylori vaccine-encapsulated acid-resistant HP55/PLGA nanoparticles promote immune protection, European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 111 (2017) 33-43. [13] C.P. Reis, R.J. Neufeld, A.J. Ribeiro, F. Veiga, Nanoencapsulation II. Biomedical applications and current status of peptide and protein nanoparticulate delivery systems, Nanomedicine, 2 (2006) 53-65. [14] R.M. Starke, R.J. Komotar, M.L. Otten, D.K. Hahn, L.E. Fischer, B.Y. Hwang, M.C. Garrett, R.R. Sciacca, M.B. Sisti, R.A. Solomon, S.D. Lavine, E.S. Connolly, P.M. Meyers, Adjuvant embolization with N-butyl cyanoacrylate in the treatment of cerebral arteriovenous malformations: outcomes, complications, and predictors of neurologic deficits, Stroke, 40 (2009) 2783-2790. [15] S. Gao, Y. Xu, S. Asghar, M. Chen, L. Zou, S. Eltayeb, M. Huo, Q. Ping, Y. Xiao, Polybutylcyanoacrylate nanocarriers as promising targeted drug delivery systems, Journal of drug targeting, 23 (2015) 481-496. [16] N. Xu, J. Gu, Y. Zhu, H. Wen, Q. Ren, J. Chen, Efficacy of intravenous amphotericin B-polybutylcyanoacrylate nanoparticles against cryptococcal meningitis in mice, International journal of nanomedicine, 6 (2011) 905-913. [17] L. Cabeza, R. Ortiz, J.L. Arias, J. Prados, M.A. Ruiz Martinez, J.M. Entrena, R. Luque, C. Melguizo,



Enhanced

antitumor

activity

of

doxorubicin

in

breast

Page 12 of 21

cancer

through

the

use

of

poly(butylcyanoacrylate) nanoparticles, International journal of nanomedicine, 10 (2015) 1291-1306. [18] C.Y. Chung, J.T. Yang, Y.C. Kuo, Polybutylcyanoacrylate nanoparticle-mediated neurotrophin-3 gene delivery for differentiating iPS cells into neurons, Biomaterials, 34 (2013) 5562-5570. [19] Z.R. Xu, W.F. Wang, X.F. Liang, Z.H. Liu, Y. Liu, L. Lin, X. Zhu, Protective effects of poly (butyl) cyanoacrylate

nanoparticles

containing

vasoactive

intestinal

peptide

against

6-hydroxydopamine-induced neurotoxicity in vitro, Journal of molecular neuroscience : MN, 55 (2015) 854-864. [20] C. Damge, H. Vranckx, P. Balschmidt, P. Couvreur, Poly(alkyl cyanoacrylate) nanospheres for oral administration of insulin, Journal of pharmaceutical sciences, 86 (1997) 1403-1409. [21] M. Sharma, V. Sharma, A.K. Panda, D.K. Majumdar, Development of enteric submicron particle formulation of papain for oral delivery, International journal of nanomedicine, 6 (2011) 2097-2111. [22] A. Farhadian, N.M. Dounighi, M. Avadi, Enteric trimethyl chitosan nanoparticles containing hepatitis B surface antigen for oral delivery, Human vaccines & immunotherapeutics, 11 (2015) 2811-2818. [23] H. Song, X. Lv, J. Yang, W. Liu, H. Yang, T. Xi, Y. Xing, A novel chimeric flagellum fused with the multi-epitope vaccine CTB-UE prevents Helicobacter pylori-induced gastric cancer in a BALB/c mouse model, Applied microbiology and biotechnology, 99 (2015) 9495-9502. [24] Z. Fang, S. Chen, J. Qin, B. Chen, G. Ni, Z. Chen, J. Zhou, Z. Li, Y. Ning, C. Wu, L. Zhou, Pluronic P85-coated poly(butylcyanoacrylate) nanoparticles overcome phenytoin resistance in P-glycoprotein overexpressing rats with lithium-pilocarpine-induced chronic temporal lobe epilepsy, Biomaterials, 97 (2016) 110-121. [25] T. Bosma, R. Kanninga, J. Neef, S.A. Audouy, M.L. van Roosmalen, A. Steen, G. Buist, J. Kok, O.P. Kuipers, G. Robillard, K. Leenhouts, Novel surface display system for proteins on non-genetically modified gram-positive bacteria, Applied and environmental microbiology, 72 (2006) 880-889. [26] A. Lee, J. O'Rourke, M.C. De Ungria, B. Robertson, G. Daskalopoulos, M.F. Dixon, A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain, Gastroenterology, 112 (1997) 1386-1397. [27] L. Guo, X. Li, F. Tang, Y. He, Y. Xing, X. Deng, T. Xi, Immunological features and the ability of inhibitory effects on enzymatic activity of an epitope vaccine composed of cholera toxin B subunit and B cell epitope from Helicobacter pylori urease A subunit, Applied microbiology and biotechnology, 93 (2012) 1937-1945. [28] L. Guo, K. Liu, W. Zhao, X. Li, T. Li, F. Tang, R. Zhang, W. Wu, T. Xi, Immunological features and efficacy of the reconstructed epitope vaccine CtUBE against Helicobacter pylori infection in BALB/c mice model, Applied microbiology and biotechnology, 97 (2013) 2367-2378. [29] L. Guo, R. Yin, K. Liu, X. Lv, Y. Li, X. Duan, Y. Chu, T. Xi, Y. Xing, Immunological features and efficacy of a multi-epitope vaccine CTB-UE against H. pylori in BALB/c mice model, Applied microbiology and biotechnology, 98 (2014) 3495-3507. [30] R.L. Ferrero, J.M. Thiberge, M. Huerre, A. Labigne, Immune responses of specific-pathogen-free mice to chronic Helicobacter pylori (strain SS1) infection, Infection and immunity, 66 (1998) 1349-1355. [31] W. Liu, Z. Tan, H. Liu, Z. Zeng, S. Luo, H. Yang, L. Zheng, T. Xi, Y. Xing, Nongenetically modified Lactococcus lactis-adjuvanted vaccination enhanced innate immunity against Helicobacter pylori, Helicobacter, 22 (2017).


Page 13 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


[32] A. Gamvrellis, D. Leong, J.C. Hanley, S.D. Xiang, P. Mottram, M. Plebanski, Vaccines that facilitate antigen entry into dendritic cells, Immunology and cell biology, 82 (2004) 506-516. [33] P. Sutton, S.J. Danon, M. Walker, L.J. Thompson, J. Wilson, T. Kosaka, A. Lee, Post-immunisation gastritis and Helicobacter infection in the mouse: a long term study, Gut, 49 (2001) 467-473. [34] E.S. DeLyria, R.W. Redline, T.G. Blanchard, Vaccination of mice against H pylori induces a strong Th-17 response and immunity that is neutrophil dependent, Gastroenterology, 136 (2009) 247-256. [35] P.L. Ogra, H. Faden, R.C. Welliver, Vaccination strategies for mucosal immune responses, Clinical microbiology reviews, 14 (2001) 430-445. [36] B. Singh, S. Maharjan, T. Jiang, S.K. Kang, Y.J. Choi, C.S. Cho, Attuning hydroxypropyl methylcellulose phthalate to oral delivery vehicle for effective and selective delivery of protein vaccine in ileum, Biomaterials, 59 (2015) 144-159. [37] A.K. Jain, A.K. Goyal, N. Mishra, B. Vaidya, S. Mangal, S.P. Vyas, PEG-PLA-PEG block copolymeric nanoparticles for oral immunization against hepatitis B, International journal of pharmaceutics, 387 (2010) 253-262. [38] H. Harde, A.K. Agrawal, S. Jain, Development of stabilized glucomannosylated chitosan nanoparticles using tandem crosslinking method for oral vaccine delivery, Nanomedicine, 9 (2014) 2511-2529. [39] P. Gao, G. Xia, Z. Bao, C. Feng, X. Cheng, M. Kong, Y. Liu, X. Chen, Chitosan based nanoparticles as protein carriers for efficient oral antigen delivery, International journal of biological macromolecules, 91 (2016) 716-723. [40] M.M. D'Elios, S.J. Czinn, Immunity, inflammation, and vaccines for Helicobacter pylori, Helicobacter, 19 Suppl 1 (2014) 19-26. [41] W. He, X. Jiang, Z.R. Zhang, Preparation and evaluation of poly-butylcyanoacrylate nanoparticles for oral delivery of thymopentin, Journal of pharmaceutical sciences, 97 (2008) 2250-2259. [42] P. Girotra, S.K. Singh, A Comparative Study of Orally Delivered PBCA and ApoE Coupled BSA Nanoparticles for Brain Targeting of Sumatriptan Succinate in Therapeutic Management of Migraine, Pharmaceutical research, 33 (2016) 1682-1695. [43] M. Shakweh, M. Besnard, V. Nicolas, E. Fattal, Poly (lactide-co-glycolide) particles of different physicochemical properties and their uptake by peyer's patches in mice, European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 61 (2005) 1-13. [44] R. Sharma, U. Agrawal, N. Mody, S.P. Vyas, Polymer nanotechnology based approaches in mucosal vaccine delivery: challenges and opportunities, Biotechnology advances, 33 (2015) 64-79. [45] T.H. Ermak, P.J. Giannasca, R. Nichols, G.A. Myers, J. Nedrud, R. Weltzin, C.K. Lee, H. Kleanthous, T.P. Monath, Immunization of mice with urease vaccine affords protection against Helicobacter pylori infection in the absence of antibodies and is mediated by MHC class II-restricted responses, The Journal of experimental medicine, 188 (1998) 2277-2288. [46] A. Muller, J.V. Solnick, Inflammation, immunity, and vaccine development for Helicobacter pylori, Helicobacter, 16 Suppl 1 (2011) 26-32. [47] D. Velin, K. Straubinger, M. Gerhard, Inflammation, immunity, and vaccines for Helicobacter pylori infection, Helicobacter, 21 Suppl 1 (2016) 26-29. [48] A. Amedei, F. Munari, C.D. Bella, E. Niccolai, M. Benagiano, L. Bencini, F. Cianchi, M. Farsi, G. Emmi, G. Zanotti, M. de Bernard, M. Kundu, M.M. D'Elios, Helicobacter pylori secreted peptidyl prolyl cis, trans-isomerase drives Th17 inflammation in gastric adenocarcinoma, Internal and emergency



medicine, 9 (2014) 303-309. [49] D. Velin, L. Favre, E. Bernasconi, D. Bachmann, C. Pythoud, E. Saiji, H. Bouzourene, P. Michetti, Interleukin-17 is a critical mediator of vaccine-induced reduction of Helicobacter infection in the mouse model, Gastroenterology, 136 (2009) 2237-2246 e2231. [50] O. Soehnlein, S. Steffens, A. Hidalgo, C. Weber, Neutrophils as protagonists and targets in chronic inflammation, Nature reviews. Immunology, 17 (2017) 248-261. [51] P.K. Giri, G.K. Khuller, Is intranasal vaccination a feasible solution for tuberculosis?, Expert review of vaccines, 7 (2008) 1341-1356. [52] H.F. Florindo, S. Pandit, L. Lacerda, L.M. Goncalves, H.O. Alpar, A.J. Almeida, The enhancement of the immune response against S. equi antigens through the intranasal administration of poly-epsilon-caprolactone-based nanoparticles, Biomaterials, 30 (2009) 879-891. [53] S. Chadwick, C. Kriegel, M. Amiji, Nanotechnology solutions for mucosal immunization, Advanced drug delivery reviews, 62 (2010) 394-407.

Figure Captions Figure 1. Characterization of different nanoparticles. (A) Transmission electron micrograph of HP55/PBCA-CCF NPs. (B) The amount of CCF encapsulated in different nanoparticles was analyzed using SDS-PAGE. (C) In vitro antigen cumulative release from different formulations when incubated in SGF (pH 1.2, pepsin) and SIF (pH 7.4, pancreatin) at predetermined time, CCF stander was totally degraded at 0.5 h in SGF and at 1 h in SIF. Data were expressed as mean ± SD (n = 3). (D) The amount of CCF released from different formulations when incubated in SGF and SIF at predetermined time was analyzed using SDS-PAGE.


Page 14 of 21

Page 15 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Biocompatibility assessment and in vivo biodistribution of HP55/PBCA NPs. (A and B) In vitro cytotoxicity study from different concentrations of HP55/PBCA-CCF NPs (Determined by the encapsulated amount of antigen CCF) after 24 h. Data were expressed as mean ± SD (n = 5). p < 0.05 was considered statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001, NS: not significant (one-way ANOVA). (C and D) In vivo fluorescence imaging of CCF-FITC and HP55/PBCA-CCF-FITC NPs in gastrointestinal (GI) tract at predetermined time after oral administration.




Page 16 of 21

Page 17 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. The schedule of animal experiments and the levels of systematic antigen-specific antibodies in immunized mice. (A) Timeline for challenge, immunization and sampling. (B) Serum IgG, IgA and IgM against native H. pylori urease were examined on the day 29 and day 43. Data were expressed as mean ± SD (n = 5-8). p < 0.05 was considered statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA)



Figure 4. Assessment of antigen-specific serum IgG subtypes and splenic cytokines levels. (A) IgG subclass distribution. (B) The ratio of IgG2a/IgG1. (C and D) The levels of IFN-γ and IL-17 were detected by stimulation of splenic lymphocytes in vitro. Data were expressed as mean ± SD (n = 5-8). p < 0.05 was considered statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA)


Page 18 of 21

Page 19 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Vaccination of mice with HP55/PBCA-CCF NPs induced a Th1/Th17 response. (A and B) The proportions of IFN-γ and IL-17 producing CD4+ cells in MLN were analyzed by flow cytometry. (C, D and E) The mRNA levels of IFN-γ, IL-17 and CXCL1 in gastric tissues were determined by qRT-PCR. (F) Representative plots and gating schemes for positive cells of IFN-γ and IL-17 in MLN. Data were expressed as mean ± SD (n = 5-8). p < 0.05 was considered statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA)



Figure 6. Local mucosal sIgA and the infiltration of lymphocytes in gastric mucosa reduce H. pylori colonization in immunized mice. (A) The level of Serum IgA in the gastric tissue. (B) Gastric H. pylori colonization was determined by quantitative culture. (C, D and E) The proportions of leukocytes (CD45+), T-helper cells (CD4+) and neutrophils (Ly6G+) were detected in the gastric mucosa by flow cytometry. (F) Representative plots and gating schemes for gastric immune cells. Data were expressed as mean ± SD (n = 5-8). p < 0.05 was considered statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA)


Page 20 of 21

Page 21 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1 The sequences of primers in qRT-PCR. Genes

Forward primer

Reverse primer

GAPDH IL-17 IFN-γ CXCL1

GGGGGTAGGAACACGGAA CAGCTTTCCCTCCGCATT GGACCTGTGGGTTGTTGA CGCTGGCTTCTGACAACACTA

AAGGGTGGAGCCAAAAGG ACTACCTCAACCGTTCCAC CTTGGCTTTGCAGCTCTT TCGCACAACACCCTTCTACTA

Table 2 The average particle size and encapsulation efficiency (EE) of different nanoparticles. Nanoparticles HP55/PBCA- NPs PBCA-CCF NPs HP55/PBCA-CCF NPs

Average particle size ± SD

187.7±7.9 168.4±6.8 218.6±4.7

Polydispersity ± SD

EE (%)

0.122±0.031 0.202±0.096 0.158±0.061

-49.74 55.04


Promoting immune efficacy of oral Helicobacter pylori vaccine by

Recommend Documents