ProteinâProtein Interactions: Inhibition of Mammalian Carbonic

Subscriber access provided by George Mason University Libraries & VIVA (Virtual Library of Virginia)

Article

Protein-protein interactions: Inhibition of mammalian carbonic anhydrases I-XV by the murine inhibitor of carbonic anhydrase and other members of the transferrin family S. Durdagi, Daniela Vullo, Peiwen Pan, Niklas Kahkonen, Juha Määttä, Vesa Hytonen, Andrea Scozzafava, Seppo Parkkila, and Claudiu T Supuran J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/jm3004587 • Publication Date (Web): 11 May 2012 Downloaded from http://pubs.acs.org on May 14, 2012

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Protein-protein interactions: Inhibition of mammalian carbonic anhydrases I-XV by the murine inhibitor of carbonic anhydrase and other members of the transferrin family Serdar Durdagi,a Daniela Vullo,b Peiwen Pan,c Niklas Kähkönen c, Juha A. Määttä,c Vesa P. Hytönen,c Andrea Scozzafava, b Seppo Parkkila,c and Claudiu T. Supuranb,d*

a

University of Calgary, Department of Biological Sciences, Institute for Biocomplexity and Informatics, 2500 University Drive, T2N 1N4, Calgary, AB, Canada. b

Università degli Studi di Firenze, Polo Scientifico, Laboratorio di Chimica Bioinorganica, Rm. 188, Via della Lastruccia 3, 50019 Sesto Fiorentino, Florence, Italy.

c

Institute of Biomedical Technology, Fimlab Ltd, School of Medicine (S. P.) and BioMediTech, University of Tampere and Tampere University Hospital, Biokatu, 33520 Tampere, Finland.

d Università degli Studi di Firenze, Dipartimento di Scienze Farmaceutiche, Via Ugo Schiff 6, 50019 Sesto Fiorentino, Florence, Italy.

Abstract. The murine inhibitor of carbonic anhydrase (mICA), a member of the transferrin (TF) superfamily of proteins, together with human holo- and apoTF as well as lactoferrin (LF) were assessed as inhibitors of all catalytically active mammalian (h=human, m=murine) CA isoforms, from CA I to CA XV. mICA was a low nanomolar-subnanomolar inhibitor of hCA I, II, III, VA, VB, VII and mCA XV (KIs of 0.7 – 44.0 nM) and inhibited the remaining isoforms with KIs of 185.5 – 469 nM. hTF, apoTF and hLF were inhibitors of most of these CAs but with reduced efficiency compared to mICA (KIs of 18.9 – 453.8 nM). Biacore surface plasmon resonance and differential scanning calorimetry experiments were also used for obtaining more insights in the interaction between these proteins, which may be useful for the drug design of protein-based CA inhibitors.

______ *Correspondence

authors.

Tel:

+39-055-457

3005;

Fax:

+39-055-4573385;

E-mail:

[email protected] (CTS).

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

Abbreviations: CA, carbonic anhydrase; CAI, CA inhibitor; DSC, differential scanning calorimetry; mICA, murine inhibitor of CA; apoTF, apo-transferrin; holoTF, holo transferrin; LF, lactoferrin; TF, transferrin.


2

Page 3 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction

The transferrin (TF) superfamily of proteins is mainly involved in the transport and delivery of iron to cells and other body fluids such as the milk in mammals, or the egg white in birds. The numerous members belonging to it are present in organisms spanning from invertebrates to vertebrates.1-3 Iron metabolism and transport are tightly regulated processes as this metal ion (both oxidation numbers 2 and 3; i.e. Fe(II) and Fe(III)) is essential in many life processes but it is also toxic due to the possibility to generate free radicals through the Fenton reaction.3,4 The TF family includes (at least in vertebrates) serum TF,1-3 lactoferrin (LF),5 ovotransferrin (OTF),2,6 melanotransferrin (MTF)2,6 as well as proteins which are “TF-like”, such as saxiphillin, a protein binding with high affinity the frog skin toxin saxitoxin and the protein inhibitor of carbonic anhydrase (ICA), isolated and characterized from pig plasma (pICA) by Fierke’s group.7,8 The murine variant of pICA, mICA, was discovered later and characterized by Mason et al..9-11 TFs and TF-like proteins are 80 kDa bilobal glycoproteins, arising from a gene duplication and fusion event which gave rise to two homologous lobes, termed the N- and Clobes.1-3 Each lobe contains two subdomains, denominated N1/N2, and C1/C2, respectively, which form a cleft in which one Fe(III) ion is octahedrally coordinated to the side chains of two Tyr, one His, one Asp residues as well as a bicarbonate ion (acting as a bidentate ligand). 1-3,11 The metal ion and its companion counterion (bicarbonate or oxalate) are tightly bound to the protein, with a dissociation constant as low as Kd = 10-22 M for some members of the TF family.1-3,11 Other metal ions, such as Ga(III), Al(III), Co(III), Cu(II), Pt(II), In(III), etc., may also bind within the iron binding site in apo-TF and related proteins. 1-3 The carbonic anhydrases (CAs, EC 4.2.1.1) are metalloenzymes found in organisms all over the tree of life, including prokaryotes and eukaryotes.12-15 In vertebrates, 16 zinc-containing CAs belonging to the α-CA class have been characterized to date, many of which are involved in critical physiologic and pathologic processes.12-15 They catalyze the simple reaction between carbon dioxide and water with generation of bicarbonate and protons: CO2+H2O ⇔H++HCO3-.1215

In humans, CAs are present in a large variety of tissues including the gastrointestinal and

reproductive tracts, central nervous system, kidney, lung, skin and eye.14 The different isozymes are localized in different parts of the cell with CA I, CA II, CA III, CA VII and CA XIII being found in the cytosol,14 two isoforms (CA VA and VB) present in mitochondria and one isoform


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 23

(CA VI) secreted in saliva and milk.12-16 Many of the CAs are important therapeutic targets with the potential to be inhibited for treating a range of disorders.12-16 CA II plays a role in bicarbonate production in the eye and is therefore a target for the therapy of glaucoma.12 CA inhibitors (CAIs) of the sulfonamide type are widely used in glaucoma therapy.12 Several other CA isoforms, such as CA IV, IX, XII, XIV and XV are either associated through phosphoinositol glycan anchors to the plasma membranes (CA IV and XV) or are transmembrane proteins with extracellular active sites (CA IX, XII and XIV).12-17 CA IX and CA XII are both extracellularly localized mainly on hypoxic tumor cells,14-17 where they play various roles in tumorigenesis, by regulating pH inside and outside the tumor cell,15 interfering with phosphorylation processes or by playing a role in the cell-cell adhesion.15,18 Therefore, they provide a target for cancer therapy because of their relative specificity to the hypoxic tumor cells, being important for their survival and proliferation in the acidic/hypoxic environment characteristic of many solid tumors.15 Indeed, several antibodies targeting CA IX are in Phase III clinical development for the treatment of solid tumors (or for their imaging), while some small molecule inhibitors are also in advanced (pre)clinical evaluation.18,19 Antibodies against CA XII were also reported, which inhibit the catalytic activity of the enzyme and show anticancer effects.20 Whitesides’ group recently investigated synthetic dimeric CAs as models with which to study the interaction of bivalent proteins with their ligands, such as immunoglobulins, presented at the surface of mixed self-assembled monolayers21 or a bivalent ligand-bivalent receptor model system, based again on dimeric CAs and bivalent inhibitors of the sulfonamide type.22 All these data show that protein-protein interactions are a hot topic in the CA research area. In this paper, we investigated the interaction of all catalytically active mammalian CA isoforms, CA I – CA XV, with mICA and other proteins belonging to the TF family, i.e., human (h) TF, in its apo- (apoTF) and holo- (hTF) forms, as well as lactoferrin (LF). Solution studies allowed us to evidence a potent inhibition of many CA isoforms by several of the TF protein family members. We also used biosensor assays to investigate the binding of mICA and trasnferrin to selected CAs.

Results and Discussion


4

Page 5 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CA inhibition by mICA, TF and LF. Plasma inhibitors of carbonic anhydrase (ICA) were reported in the blood of several mammals as early as 1938,23 but they were not found in the blood of primates.7-10,23 It has recently been reported that the ICA gene is a pseudogene in the genomes of primates, including humans.11 On the other hand, CAs, mainly as isoforms CA I and II, are highly abundant in the red blood cells of mammals (including humans), with a total concentration as high as 0.2 mM.24 It is thus not surprising that an endogenous inhibitor of these enzymes is also present in the plasma of many mammals, which may have the function to bind CA isozymes, eventually released from erythrocytes into the blood circulation by intravascular haemolysis, as proposed by Ridderstale et al.24 for the pICA. The CA-pICA complex in plasma may then be transported to the reticuloendothelial system, for degradation and recycling of the zinc present in the enzyme, which is similar to the fate of the hemoglobin-haptoglobin complex, for the recycling of iron.24 Indeed, these researchers found pICA in liver sinusoids and kidney glomeruli, where phagocytic cells (Kupffer and mesangial cells) are located, but the protein was not present inside parenchymal cells, or in tissues from striated muscle, heart, eye or lung.

24

Thus, the physiological function of this member of the TF family is not yet completely elucidated. Fierke’s group also investigated inhibition of isoforms CA I, II, III and IV with pICA initially isolated from the pig blood,7 and subsequently cloned.8 They found the inhibition constants in the range of 1 nM (against hCA II) to 50 µM (against hCA I). Mason’s group who reported the murine protein, mICA, also investigated its inhibitory activity (by a CO2 hydrase assay9 and an esterase assay with 4-nitrophenyl acetate as substrate),10 observing a strong such inhibitory activity against bovine CA II (the only isoform investigated) but no quantitative inhibition data were provided. Recently, the same group reported in an excellent study the X-ray crystallographic structure of mICA, which surprisingly, is highly similar to the 3D structure of diferric TF, although mICA does not bind metal ions.11 Indeed, as all members of the TF family, mICA was observed to be a bilobal protein with two α-β domains per lobe. 11 The structure also includes the unusual reverse γ-turn in each lobe,11 being consistent with the fact that introduction of two mutations in the N-lobe of mICA (i.e., W124R and S188Y) restores the binding of iron ions with high affinity.10 Fierke’s group already reported earlier7,8 that the C-lobe seems to be the region of pICA responsible for the interaction with CAs. Considering the fact that the mICA inhibition data


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 23

against mammalian CAs are incomplete, we investigate here the interaction of recombinant mICA with all 13 catalytically active mammalian CA isoforms, i.e., CA I, II, III, IV, VA, VB, VI, VII, IX, XII, XIII, XIV and XV (of human, (h) or murine (m) origin). Three of the CA isoforms, i.e., CA VIII, X and XI are acatalytic, as they lack one or more His residues acting as zinc ligands,25 and these proteins were not included in our study. On the other hand, we included in the study other TF family proteins, such as hTF (diferric enzyme), apoTF (no metal ions contained in the protein) as well as LF, since the recent structural determination of mICA,11 as stressed above, showed it to be highly similar to diferric TF, and the interaction of these proteins with CAs have never been investigated so far. Table 1 here Data of Table 1 show that mICA, hTF, apoTF and hLF show significant inhibitory activities against h/mCA isoforms I-XV, as measured by a stopped-flow CO2 hydrase assay, monitoring the physiologic reaction catalyzed by these enzymes, at pH 7.4 and 20 °C.26 From these data, it can be noted that mICA was a low nanomolar – subnanomolar inhibitor of hCA I, hCA II, hCA VII and mCA XV, with inhibition constants in the range of 0.7 – 3.8 nM. Isoforms hCA III, VA and VB were also effectively inhibited, with KIs in the range of 22.9 – 44.0 nM, whereas for all the remaining isoforms KIs in the range of 185.5 – 469.0 nM were measured (Table 1). No species related effects were observed (as also reported by Fierke’s group for pICA),7 since the human and murine CA XIII were inhibited with identical KIs by mICA. However, significant differences between the various isoforms were identified, as stressed above. Indeed, the ratio between the most inhibited isoform by mICA (CA XV) and the least inhibited one (CA VI) was of 670. hTF was also an effective CA inhibitor (CAI), although slightly less, when compared to mICA. Intuitively, this is a very unexpected finding, but considering the degree of similarity between the 3D structures of the two proteins, this is after all not so unexpected. KIs in the range of 18.9 – 465.5 nM against the various CA isoforms were measured for hTF (Table 1). The most inhibited CAs were the cytosolic hCA I and II (KIs of 18.9 – 31.6 nM) whereas the remaining isoforms showed a rather compact behaviour of medium inhibition, with variations of the inhibition constants in the range of 216.4 – 465.5 nM. A rather similar inhibition pattern was observed for apoTF, with the same two isoforms, hCA I and II, being effectively inhibited in the low nanomolar range (KIs of 26.6 – 34.3 nM) whereas the remaining ones (CA III – XV) being


6

Page 7 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


less sensitive to this protein inhibitor (KIs in the range of 184.4 – 343.6 nM were measured, Table 1). For many isoforms, such as hCA II, III, IV, VA, VI, IX, XII, XIII, and mCA XIII, apoTF was a better inhibitor compared to the corresponding metalloprotein with two Fe3+ ions bound to it (hTF), but the differences are not significant except hCA VI for which apoTF was a 2.5-fold stronger inhibitor compared to hTF (Table 1). hLF showed a distinct inhibition pattern against the mammalian CA isoforms compared to mICA or apo/holo-TFs (Table 1). Indeed, hCA IV and hCA XIV were not significantly inhibited with hLF concentrations up to 1 µM, and even at 10 µM concentrations, inhibitions of only 30-40 % were observed (data not shown). In contrast, a rather large number of isoforms, such as hCA I, hCA II, hCA VA, hCA VII and hCA XII were effectively inhibited by hLF, with KIs in the range of 40.1 – 48.2 nM (a very narrow spread of the inhibition constants, when compared to the one observed for mICA against the highly inhibited isoforms, i.e., mCA XV, hCA I, II, VA and VII, discussed above). Against isoforms hCA III, hCA VB, hCA VI, hCA IX, hCA XIII and mCA XV, hLF acted as a medium potency inhibitor, with KIs in the range of 206.8 – 453.8 nM (Table 1). Apart from the rather unexpected finding that the highly abundant proteins, TF and LF, show such a potent activity against various CAs, it is very surprising that the different isoforms have such a particular inhibition pattern with these proteins. In fact, as observed just for LF, the last case discussed here, irrespective of the subcellular localization of the CA isoforms (e.g., CA II cytosolic, CA VA mitochondrial, CA XII transmembrane, extracellular active site), the inhibition observed with LF is quite similar. On the other hand, two transmembrane isoforms sharing a high degree of homology, i.e., CA XII and CA XIV,27,28 have a very different inhibition pattern with LF: CA XII is potently inhibited, whereas CA XIV is not inhibited significantly even at concentrations as high as 10 µM. All these data probably mean that the interaction between the two proteins, i.e., the enzyme and its protein inhibitor (which is more than two times bigger compared to the enzyme) is very much dependent of all amino acid residues found at the interface between them. Various trials to co-crystallize different CA isoforms (e.g., CA I, II, VII, XIII)29,30 with mICA were unfortunately not successful for obtaining high quality crystals for X-ray crystallography. Figs. 1and 2 here


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 23

Biosensor analyses. We used two biosensor methods to characterize the interactions between carbonic anhydrases and their potential binding partners. Biacore surface plasmon resonance instrument was used to measure the binding affinity utilizing biosensor functionalized with mICA or transferrin. We observed tight binding of hCA II (apparent Kd = 9 nM) and hCA VI (apparent Kd = 171 nM; Figure 1A) to mICA chip. In contrast, the other hCAs (hCA I, hCA IX, hCA XII, hCA XIII) showed no signs of binding when protein concentration up to 5-15 µM was applied on the chip except hCA III, which showed much weaker binding compared to hCA II and hCA VI (Figure 1B). Of those, hCA IX and hCA XII showed clear signs of nonspecific binding while they did not bind to the mICA-functionalized surface. hCA VII showed highly atypical binding curve, which was most probably due to nonspecific binding to the sensor chip (data not shown). The discrepancy between the kinetic inhibition data and the Biacore data may be due to the fact that the functionalization of the proteins for their immobilization on the chips may have affected the part of these molecule(s) involved in the interaction between the two proteins. Experiments with holo-transferrin-functionalized surface showed no clear signs of interaction (hCA I, hCA II, hCA III, hCA VI, hCA VII, hCA XII studied). Since the transferrin immobilization had to be carried in quite acidic conditions, we carried a control experiment with anti-transferrin. The antibody showed strong binding to the biosensor surface (Figure 1C). hCA II was selected for another set of experiments where streptavidin-biotin interaction was used for the immobilization of hCA II on the Fortebio Octet RED384 sensor tip. The immobilization of biotinylated hCA II resulted in clear binding signal of 0.9 nm. The sensor was then subjected to samples of mICA, apo-transferrin and holo-transferrin. Of those, only mICA showed binding to the sensor with an apparent Kd of 3.2±0.7 x 10–8 M (Figure 2). These findings were in reasonable agreement with the results obtained with Biacore: Only mICA shows tight interaction with hCA II, whereas transferrin binding was not obtained in this concentration range. Additional experiments performed using 10 µM transferrin did not reveal any significant difference to that seen with 1 µM transferrin (data not shown). Figure 2 here


8

Page 9 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CAs varied in their temperature transition midpoints as determined by differential scanning calorimetry (DSC), Table 2. Tm for the least stable hCA VII was 41.2 °C and for the most stable hCA III 53.3 °C. Interestingly, the thermal unfolding of hCA III was biphasic (Supplemental Fig. 2), the more stable part of the transition being close to the previously reported Tm value of hCA II (56.5 °C),31 mICA was more stable than any of CA proteins having Tm value at 62.5 °C. Table 2 here

Conclusions

Protein-protein interactions are essential in many biological processes and the design of pharmacological agents based on such approaches has made important progress in the last period.32 mICA, a member of the TF superfamily of proteins, together with human holo- and apoTF as well as LF were assessed here as inhibitors of all catalytically active mammalian CA isoforms, CA I- CA XV, some of which are established drug targets for several pharmacologic applications (antiglaucoma, antiobesity, antiepileptic and antitumor agents, among others).12-16 mICA was a low nanomolar-subnanomolar inhibitor of several isoforms, i.e., hCA I, II, III, VA, VB, VII and mCA XV (KIs of 0.7 – 44.0 nM) and inhibited the remaining ones with KIs of 185.5 – 469 nM. hTF, apoTF and hLF were also inhibitors of most of these CAs but with a reduced efficiency compared to mICA (KIs in the range of 18.9 – 453,8 nM). Biacore surface plasmon resonance and differential scanning calorimetry experiments were also used for obtaining more insights in the interaction between these proteins, which may be useful for the drug design of protein-based CA inhibitors. This is a particularly dynamic research field, with several antibodies targeting various CA isoforms in advanced clinical trials as antitumor drugs.15,33

Experimental Section

Reagents. Recombinant mICA was prepared as described below, whereas hTF, apoTF and hLF were from Sigma-Aldrich (Milan, Italy). All CA isoforms were recombinant ones obtained inhouse as described earlier.18-20,29,30 Expression and purification of mICA using insect cell-baculovirus system


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 23

The expression of mICA was performed using Bac-to-Bac baculorvirus expression system (Invitrogen) according to the manufacturer´s instruction. A full-length cDNA encoding mICA was amplified by PCR using the mouse cDNA clone (I.M.A.G.E Consortium, clone ID 5175251, MRC Geneservice, Cambridge, U.K.) as a template and a synthetic primer set mICAF (5´GGCCAGATCTATGAGGCTGCTCATCTGCGCCCT-3´)

and

mICAR

(5´-

CGCCGTCGACTTAATGGTGGTGATGGTGGTGGGAACCACGGGGCACCAGATATT TATGAAATGTGCAGGCA-3´) (Biomers) that incorporated desired restriction sites, BglII and SalI (underlined), at the 5´-ends, respectively. In addition, a thrombin protease site plus a hexahistidine tag (bolded sequence) were integrated into the C-terminus of the coding sequence to produce a fusion protein. The obtained PCR product was digested and directionally ligated to BamHI/SalI digested expression vector pFastBac1. The ligated plasmid was transformed into E. coli TOP10 competent cells and the nucleotide sequence of mICA gene was verified by DNA sequencing. The recombinant pFastBac1-mICA plasmid was then used to tranform E. coli DH10Bac competent cells for transposition into the bacmid. The successful transposition was confirmed by blue/white screening and the recombinant bacmid DNA was isolated using the PureLinkTM HiPure Plasmid purification kit (Invitrogen). PCR analysis using the recombinant bacmid

as

template

source

and

CCCAGTCACGACGTTGTAAAACG-3´)

the

primers and

M13/pUC

forward

reverse

(5´(5´-

AGCGGATAACAATTTCACACAGG-3´) amplification primer was performed to verify once more successful transposition to the bacmid. The recombinant baculovirus harboring the mICA gene was produced by transfecting the recombinant bacmid DNA to Spodoptera frugiperdaderived Sf9 cells using CellFECTIN Reagent (Invitrogen) as described by the manufacturer. To purify the recombinant mICA, 400 mL of Sf9 cells (2x106/mL) grown in HyQ SFX-Insect serum-free cell culture medium (HyClone, Logan, UT) in a 2 L flask shaken at 125 rpm at 27°C were inoculated with 4 mL of the recombinant mICA baculovirus. At 72 h post-infection, the cells were collected by centrifugation (2000 g, 5 min, 20°C) and the supernatant was transferred to a 2 L beaker. The binding and purification of mICA were performed using Probond Purification System (Invitrogen) as described by Hilvo et.al.30 After purification, mICA was buffer-changed to 50 mM Tris-Cl (pH 7.5) using an Amicon Ultra 30-KDa cut-off centrifugal filter device (Millipore). To remove the His-tag from recombinant mICA, 1 mg protein was treated with 100 µL thrombin from Thrombin Cleancleave KIT (Sigma) with shaking at room


10

Page 11 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


temperature overnight. Supplemental Figure 1 shows that the recombinant mICA, comprising the full-length mICA plus the thrombin site and hexahistidine tag, was around 75 KDa in size. CA inhibition. An Applied Photophysics stopped-flow instrument has been used for assaying the CA catalysed CO2 hydration activity. Phenol red (at a concentration of 0.2 mM) has been used as indicator, working at the absorbance maximum of 557 nm, with 20 mM Hepes (pH 7.4) as buffer, and 20 mM Na2SO4 (for maintaining constant the ionic strength), following the initial rates of the CA-catalyzed CO2 hydration reaction for a period of 10-100 s.26 The CO2 concentrations ranged from 1.7 to 17 mM for the determination of the kinetic parameters and inhibition constants. For each inhibitor at least six traces of the initial 5-10% of the reaction have been used for determining the initial velocity. The uncatalyzed rates were determined in the same manner and subtracted from the total observed rates. Stock solutions of inhibitory protein (10 µM) were prepared in distilled-deionized water and dilutions up to 0.001 nM were done thereafter with distilled-deionized water. Inhibitor and enzyme solutions were preincubated together for 15 min at room temperature prior to assay, in order to allow for the formation of the E-I complex (the proteins were incubated also for longer periods, of 1-24 h, but no differences of activity have been detected). The inhibition constants were obtained by non-linear least-squares methods using PRISM 3, as reported earlier,18-20 and represent the mean from at least three different determinations. All CA isoforms were recombinant ones obtained in house as reported earlier. 18-20,29,30 Surface plasmon resonance. To study the interaction between mICA, transferrin and human carbonic anhydrases (hCAs), a BIAcore X optical biosensor (Biacore, Uppsala, Sweden) was used. mICA or transferrin was covalently coupled to the carboxymethylated dextran layer of a CM5 sensor chip using standard amine coupling chemistry as follows: the dextran matrix on the sensor chip surface was first activated with a mixture containing 0.2 M 1-ethyl-3-(3dimethylaminopropyl) carbodiimide hydrochloride (EDC) and 0.05 M N-hydroxysuccinimide (NHS) in water. Then, 30 µL of mICA (100 µg/ml) in 50 mM MES buffer (pH 5.0) was injected (5 µL/min flow rate) on the sensor surface for immobilization. Alternatively, 100 µg/ml holotransferrin (Sigma-Aldrich, St. Louis, MO, USA, cat. no. 040M1891) was injected in ~56 mM acetic acid (pH 3.1, adjusted with NaOH). After the quenching of the remaining activated groups by 1 M ethanolamine-HCl, 2120 RU of immobilized protein in was detected in the case of mICA


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 23

and 2485 RU in the case of transferrin. Only channel 2 was activated and the nonactivated channel 1 was used as a reference sensor. The reference signal measured was subtracted from all the data. Samples of human CAs I, II, III, VI, VII, IX, XII, and XIII were diluted to final concentration of 0-10 µM in PBS, which was also used as a running buffer in the measurements. The binding of hCAs to sensor surface was studied by injecting the samples on the sensor chip at the flow rate of 20 µL/min for 3 min. A delayed wash (200 sec) was then applied after the injection to follow the dissociation process. After that, the chip was regenerated by injecting (20 µL/min) 60 µL of 50 mM Na-acetate (pH 4.0) containing 650 mM NaCl, followed by equilibration to the running buffer. In the case of transferrin chip, only one protein concentration was studied. To verify the presence of transferrin on the sensor chip, 3 mg/ml transferrin antibody was injected in the buffer supplied by the manufacturer (Abcam, Cambridge, United Kingdom; cat. no. ab9538). The binding constants were determined by using the BiaEvaluation software by using Langmuir 1:1 binding model. First, dissociation rate constant was obtained by averaging the values determined for several measurements in different concentrations. This was then used to determine the association rate constant and dissociation constant. For preparation of the graphs, the data was manually polished by removing the peaks associated with the time delay between measurement channels. This was done after determination of the binding constants to clarify the illustration. The graphs were prepared by MS Excel using data exported from BiaEvaluation program.

Biolayer interferometry. Binding of hCA II to apo- and holo-transferrin and to mICA was analyzed by biolayer interferometry (BLI) using ForteBio Octet RED384 instrument (FortéBio, Menlo Park, CA, USA). The instrument was controlled by using Data Acquisition 7.0 software (FortéBio). Prior to experiment, biotinylated hCA II was prepared by incubating 1 µM hCAII in the presence of 100-fold excess of EZ-Link Sulfo-NHS-SS-Biotin (Thermo Scientific, cat no. 21331) in phosphate buffered saline pH7.4 (PBS; Abcell, Tampere, Finland, cat no. 10XPBS74500). Removal of the excess of EZ-Link Sulfo-NHS-SS-Biotin was done by dialysis with Slide-A-Lyzer MWCO 10 000, 0.5 ml (Thermo Scientific, Waltham, MA, USA). The


12

Page 13 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


biotinylation was verified by dot-blot experiment. Briefly, the biotinylated protein was applied to nitrocellulose and dried, blocked with 1% BSA Tris-buffered saline (4 °C, 1 h). Streptavidin alkaline phosphatase conjugate (Roche Diagnostics GmbH, Mannheim, Germany) diluted 1:10,000 in Tris-buffered saline + 0.02% Tween + 1% BSA was applied. After incubation for one hour, the sheet was washed extensively with in Tris-buffered saline + 0.02% Tween and the detection was done by using a mixture of BCIP and NBT in 100 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2 pH 9.5. The biosensor experiment was carried out as follows: First, baseline for streptavidin-coated biosensors (FortéBio, cat. no. 18-5019) in PBS was recorded for 200 s. Then, biotinylated HCAII was attached to the sensor with 300 s incubation, followed by 200 s wash. This resulted in n instrument response of 0.9 nm. The sensor was then transferred to PBS containing 0.02% Tween20 + 10 mg/ml BSA + 0.05% NaN3, which was used for the interaction analyses. The measurement cycle contained (1) baseline determination for 200 s, (2) incubation in a solution containing apo-TF (Sigma-Aldrich, cat. no. 090M1169) or holo-TF or mICA in various concentrations for 200 s, (3) incubation in measurement buffer for 200 s, and, (4) regeneration of the sensor in 25 mM Na2CO3, 100 mM NaCl, pH 10.8 for 100 s. Protein concentrations in a range of 31-1,000 nM were studied. The activity of the hCA II-activated sensor after the regeneration cycle was proved by control experiment containing several dilutions of mICA. The specificity of the binding of mICA, apo-TF and holo-TF was confirmed by measuring their binding to nonfunctionalized streptavidin biosensors using the highest concentration used in the experiments, which resulted in no binding (data not shown). The measurement parameters were as follows: measurement temperature 30 °C, stirring speed 1000 rpm, distance of the tip from the surface 4 mm, acquisition rate 5.0 Hz, averaging by 20. Black 96-well plates (Greiner Bio-One GmbH, Frickenhausen, Germany; cat. no. 655209) were used for the biosensor analyses, 1:1 Langmuir binding model was fitted to the binding curves by using Data Analysis 7.0 software (FortéBio). Inter-step correction procedure and Savitsky-Golay filtering was applied to the data. For preparation of the graphs, the raw data was exported from the instrument and processed with MS Excel. Differential scanning calorimetry. Thermal stability of different hCA proteins was determined by capillary VP-DSC (GE, MicroCal, Inc. North Hampton, MA, USA) by heating a sample of


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 23

protein from 30 °C to 140 °C with a scan rate of 120 °C/h. Proteins were diluted with 50 mM Na2HPO4, 500 mM NaCl, 250 mM imidazole, pH 8.0 to final concentration of 0.2 mg/ml (5.66 µM – 6.79 µM) and degassed prior to analysis. Temperature transition midpoints (Tm) were determined from baseline-subtracted data by MicroCal Origin 7 software (GE Healtcare, MicroCal, North Hampton, MA, USA) using Levenberg-Marquardt non-linear last-square method. All measurements were done twice and an average of the determined Tm values was reported.

Supporting Information Available: The SDS-PAGE of the purified mICA as well as the thermal unfolding profiles of hCAs and mICA, as determined by differential scanning calorimetry, together with the inhibition curves of all CA isofoms with mICA are provided as supporting material. This material is available free of charge via the Internet at http://pubs.acs.org.

Acknowledgments. This research was financed by an FP7 EU project (Metoxia) to CTS and by grants from the Academy of Finland, Sigrid Jusélius Foundation and Competitive Research Funding of Tampere University Hospital (9N054, 9M019 and X51410) to SP and VPH.

We acknowledge Biocenter

Finland for support. We thank Jenni Leppiniemi, Johanna Lampinen and Laura Kananen for their help in biosensor analyses. We thank Barbara Niederhauser for help in the biotinylation of the proteins. We thank Ulla Kiiskinen for technical support.


14

Page 15 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


References 1. Sheftel, A.D.; Mason, A.B.; Ponka, P. The long history of iron in the Universe and in health and disease. Biochim. Biophys. Acta. 2012, 1820, 161-187. 2. Lambert, L.A.; Perri, H.; Halbrooks, P.J.; Mason, A.B. Evolution of the transferrin family: conservation of residues associated with iron and anion binding. Comp Biochem Physiol B Biochem Mol Biol. 2005, 142, 129-141. 3. Gkouvatsos, K.; Papanikolaou, G.; Pantopoulos, K. regulation of iron trasnport and the role of transferrin. Biochim. Biophys. Acta. 2012, 1820, 188-202. 4. Papanikolaou, G.; Pantopoulos, K. Iron metabolism and toxicity. Toxicol. Appl. Pharmacol. 2005, 202, 199-211. 5. Baker, H.M.; Baker, E.N. Lactoferrin and iron: structural and dynamic aspects of binding and release. Biometals 2004, 17, 209-216. 6. Wally, J.; Halbrooks, P.J.; Vonrhein, C.; Rould, M.A.; Everse, S.J.; Mason, A.B.; Buchanan, S.K. The crystal structure of iron-free human serum transferrin provides insight into inter-lobe communication and receptor binding. J. Biol. Chem. 2006, 281, 24934-2444. 7. Roush, E.D.; Fierke, C.A. Purification and characterization of a carbonic anhydrase II inhibitor from porcine plasma. Biochemistry. 1992, 31, 12536-12542. 8. Wuebbens, M.W.; Roush, E.D.; Decastro, C.M.; Fierke, C.A. Cloning, sequencing, and recombinant expression of the porcine inhibitor of carbonic anhydrase: a novel member of the transferrin family. Biochemistry. 1997, 36, 4327-4336. 9. Wang, F.; Lothrop, A.P.; James, N.G.; Griffiths, T.A.; Lambert, L.A.; Leverence, R.; Kaltashov, I.A.; Andrews, N.C.; MacGillivray, R.T.; Mason, A.B. A novel murine protein with no effect on iron homoeostasis is homologous with transferrin and is the putative inhibitor of carbonic anhydrase. Biochem. J. 2007, 406, 85-95. 10. Mason, A.B.; Judson, G.L.; Bravo, M.C.; Edelstein, A.; Byrne, S.L.; James, N.G.; Roush, E.D.; Fierke, C.A.; Bobst, C.E.; Kaltashov, I.A.; Daughtery, M.A. Evolution reversed: the ability to bind iron restored to the N-lobe of the murine inhibitor of carbonic anhydrase by strategic mutagenesis. Biochemistry 2008, 47, 9847-9855. 11. Eckenroth, B.E.; Mason, A.B.; McDevitt, M.E.; Lambert, L.A.; Everse, S.J. The structure and evolution of the murine inhibitor of carbonic anhydrase: a member of the transferrin superfamily. Protein Sci. 2010, 19, 1616-1626.


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 23

12. Supuran, C.T. Carbonic anhydrases: novel therapeutic applications for inhibitors and activators. Nat. Rev. Drug Discov. 2008, 7, 168-181. 13. Supuran, C.T. Carbonic anhydrase inhibitors. Bioorg. Med. Chem. Lett. 2010, 20, 3467-3474. 14. a) Pastorekova, Parkkila, S.; Pastorek, J.; Supuran, C.T. Carbonic anhydrases: current state of the art, therapeutic applications and future prospects. J. Enzyme Inhib. Med. Chem. 2004, 19, 199-229; b) Supuran, C.T.; Mincione, F.; Scozzafava, A.; Briganti, F.; Mincione, G.; Ilies, M.A. Carbonic anhydrase inhibitors. Part 52. Metal complexes of heterocyclic sulfonamides: A new class of strong topical intraocular pressure-lowering agents with potential use as antiglaucoma drugs. Eur. J. Med. Chem. 1998, 33, 247-254. 15. Neri, D.; Supuran, C.T. Interfering with pH regulation in tumours as a therapeutic strategy. Nat. Rev. Drug Discov. 2011, 10, 767-777. 16. a) Supuran, C.T.; Scozzafava, A.; Casini, A. Carbonic anhydrase inhibitors. Med. Res. Rev. 2003, 23, 146-189; b) Casini, A.; Scozzafava, A.; Mincione, F.; Menabuoni, L.; Ilies, M.A.; Supuran, C.T. Carbonic anhydrase inhibitors: Water soluble 4-sulfamoylphenylthioureas as topical intraocular pressure lowering agents with long lasting effects. J. Med. Chem. 2000, 43, 4884-4892. 17. Alterio, V.; Hilvo, M.; Di Fiore, A.; Supuran, C.T.; Pan, P.; Parkkila, S.; Scaloni, A.; Pastorek, J.; Pastorekova, S.; Pedone, C.; Scozzafava, A.; Monti, S.M.; De Simone, G. Crystal structure of the extracellular catalytic domain of the tumor-associated human carbonic anhydrase IX. Proc. Natl. Acad. Sci. USA, 2009, 106, 16233 – 16238. 18. Lou, Y.; McDonald, P.C.; Oloumi, A.; Chia, S.K.; Ostlund, C.; Ahmadi, A.; Kyle, A.; Auf dem Keller, U.; Leung, S.; Huntsman, D.G.; Clarke, B.; Sutherland, B.W.; Waterhouse, D.; Bally, M.B.; Roskelley, C.D.; Overall, C.M.; Minchinton, A.; Pacchiano, F.; Carta, F.; Scozzafava, A.; Touisni, N.; Winum, J.Y.; Supuran, C.T.; Dedhar, S. Targeting Tumor Hypoxia: Suppression of Breast Tumor Growth and Metastasis by Novel Carbonic Anhydrase IX Inhibitors. Cancer Res. 2011, 71, 3364-3376. 19. Ditte, P.; Dequiedt, F.; Svastova, E.; Hulikova, A.; Ohradanova-Repic, A.; Zatovicova, M.; Csaderova, L.; Kopacek, J.; Supuran, C.T.; Pastorekova, S.; Pastorek, J. Phosphorylation of


16

Page 17 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


carbonic anhydrase IX controls its ability to mediate extracellular acidification in hypoxic tumors. Cancer Res. 2011, 71, 7558-7567. 20. Battke, C.; Kremmer, E.; Mysliwietz, J.; Gondi, G.; Dumitru, C.; Brandau, S.; Lang, S.; Vullo, D.; Supuran, C.; Zeidler, R. Generation and characterization of the first inhibitory antibody targeting tumour-associated carbonic anhydrase XII. Cancer Immunol. Immunother. 2011, 60, 649-658. 21. Mack, E.T.; Snyder, P.W.; Perez-Castillejos, R.; Whitesides, G.M. Using covalent dimers of human carbonic anhydrase II to model bivalency in immunoglobulins. J. Am. Chem. Soc. 2011, 133, 11701-11715. 22. Mack, E.T.; Snyder, P.W.; Perez-Castillejos, R.; Bilgicer, B.; Moustakas, D.T.; Butte, M.J.; Whitesides, G.M. Dependence of Avidity on Linker Length for a Bivalent Ligand-Bivalent Receptor Model System. J. Am. Chem. Soc. 2012, 134, 333-345. 23. Booth, V.H. The carbonic anhydrase inhibitor in serum. J. Physiol. 1938, 91, 474-479. 24. Ridderstråle, Y.; Fierke, C.A.; Roush, E.D., Wistrand, P.J. Localization of a protein inhibitor of carbonic anhydrase in pig tissues. Acta Physiol. Scand. 2002, 176, 27-31. 25. Aspatwar, A.; Tolvanen, M.E.; Parkkila, S. Phylogeny and expression of carbonic anhydraserelated proteins. BMC Mol. Biol. 2010, 11, 25. 26. Khalifah, R.G. The carbon dioxide hydration activity of carbonic anhydrase. I. Stop-flow kinetic studies on the native human isoenzymes B and C. J. Biol. Chem. 1971, 246, 2561-2573. 27. Whittington, D.A.; Waheed, A.; Ulmasov, B.; Shah, G.N.; Grubb, J.H.; Sly, W.S.; Christianson, D.W. Crystal structure of the dimeric extracellular domain of human carbonic anhydrase XII, a bitopic membrane protein overexpressed in certain cancer tumor cells. Proc. Natl. Acad. Sci. USA. 2001, 98, 9545-9550. 28. Whittington, D.A.; Grubb, J.H.; Waheed, A.; Shah, G.N.; Sly, W.S.; Christianson, D.W. Expression, assay, and structure of the extracellular domain of murine carbonic anhydrase XIV: implications for selective inhibition of membrane-associated isozymes. J. Biol. Chem. 2004, 279, 7223-7228.


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 23

29. Di Fiore, A.; Monti, S.M.; Hilvo, M.; Parkkila, S.; Romano, V.; Scaloni, A.; Pedone, C.; Scozzafava, A.; Supuran, C.T.; De Simone, G. Crystal structure of human carbonic anhydrase XIII and its complex with the inhibitor acetazolamide. Proteins, 2009, 74, 164-175. 30. a) Di Fiore, A.; Truppo, E.; Supuran, C.T.; Alterio, V.; Dathan, N.; Bootorabi, F.; Parkkila, S.; Monti, S.M.; De Simone, G. Crystal structure of the C183S/C217S mutant of human CA VII in complex with acetazolamide. Bioorg. Med. Chem. Lett. 2010, 20, 5023-5026; b) Hilvo, M.; Baranauskiene, L.; Salzano, A.M.; Scaloni, A.; Matulis, D.; Innocenti, A.; Scozzafava, A.; Monti, S.M.; Di Fiore, A.; De Simone, G.; Lindfors, M.; Janis, J.; Valjakka, J.; Pastorekova, S.; Pastorek, J.; Kulomaa, M.S.; Nordlund, H.R.; Supuran, C.T.; Parkkila, S. Biochemical characterization of CA IX: one of the most active carbonic anhydrase isozymes. J. Biol. Chem. 2008, 283, 27799-27809. 31. Matulis, D.; Kranz, J.K.; Salemme, F.R.; Todd, M.J. Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor. Biochemistry 2005, 44, 5258-5266. 32. Pommier, Y.; Marchand, C. Interfacial inhibitors: targeting macromolecular complexes. Nat. Rev. Drug Discov. 2012, 11, 25-36. 33. a) Reichert, J.M. Antibody-based therapeutics to watch in 2011. MAbs 2011, 3, 76-99; b) Perez-Sayans, M.; Garcia-Garcia, A.; Scozzafava, A.; Supuran, C.T. Inhibition of V-ATPases and carbonic anhydrases as interference strategy with tumor acidification processes. Curr. Pharm. Des. 2012, 18, 1407-1413.


18

Page 19 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1: Inhibition of mammalian isoforms CA I – XV (h = human, m = murine enzyme) with mICA, human serum hTF, apo-TF and hLF, by a stopped flow CO2 hydrase assay.26 Isoform

KI (nM)* mICA

hTF

apoTF

hLF

hCA I

2.1

18.9

34.3

48.2

hCA II

3.4

31.6

26.6

40.1

hCA III

41.3

408.3

300.8

206.8

hCA IV

331.5

392.3

343.6

>1000

hCA VA

44.0

266.3

242.9

45.3

hCA VB

22.9

216.4

263.0

358.6

hCA VI

469.0

465.5

184.4

399.3

hCA VII

3.8

234.6

299.4

45.7

hCA IX

185.5

271.6

213.8

280.0

hCA XII

207.4

269.5

349.2

45.4

hCA XIII

420.7

314.9

276.8

453.8

mCA XIII

423.1

313.2

275.9

450.1

hCA XIV

407.2

341.8

387.7

>1000

mCA XV

0.7

230.9

343.7

333.5

* Mean from 3 different determinations. Errors were in the range of ± 10 % of the reported values.


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 23

Table 2. Transition midpoints of thermal denaturation determined by differential scanning calorimetry. The standard deviation has been reported as measurement error (from 3 differen determinations). Protein

Tm

mICA

62.5 ± 0.2

hCA III

48.0 ± 1.8

hCAIII 2nd peak

53.3 ± 0.6

hCA VI

41.6 ± 0.4

hCA VII

41.2 ± 0.8

hCA XIII

46.8 ± 0.3


20

Page 21 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 1. SPR biosensor analysis with mICA- and transferrin-functionalized sensors. (A) hCA VI showed tight binding to mICA-functionalized surface. The protein was applied on the surface at concentration of 100–3290 x 10–8 M. (B) hCA III at a concentration of 790 x 10–8 M showed weak binding signal, whereas hCA I showed no binding at the highest protein concentration used (1465 x 10–8 M). No clear binding to transferrin-functionalized surface was observed when samples of hCA I, hCA II, hCA III, hCA VI, hCA VII and hCA XII were injected onto the transferrin-functionalized sensor. In contrast, anti-transferrin showed strong binding (C).


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 23

Fig. 2. BLI analysis with hCA II-functionalized biosensor. The binding of mICA (A), apotransferrin (B) and holo-transferrin (C) was studied by incubating the hCA II-coupled sensor tip in wells containing 31-1000 x 10–9 M protein solutions. After 200 s incubation in the protein sample, the sensor was moved to a well containing measurement buffer alone to visualize dissociation phase.


22

Page 23 of 23

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC graphic

KIs(mICA) in the range of 0.7 – 469 nM against CA I - CA XV

23


ProteinâProtein Interactions: Inhibition of Mammalian Carbonic

Recommend Documents

ProteinâProtein Interactions: Inhibition of Mammalian Carbonic