Proteomic and Biochemical Analyses Reveal a Novel Mechanism for

Subscriber access provided by - Access paid by the | UCSB Libraries

Proteomic and Biochemical Analyses Reveal a Novel Mechanism for Promoting Protein Ubiquitination and Degradation by UFBP1, a Key Component of Ufmylation Ying Zhu, Qing Lei, Dan Li, Yang Zhang, Xiaogang Jiang, Zhanhong Hu, and Guoqiang Xu J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.7b00843 • Publication Date (Web): 13 Mar 2018 Downloaded from http://pubs.acs.org on March 14, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Proteomic and Biochemical Analyses Reveal a Novel Mechanism for Promoting Protein Ubiquitination and Degradation by UFBP1, a Key Component of Ufmylation

Ying Zhu†,#, Qing Lei†,#, Dan Li†, Yang Zhang†, Xiaogang Jiang†, Zhanhong Hu†, and Guoqiang Xu†,*

†

Jiangsu Key Laboratory of Neuropsychiatric Diseases and College of Pharmaceutical Sciences,

Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Soochow University, Suzhou, Jiangsu 215123, China

ABSTRACT: Protein post-translational modification by ubiquitin-fold modifier 1, UFM1, regulates many biological processes such as response to endoplasmic reticulum stress and regulation of tumor progression. Recent study has indicated that the UFM1-binding and PCI domain-containing protein 1 (UFBP1) is required for the conjugation of UFM1 to a substrate. However, other biological functions of UFBP1 have not been explored. Here, we use immunoprecipitation and label-free quantitative proteomics to identify UFBP1-interacting proteins in a mammalian cell line. About 80 potential interacting proteins are obtained from MS analyses of three biological replicates. Bioinformatics analyses of these proteins suggest that UFBP1 may participate in the regulation of protein folding, stability, and trafficking. Biochemical experiments discover that UFBP1 expression downregulates the protein level and reduces the stability of several of its interacting proteins while UFBP1 knockdown increases their protein level. Protein synthesis inhibition and proteasomal inhibition experiments reveal that UFBP1 promotes their ubiquitination and degradation. Experiments using a model UFBP1-interacting protein ANT3 demonstrate that UFBP1 enhances the interaction between ANT3 and its E3 ligase and thus promotes its ubiquitination and degradation. Our work elucidates a novel molecular mechanism by which UFBP1 regulates protein ubiquitination and degradation. Keywords: UFBP1, quantitative proteomics, protein-protein interaction, protein stability, 1

ACS Paragon Plus Environment

Journal of Proteome Research 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

post-translational modification, ubiquitination

INTRODUCTION Post-translational modifications (PTMs) regulate protein functions through the addition of small chemical moieties or protein modifiers to the specific residues of their target proteins. One such PTM is ubiquitination, which plays important roles in regulating protein stability, activity, interaction, and subcellular localization, subsequently influencing diverse biological processes, such as DNA repair, signal transduction, kinase activation, and endocytosis.1, 2 About ten small protein modifiers with tertiary structures highly similar to ubiquitin, termed ubiquitin-like (Ubl) modifiers, have been discovered.3 These modifiers can also be conjugated to the side chain of lysine residues on their substrates through activating enzymes (E1s), conjugating enzymes (E2s), and ligases (E3s), in a manner similar to ubiquitination.1 Recently, some of these modifiers, such as small ubiquitin-like modifiers (SUMO), have been extensively studied and thousands of substrates were discovered by mass spectrometry (MS) analyses,4-6 which provided a wealth of resources for further functional study of these modifications. However, only limited information is known about other Ubl conjugation systems. One such Ubl modifier is ubiquitin-fold modifier 1 (UFM1).7 Although UFM1 only has about 20% sequence identity to ubiquitin, it also folds into a ubiquitin-like tertiary structure.7, 8 The C-terminal residue (Gly) of UFM1 can be conjugated to its substrates through a series of enzyme-catalyzed reactions. In this enzymatic cascade, only one E1, ubiquitin-like modifier-activating enzyme 5 (UBA5), one E2, UFM1-conjugating enzyme 1 (UFC1), and one E3, UFM1-protein ligase 1 (UFL1), have been discovered so far.7, 9 The conjugated UFM1 could be removed by two UFM1-specific proteases, UfSP1 and UfSP2.10 This conjugation system was suggested to play important roles in the endoplasmic reticulum (ER) regulation,11, 12 cellular homeostasis,13 erythroid development,14 and early-onset encephalopathy.15, 16 Although UFM1 has been discovered for more than ten years, a few proteins were found to be 2


Page 2 of 39

Page 3 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


modified by UFM1. Initially, the E2 UFC1 and the E3 UFL1 were identified to be the UFM1 modified proteins when the conjugation system was discovered.7, 9 Recently, a novel UFM1 substrate, a transcription coactivator activating signal cointegrator 1 (ASC1), was found to play an important role in the development of breast cancer.17 The ufmylation of this substrate is regulated by estrogen receptor α which displaces the UFM1-specific protease UfSP2 on ASC1 in the presence of 17β-estradiol. Moreover, it has been found that the ASC1 ufmylation promotes estrogen receptor α transactivation and tumor growth in breast cancer.17 This result suggested that ufmylation might play more important roles than initially discovered. Interestingly, this study also discovered that the conjugation of UFM1 to ASC1 required another protein, UFM1-binding and PCI domain-containing protein 1 (UFBP1, also called DDRGK domain-containing protein 1, Dashurin, or C20orf116). Together with previous discovery, in this enzymatic cascade, the UFM1 conjugated to E3 is first transferred to a lysine residue of UFBP1 (also a UFM1 substrate) and then moved to ASC1 in the presence of 17β-estradiol.17 This is distinct from the conjugation systems of other Ubl modifiers, suggesting that UFBP1 may have other important biological functions. Analyses of interacting proteins can allow us to explore the potential biological functions of the bait proteins. One of the best approaches for the identification of interacting proteins is to immunoprecipitate the bait protein and its interacting partners for subsequent MS analysis. Quantitative proteomic approaches, such as stable isotope labeling of amino acids by cell culture18 and label-free quantification19 can distinguish true interacting partners from nonspecific binding proteins. These approaches have been widely used to explore protein interacting partners and complex protein interaction networks.20-22 In this study, we performed immunoprecipitation (IP)-MS and identified 81 potential UFBP1-interacting proteins using MaxQuant label-free quantitative proteomics. Expression and knockdown of UFBP1 found that UFBP1 regulated the stability and ubiquitination of several of its interacting proteins. Further biochemical experiments found that UFBP1 enhanced the interaction between the substrate and its E3 ligase, leading to the enhanced ubiquitination and degradation. 3



This work discovers a potential molecular mechanism by which UFBP1 modulates its interacting proteins.

MATERIALS AND METHODS Materials Human embryonic kidney (HEK) 293T cell line was from American Type Culture Collection (ATCC). Anti-FLAG M2 affinity gel and cycloheximide (CHX) were from Sigma. Sequencing grade modified trypsin was from Promega. FLAG peptide (DYKDDDDK) was from ChinaPeptides. Myc sepharose 4B affinity gel, Myc magnetic beads, and Myc peptides (MEQKLISEEDL) were from Bimake. C18 ZipTips were from Millipore. Antibodies used in this work were from the following companies: FLAG from Sigma; ADP/ATP translocase 3 (ANT3), nuclear pore complex protein NUP160 (NUP160), and splicing factor 3B subunit 1 (SF3B1) from Cohesion Biosciences; Myc from CusAb; ubiquitin from Santa Cruz Biotechnology; UFBP1 from ProteinTech; ITCH from Sangon Biotech; GAPDH from HuaAn Biotechnology; α-tubulin from Ruiying Biological; secondary antibodies and protein A/G beads from Beyotime Biotechnology. Plasmid construction Total RNA was isolated from HEK293T cells with TRIzol reagent (Life Technologies) according to the manufacturer’s instruction. cDNA library was prepared with Thermo Scientific Revert Aid First Strand cDNA Synthesis kit (Thermo Fisher). Polymerase chain reaction (PCR) was conducted with TransStart FastPfu DNA polymerase (TransGen Biotech) with the following primers for UFBP1 (Forward: 5’-GCTTGGTACCGAGCTCGGATGGACTACAAGGACGACGATGACAAGGTGGCGCCTGTG TGG-3’; Reverse: 5’-TTGTTCGAAGGGCCCTCTAGATCAGGCTGGGGCTTGGGC-3’, synthesized by GeneWiz). The PCR product was cloned to the p3XFLAG plasmid using pEASY-UniSeamless Cloning and Assembly kit (TransGen Biotech), which expressed UFBP1 4


Page 4 of 39

Page 5 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


protein with an N-terminal 3XFLAG tag. Plasmids expressing UFBP1 without tag, with a FLAG tag at the C-terminus, with a Myc tag at the N-terminus were also constructed to pcDNA3.1 vector. Plasmids expressing HA-FLAG-UFM1, HA-UBA5, FLAG-UFC1, Myc-UFL1, Myc-Strep-ANT3 and Myc-Strep-NUP160 were constructed using the same method. pcDNA3.1-GFP and pcDNA3.1 plasmids, which have the same CMV promoter as the p3XFLAG-UFBP1 plasmid, were used as the control plasmid or balance plasmid. All plasmids were verified by DNA sequencing. Cell culture and plasmid transfection HEK293T cells were cultured in high glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% FBS (PAN Biotech and Lonsera), penicillin and streptomycin (Gibco). Cells were transfected with indicated plasmids using polyethyleneimine (PEI, Sigma) transfection reagents on the second day after seeding. The growth medium was replaced with fresh medium 6 h after transfection. Forty-eight hours after transfection, cells were washed with ice-cold PBS, harvested, and lysed in the modified RIPA buffer (50 mM Tris-HCl pH 7.2, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 1 mM EDTA) with freshly added protease inhibitor cocktail (Roche) under mild sonication. For the FLAG immunoprecipitation and MS analysis, ten 10-cm plates of HEK293T cells were used for each condition. For other experiments, one 10-cm plate of cells for each condition was used. Affinity purification FLAG-tagged proteins were purified according to a protocol described previously.23 Briefly, cell lysates were incubated with anti-FLAG M2 affinity gel at 4 °C for 10 h. Gel was washed three times with TBST and again three times with TBST containing 0.3 M NaCl. The FLAG-tagged UFBP1 and its interacting proteins were eluted with TBST containing 200 µg/mL FLAG peptides. For the reverse immunoprecipitation and ubiquitination experiments, the Myc-Strep tagged proteins (ANT3, NUP160) and endogenous SF3B1 were purified with an anti-Myc antibody or an anti-SF3B1 antibody. Briefly, cell lysates were first preincubated with prewashed protein A/G agarose beads for 2 h and the supernatants were incubated with 3 µg antibodies for 12 h at 4 °C. Then 30 µL 5



prewashed protein A/G beads (50%) were added and incubated for 4 h. The beads were washed with RIPA buffer for five times and eluted with 2×SDS sample loading buffer for Western blotting analysis or silver staining. The anti-Myc magnetic beads were used to purify the Myc-tagged ANT3 in the binding experiments. Briefly, the prewashed anti-Myc magnetic beads were incubated with cell lysates or FLAG M2 affinity gel purified samples (from the 1st round eluate) for 6 h at 4 °C. The magnetic beads were washed six times with TBST and four times with a RIPA buffer containing 0.6 M NaCl. Fifty microlitter 2×SDS sample loading buffer was added to the washed beads and the samples were heated 5 min at 98 °C for elution. Sample preparation for MS analysis The purified protein samples were separated by SDS-PAGE and visualized by silver staining. The gel bands were divided into five slices, cut into small pieces, and destained. The proteins were reduced, alkylated, and digested according to the in-gel trypsin digestion protocol.24, 25 The extracted samples were dried, resuspended in 0.1% trifluoroacetic acid, desalted with C18 ZipTips, dried again, and dissolved in 0.1% formic acid. MS analysis Peptide samples were analyzed by an Orbitrap Elite hybrid mass spectrometer (Thermo Fisher) according to a method described previously.26 Briefly, samples were separated on a C18 analytical column with a two-solvent system. Solvent A was composed of 0.1% formic acid and solvent B contained 80% acetonitrile and 0.1% formic acid. The LC gradient was from 6% to 44% solvent B within 120 min. Mass spectra were acquired in the positive-ion mode with an automated data-dependent MS/MS analysis. For each precursor MS scan (350-1800 m/z), the 15 most intense ions were selected for MS/MS analyses that were carried out in the collision-induced dissociation mode with the normalized collision energy of 35%. The selected precursor ion was excluded for fragmentation after two MS/MS analyses within 60 s. The resolution for the precursor ion was set to

6


Page 6 of 39

Page 7 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


120,000 at m/z = 400 in the Fourier transform mode and the isolation window for the selected precursor ion in MS/MS analysis was 2 Da. Experimental design and statistical rationale Three biological replicates for the identification of immunoprecipitated UFBP1-interacting proteins were carried out and samples were analyzed once by MS for each biological replicate. MS/MS spectra were searched using MaxQuant software suite (version 1.6.1.1) against a human protein database downloaded from the www.uniprot.org (released in July 2017).27 This database contains

182230 entries including protein isoforms from UniProtKB and TrEMBL databases and 247 common contaminants from MaxQuant website were also included. The default parameters in MaxQuant software suite were used for database search. The mass tolerance for precursor ions was set to 20 ppm for the first search and 4.5 ppm for the main search and that for fragment ions was set to 0.5 Da. The cysteine carbamidomethylation was set as fixed modification and methionine oxidation as variable modification. The maximal trypsin missed-cleavage sites were set to two. Proteins with more than one razor peptide and unique peptides were used for their identification and the false discovery rate (FDR) for peptides and proteins was set to 1%, which was estimated using the decoy database search strategy.28 The relative protein quantification was carried out based on the label-free quantification (LFQ) incorporated in the MaxQuant software suite (MaxLFQ).29 The LFQ intensity was obtained for proteins from the control and experimental samples. The missing LFQ intensity was replaced by random numbers that were drawn from a normal distribution with a width of 0.3 and a downshift of 1.8 defined by MaxQuant. p-value was calculated using Perseus computational platform.30 The averaged Log2(LFQExpt/LFQCtrl) from three biological replicates and the -Log(p-value) was used to obtain the volcano plot. FDR was set to 5% for the identification of UFBP1-interacting proteins. This resulted in one data point above the dashed hyperbolic curve at the left side of the volcano plot.

7



The protein classes were analyzed using the PANTHER database (version 13.1).31 The biological processes were obtained from STRING database analysis against the whole human genome (version 10.5).32 The volcano and bar graphs were plotted with Origin (OriginLab). Cycloheximide (CHX) and MG132 treatment HEK293T cells were transfected with the control and UFBP1 plasmids. Cells were equally split to each well of the 6-well plates and cultured in growing medium. Forty-eight hours after transfection, cells were treated with CHX (100 µg/mL) for the indicated time or with MG132 (10 µM) for 12 h. The treated cells were washed with ice-cold PBS and lysed in the modified RIPA buffer for immunoblotting analysis. UFBP1 knockdown UFBP1 siRNAs were purchased from GenePharma and the sequences were: siRNA UFBP1-sense 1: GAAAAUUGGAGCUAAGAAA, anti-sense 1: UUUCUUAGCUCCAAUUUUCTT; sense 2: CCAUAAAUCGCAUCCAGAA, anti-sense 2: UCCUGGAUGCGAUUUAUGGTT. HEK293T cells in 12-well plates were transfected with each pair of siRNAs (20 nM final concentration) using lipofectamine 2000 (Life Technologies). The culture medium was changed 6 h after transfection and cells were collected 48 h after transfection. Western blotting analysis Western blotting analysis was carried out according to a method previously described33 and the images were recorded in Bio-Rad ChemiDoc imaging system. The band intensity was analyzed with Image-Pro Plus (Media Cybernetics). The relative intensity was normalized by GAPDH or α-tubulin and averaged for three biological replicates. One way analysis of variance (ANOVA) with post hoc Tukey’s honestly significant difference was used to calculate the p-value for the effect of UFBP1 on protein level. Student’s t test was used to calculate the p-value for CHX chase experiments.

RESULTS 8


Page 8 of 39

Page 9 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Purification of UFBP1-interacting proteins To explore the potential biological functions of UFBP1, we tried to isolate the UFBP1-interacting proteins for MS analysis using a tagged UFBP1. First, we evaluated the effect of different small affinity tags on the function of UFBP1 in the UFM1 conjugation system. To do so, we expressed UFBP1, FLAG-UFBP1, UFBP1-FLAG, or Myc-UFBP1 along with UFM1, UBA5 (E1), UFC1 (E2) and UFL1 (E3) in HEK293T cells and immunoblotted UFM1 modified proteins. The result showed that the tags did not significantly alter the level of UFM1 modified proteins (Figure S1). Therefore, we used FLAG-UFBP1 for the subsequent experiments since the FLAG M2 affinity gel was frequently used for immunoprecipitation. We then expressed a control plasmid (GFP, control sample) or a FLAG-UFBP1 plasmid (experimental sample) in HEK293T cells and immunoprecipitated UFBP1 and its interacting proteins from cell lysates (Figure 1A). Immunoblotting of whole cell lysates with FLAG and GAPDH antibodies showed that UFBP1 was successfully expressed in the experimental sample (Figure 1B, top two panels). Evaluation of the effect of SDS (0.1%) in the lysis buffer on the isolation of UFBP1 and its interacting proteins demonstrated that such a low concentration of SDS did not affect the isolation of UFBP1 and its interacting proteins based on the short time silver staining of the purified samples (Figure S2). Therefore, 0.1% SDS was included in the lysis buffer for the subsequent experiments. After immunoprecipitation, UFBP1 was readily detected by a FLAG antibody (Figure 1B, the third panel), indicating the isolation of UFBP1 from the whole cell lysates. The silver stain showed that the control sample only contained a few weak bands, which were resulted from nonspecific bound proteins obtained during the immunoprecipitation (Figure 1B, the first lane of the bottom panel). However, in the experimental sample, many extra bands with relative high intensity were detected (Figure 1B, the second lane of the bottom panel). These results suggested that immunoprecipitation under our experimental condition could successfully isolate UFBP1 and enrich for its interacting proteins.

9



Figure 1. Purification and LC-MS/MS identification of potential UFBP1-interacting proteins. (A) Flowchart for the purification and proteomic identification of UFBP1-interacting proteins. (B) Evaluation of the efficiency for the immunoprecipitation of UFBP1-interacting proteins. HEK293T cells (ten 10-cm plates for each condition) were transfected with pcDNA3.1-GFP or 10


Page 10 of 39

Page 11 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


p3XFLAG-UFBP1 plasmid using PEI transfection reagents. The UFBP1-interacting proteins were purified with anti-FLAG M2 affinity gel. Proteins from whole cell lysates and affinity-purified samples were separated on SDS-PAGE and immunoblotted for UFBP1 and GAPDH. The UFBP1-interacting proteins were also visualized by silver staining. (C) Volcano plot of the -Log2(p-value) versus Log2(LFQExpt/LFQCrl) of MS identified proteins from three biological replicates of FLAG immunoprecipitates. The LFQ intensity was obtained from MaxQuant database search. The volcano plot was depicted using Perseus computational platform and replotted with Origin.

Identification of UFBP1-interacting proteins with label-free quantification After the purification of the UFBP1-interacting proteins, we used high-throughput MS to identify these proteins. The silver stained gels were excised and proteins were digested. The resulting peptides from the control and experimental samples were analyzed by LC-MS/MS in parallel. The resulting MS data were quantified to obtain the relative protein abundance in the control and experimental samples (Figure 1A). To confidently identify the UFBP1-interacting proteins, we carried out the MS analyses for three biological replicates. We used the label-free quantification (LFQ) incorporated in the MaxQuant software suite to quantify the relative protein abundance and used Perseus computational platform to calculate the p-values for all the identified proteins (Table S1). The relative abundance (Log2(LFQCtrl/LFQExpt)) and p-values (-Log2(p-value)) were used to construct the volcano plot and the FDR was set to < 5% estimated based on the data points at the left side of the volcano plot for the identification of UFBP1-interacting proteins (Figure 1C). In total, we identified 466 proteins from three biological replicates (Table S1). The quantification and p-values showed that most proteins identified from triplicates were located below the dashed hyperbolic curves with large p-value (or small -Log2(p-value)) at the upper right corner of the plot, which represents the non-specific bound proteins or proteins which have no statistical significance compared with the control sample from triplicate experiments. However, we identified 81 proteins with statistical significance, which were represented by the red points above the dashed hyperbolic curve at the right side of the plot (Table S2). These proteins were considered as potential UFBP1-interacting proteins. Functional analyses of UFBP1-interacting proteins 11



Since we identified a list of UFBP1-interacting proteins, we sought to explore their potential biological functions, which might reflect the possible functions of UFBP1. First, we categorized these proteins into different classes using the PANTHER database.31 For comparison, protein classes from the whole human proteome were also depicted in the same plot. It is clearly shown that UFBP1-interacting proteins were enriched in transporters, nucleic acid binding proteins, ligases, transfer/carrier proteins, cytoskeletal proteins, enzyme modulators, and chaperones (Figure 2A). Proteins in other classes such as transcription factors and receptors were moderately depleted. This information suggested that UFBP1 might be involved in the regulation of protein folding, protein stability, protein trafficking, etc. Next, we analyzed the biological processes of UFBP1-interacting proteins using online STRING database. The enriched biological processes for UFBP1-interacting proteins were protein transport and localization (Figure 2B).

Figure 2. Bioinformatics analyses of UFBP1-interacting proteins identified by MS analyses. (A) Protein classes of the UFBP1-interacting proteins and the whole human proteome. The protein classes were defined based on the annotation in the PANTHER database. For clarity, protein classes that only present in the whole human proteome were not depicted in this figure. (B) The major biological processes that the UFBP1-interacting proteins are participated in. The data were obtained from the online STRING database analysis and plotted for the 20 most enriched categories.

Biochemical validation of the UFBP1-interacting proteins Next, we used biochemical approaches to test whether the identified proteins indeed interact with 12


Page 12 of 39

Page 13 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UFBP1. To do so, we chose three proteins ANT3, NUP160, and SF3B1 which have commercial antibodies available. Immunoprecipitation of UFBP1 and its interacting proteins and subsequent immunoblotting analyses showed that these proteins were presented both in the control and experimental samples in the whole cell lysates while they were only detected in the FLAG-UFBP1 immunoprecipitates, confirming that they indeed interacted with UFBP1 (Figure 3A). The immunoblotting quantification showed that the relative protein abundance was similar to that obtained from the MS label-free quantification (Table S3). To further confirm their interaction, we performed the reverse immunoprecipitation for immunoblotting analysis. In each case, we detected UFBP1 in cell lysates of both samples and in the precipitates of the experimental samples but not in those of the control samples (Figure 3B). The forward and reverse immunoprecipitation and immunoblotting experiments clearly demonstrated that UFBP1 indeed interacted with these three proteins.

13



Figure 3. Biochemical validation of UFBP1-interacting proteins. (A) Immunoblotting of UFBP1, GAPDH, ANT3, NUP160, and SF3B1 in the cell lysates and FLAG M2 affinity gel-purified samples. GFP or FLAG-UFBP1 was expressed in HEK293T cells and UFBP1-interacting proteins were purified with FLAG M2 affinity gel. (B) Reverse immunoprecipitation and immunoblotting confirm that UFBP1 interacts with ANT3, NUP160, and SF3B1. GFP or Myc-Strep tagged ANT3 and NUP160 were expressed in HEK293T cells and an anti-Myc antibody was used for immunoprecipitation. The endogenous SF3B1 was immunoprecipitated with an anti-SF3B1 antibody. The immunoprecipitates and cell lysates were blotted with the indicated antibodies.

The role of UFBP1 in the regulation of protein level of its interacting partners We carefully examined the second row of the Western blotting images in Figure 3A and found that the protein level of ANT3, NUP160, and SF3B1 in the whole cell lysates was reduced when cells were transfected with UFBP1. To further validate this result, we transfected different amounts of UFBP1 plasmids (with a GFP plasmid to balance the total amount of plasmids) to HEK293T cells and examined the protein level by immunoblotting. We found that the protein level of ANT3, NUP160, and SF3B1 was clearly decreased with the increase of UFBP1 expression (Figure 4A). A mock transfection with different amount of control and GFP plasmids did not affect protein levels (Figure S3), which rules out the possibility that the transfection reagents or plasmids affect the endogenous protein level. These results demonstrated that UFBP1 could reduce the protein level of its interacting proteins. To further validate this result, we examined the protein level after knocking down UFBP1 through small interference RNA. As predicted, UFBP1 knockdown resulted in the increase of these three proteins in cell lysates (Figure 4B).

14


Page 14 of 39

Page 15 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


15



Figure 4. UFBP1 reduces the protein level of its three interacting proteins. (A) UFBP1 expression decreases the protein level of its three interacting proteins. FLAG-UFBP1 was transfected to HEK293T cells in different doses (0, 2, 4, or 8 µg plasmid in 6-cm plates). Total amount of plasmids were balanced with a GFP plasmid. Cell lysates were blotted with FLAG (UFBP1), GAPDH, and three endogenous UFBP1-interacting proteins, ANT3, NUP160, and SF3B1. Relative quantification from three biological replicates was carried out by Image-Pro Plus using GAPDH as loading control and p-values were calculated using one way analysis of variance (ANOVA) with post hoc Tukey’s honestly significant difference. **: p < 0.01; ***: p < 0.001. (B) UFBP1 knockdown increases the level of three UFBP1-interacting proteins. Control and two UFBP1 specific siRNAs were transfected separately to HEK293T cells with lipofectamine 2000 transfection reagents. Cell lysates were blotted with UFBP1, ANT3, NUP160, SF3B1, and α-tubulin. Relative quantification from three biological replicates was carried out by Image-Pro Plus using α-tubulin as loading control and p-values were calculated using Student’s t test. ***: p < 0.001.

UFBP1 promotes the ubiquitination of its interacting proteins To test whether the reduction of protein level was caused by the alteration of protein stability, we chose NUP160 and SF3B1 to carry out a cycloheximide (CHX) chase experiment (Figure 5A, top panels). The half-life of these proteins was significantly reduced upon UFBP1 expression, from ~9 h to ~5.5 h or 2.5 h for NUP160 and SF3B1, respectively (Figure 5A, bottom panels). To further examine whether the protein reduced by UFBP1 is induced by proteasomal degradation, we treated cells with a proteasome inhibitor, MG132, in the absence and presence of UFBP1 and measured the change of protein level (Figure 5B). Similar with the above observation, in the absence of MG132, the protein level of NUP160 and SF3B1 was decreased upon UFBP1 expression. However, after the MG132 treatment, the protein level was markedly increased and remained at the similar level for both the control and UFBP1 expressed samples. These results suggested that these two proteins underwent the ubiquitin-proteasome pathway for degradation and UFBP1 promoted this process. To further validate this result, we examined the effect of UFBP1 on the ubiquitination of its interacting proteins. We immunoprecipitated Myc-Strep tagged ANT3, NUP160, or endogenous SF3B1 in the absence and presence of UFBP1 and blotted the immunoprecipitates with an anti-ubiquitin antibody. The results from anti-ubiquitin immunoblotting clearly demonstrated the increase of the ubiquitination level for all three proteins upon UFBP1 expression although the 16


Page 16 of 39

Page 17 of 39

degree of the increase in the ubiquitination level varied (Figure 6). Together, our experiments demonstrated that UFBP1 promoted the ubiquitination and reduced the stability of its interacting proteins.

A Plasmid

pcDNA3.1

transfection CHX

0

2

4

6

FLAG-UFBP1 8

12

0

2

4

6

8

12 h WB NUP160

130

SF3B1

130 FLAG (UFBP1)

43

GAPDH

1.2

SF3B1 protein level

NUP160 protein level

34 Ctrl UFBP1

1.0 0.8 0.6 0.4 0.2

*

*

0.0 0

2

4

6

8

10

1.2

Ctrl UFBP1

1.0 0.8 0.6

**

0.4

*

0.2

12

0

*

2

4

6

8

10

12

CHX treatment (h)

FLAG-UFBP1 MG132 (10 µM) NUP160

130

FLAG (UFBP1)

43

GAPDH

34

2.0

* **

1.5 1.0 0.5

FLAG (UFBP1)

43

GAPDH

34

ns

**

SF3B1

130

SF3B1 protein level

B

*

0.0

CHX treatment (h)

NUP160 protein level

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.0

*

**

ns

**

1.5 1.0 0.5

0.0 UFBP1

0.0 UFBP1

MG132

MG132

Figure 5. UFBP1 reduces protein stability through the ubiquitin-proteasome pathway. (A) The cycloheximide (CHX) chase experiments for NUP160 and SF3B1 in the absence or presence of UFBP1. Cells were transfected with control or UFBP1 plasmids, respectively, and treated with CHX (100 µg/mL) for the indicated time. Cell lysates were immunoblotted for endogenous NUP160, SF3B1, GAPDH, and exogenously expressed UFBP1. Relative quantification was carried out for three biological replicates using GAPDH as loading control. p-values were 17



calculated using Student’s t test. *: p < 0.05; **: p < 0.01. (B) Proteasomal inhibition recovers the protein level of NUP160 and SF3B1 reduced by UFBP1 expression. Cells were transfected with the control (pcDNA3.1) or FLAG-UFBP1 plasmids, respectively, and treated with DMSO or MG132 (10 µM) for 12 h. Cell lysates were immunoblotted, signals were quantified with Image-Pro plus, and relative quantifications were carried out for three biological replicates using GAPDH as loading control. Statistical significance was evaluated with Student’s t test. *: p < 0.05; **: p < 0.01; ns: not significant.

Figure 6. UFBP1 promotes the ubiquitination of three UFBP1-interacting proteins. Immunoblotting of ubiquitin (Ub) for affinity-purified UFBP1-interacting proteins, ANT3 (A), NUP160 (B) and endogenous SF3B1 (C), in the absence or presence of UFBP1. The indicated plasmids were transfected to HEK293T cells and 48 h later, cells were treated with MG132 (10 µM) for 12 h before lysis. ANT3, NUP160, and SF3B1 were immunoprecipitated with anti-Myc or anti-SF3B1 antibodies. The immunoprecipitates or whole cell lysates were blotted with indicated antibodies.

UFBP1 enhances the interaction between ANT3 and its E3 ligase To explore the molecular mechanism by which UFBP1 regulated protein ubiquitination, we first tested whether UFBP1 regulated the interaction between ANT3 and its E3 ligase. Expression of several E3 ligase or subunits that potentially interact with ANT3 showed that E3 ubiquitin-protein ligase Itchy homolog (ITCH) reduced the ANT3 protein level in cell lysates (Figure S4). Immunoprecipitation and immunoblotting experiments further supported that ANT3 interacted with ITCH (Figure 7A). In addition, we detected the interaction between UFBP1 and ITCH (Figure 7B). Together with previous result that UFBP1 interacted with ANT3, these results suggested that 18


Page 18 of 39

Page 19 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UFBP1, ANT3 and ITCH might form a triple complex. To test this possibility, we carried out two rounds of immunoprecipitation and immunoblotting experiments and found that these three proteins indeed formed a triple complex (Figure 7C).

Figure 7. UFBP1, ANT3, and its E3 ligase ITCH form a triple complex. (A) ANT3 interacts with the E3 ligase ITCH. HEK293T cells were transfected with ITCH or/and MS-ANT3 for 48 h and the cell lysates were immunoprecipitated with Myc antibody. The affinity-purified samples and cell lysates were immunoblotted with the indicated antibodies. (B) UFBP1 interacts with ITCH. HEK293T cells were transfected with ITCH or/and FLAG-UFBP1 for 48 h and the cell lysates were immunoprecipitated with FLAG M2 affinity gel. The affinity-purified samples and cell lysates were blotted with the indicated antibodies. (C) UFBP1, ANT3, and ITCH form a triple complex. HEK293T cells were first transfected with FLAG-UFBP1 for 12 h and then transfected with ITCH or/and Myc-ANT3 for 48 h. The amount of 19



plasmids was slightly adjusted to make the proteins expressed in similar level in different samples. The resulting cell lysates were purified with FLAG M2 affinity gel and eluted with FLAG peptides in the 1st round immunoprecipitation. The eluate was further purified with Myc magnetic beads in the 2nd round immunoprecipitation. The cell lysates and the 1st and 2nd round affinity-purified samples were blotted with the indicated antibodies.

UFBP1 enhances the ITCH-mediated ANT3 ubiquitination and degradation To further elucidate the possible molecular mechanism by which UFBP1 regulated protein ubiquitination, we tested whether UFBP1 could influence the interaction between ANT3 and ITCH. Immunoprecipitation and immunoblotting experiments found that the interaction between ANT3 and ITCH was enhanced upon the expression of UFBP1 (Figure 8A). We then examined the effect of ITCH and UFBP1 on the ubiquitination of ANT3. Our data showed that the expression of ITCH promoted the ubiquitination of ANT3 and cotransfection of ITCH with UFBP1 further elevated the ubiquitination of ANT3 (Figure 8B).

20


Page 20 of 39

Page 21 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. UFBP1 enhances ITCH-mediated ANT3 ubiquitination and degradation. (A) UFBP1 enhances the interaction between ANT3 and ITCH. HEK293T cells were first transfected with FLAG-UFBP1 for 12 h and then transfected again with ITCH or/and Myc-ANT3 for 48 h. The amount of plasmids was slightly adjusted to make the proteins expressed in similar level in different samples. The cell lysates were purified with an anti-Myc antibody. The affinity-purified samples and cell lysates were immunoblotted with the indicated antibodies. (B) UFBP1 promotes ITCH-mediated ANT3 ubiquitination. HEK293T cells were transfected with ITCH, MS-ANT3 or/and FLAG-UFBP1 for 48 h and cells were treated with MG132 (10 µM) for 12 h to prevent protein degradation. The cell lysates were purified with an anti-Myc antibody. The purified samples and cell lysates were blotted with the indicated antibodies. (C) UFBP1 enhances ITCH-mediated ANT3 degradation. HEK293T cells were transfected with 21



MS-ANT3 for 12 h and then transfected again with ITCH or/and UFBP1 for another 48 h. Cell lysates were immunoblotted with the indicated antibodies. Relative Mean and SEM were obtained from three biological replicates using α-tubulin as loading control and statistics were performed with Student’s t test. *: p < 0.05, **: p < 0.01, compared with the first lane (pcDNA3.1 alone). ##: p < 0.01, compared with the third lane (pcDNA3.1 and ITCH).

We further tested whether UFBP1 enhanced the effect of ITCH on the regulation of ANT3 protein level. Upon transfection of UFBP1, ANT3 protein level was slightly decreased, which was consistent with above data. Expression of ITCH alone also decreased the ANT3 protein level. Together with the above ubiquitination data, this result indicated that ITCH was most probably an E3 ligase of ANT3. Interestingly, transfection of both UFBP1 and ITCH further enhanced the decrease of ANT3 protein level (Figure 8C). Together with the ubiquitination and protein interaction experiments, our results suggested that UFBP1 enhanced the interaction between ANT3 and its E3 ligase ITCH and thus promoted the ubiquitination and degradation of ANT3.

DISCUSSION The ubiquitin-like modifier, UFM1, plays important roles in the regulation of many cellular processes, such as response to ER stress11, 12 and cellular homeostasis.13 Recently, it has been demonstrated that during ufmylation, UFBP1 accepts UFM1 from the E3 ligase UFL1 and then transfers the conjugated UFM1 to its substrate.17 However, the study of other biological functions of UFBP1 is still in the infancy. In this work, we used a label-free quantitative proteomic approach and identified 81 potential UFBP1-interacting proteins in a mammalian cell line. Bioinformatics analyses indicated that UFBP1 may regulate protein folding, stability, and trafficking. Interestingly, through biochemical experiments, we discovered that UFBP1 could downregulate several of its interacting proteins. This result provided solid basis that UFBP1 had important functions other than the regulation of protein ufmylation. CHX chase experiments showed that UFBP1 expression reduced the half-life of its interacting partners. We also demonstrated that upon proteasomal inhibition, the degradation of two proteins, NUP160 and SF3B1, promoted by UFBP1 expression, was reduced and the protein level was returned to that 22


Page 22 of 39

Page 23 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


without UFBP1 expression. In addition, expression of UFBP1 enhanced the ubiquitination of its interacting proteins tested in our experiment. This result indicated that protein reduction by UFBP1 underwent the ubiquitin-proteasome pathway. Using ANT3 as an example, we further found that a triple complex was formed among ANT3, UFBP1, and an E3 ligase ITCH. The presence of UFBP1 enhanced the interaction between ANT3 and ITCH, which promoted the ubiquitination of ANT3 and further reduced the protein level in cell lysate. These results suggested that the regulation of UFBP1 on the ubiquitination of its interacting proteins, at least for some proteins, might be achieved through the association of UFBP1 with E3 ligases. Indeed, the identified UFBP1-interacting proteins also include multiple E3 ligase components and deubiquitinating enzymes such as cullin-4B, cullin-associated NEDD8-dissociated protein 1, and ubiquitin carboxyl-terminal hydrolase FAF-X (USP9X). In addition, UFBP1 contains a partial PCI domain that is frequently found in the subunits of proteasome. This suggests that UFBP1 may also regulate the proteasome function through this domain. Together, our work discovered a novel molecular mechanism by which UFBP1 regulated protein stability and ubiquitination. It should be noted that our experiments cannot rule out the possibility that other UFBP1-interacting proteins might be regulated by UFBP1 in different ways or through different molecular mechanisms. Identification of interacting proteins through quantitative proteomics also has its own limitations. Although we have identified many UFBP1-interacting proteins and validated several interacting partners through biochemical approaches, we cannot tell whether these proteins interact with UFBP1 directly or indirectly. If one is interested in direct interaction between UFBP1 and its specific interacting partners, validation with other approaches such as in vitro protein interaction assay is required. Nevertheless, use of the data obtained from three biological replicates increased the likelihood of their strong association. Our method may also miss some UFBP1-interacting proteins. After we surveyed the literature and the protein-interaction network analysis (PINA2),34 we could not found any of these biochemically identified UFBP1 interactors in our dataset. Several possible reasons may lead to this result. Firstly, our experimental conditions for the purification of 23



UFBP1-interacting proteins may be too stringent. Therefore, some low abundant proteins or weak interactors may be washed away during the immunoprecipitation. Secondly, our criteria for the positive identification of interacting proteins may be so strict that many proteins might be identified with no statistically significance. Indeed, ornithine aminotransferase (OAT) was such a protein, which was identified in all three biological replicates but the p-value was above 0.05. Therefore, it was not considered as a confident interacting protein through proteomic analysis. However, our biochemical experiments clearly demonstrated its interaction with UFBP1 (Figure S5). Thirdly, the interaction may be cell-type specific or may depend on specific stimulus. Some of the above limitations may be alleviated if stable isotope labeling approaches were used for protein quantification. However, the advantage of the current approach is that it can eliminate the low confidence hits and therefore increase the success rate for the biochemical validation and subsequent functional study. It should be noted that the identified protein list may also contain a small number of false positive hits although we used stringent criteria. Nevertheless, our current work revealed a new biological function for UFBP1 in the regulation of protein ubiquitination and degradation besides its known function in the conjugation of UFM1 to its substrates, indicating the potential crosstalk between ubiquitination and the UFM1 conjugation system. Our experiments suggested that UFM1-interacting proteins might be different from that of UFBP1-interacting proteins although UFBP1 could also be ufmylated. Pulldown experiments discovered that UFM1 interacted with both CDK5 regulatory subunit-associated protein 3 (CDK5RAP3) and UFBP1 in pancreatic beta cells.35 However, our MS analyses of UFBP1-interacting proteins did not identify CDK5RAP3. It is possible that these three proteins may form a weak tertiary complex, or that the interaction between CDK5RAP3 and UFBP1 may be indirect or cell type specific. It has also been shown that the transcription of the ufmylation system is upregulated upon ER stress.36 The response of the ufmylation system to ER stress may be partially executed through the association between UFBP1 and its interacting proteins.

24


Page 24 of 39

Page 25 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In summary, using comparative proteomic analyses, we identified proteins interacted with UFBP1, a key component of the UFM1 conjugation system, in a mammalian cell line. The resulting MS data and biochemical work led to the discovery that UFBP1 regulates the stability and ubiquitination of its interacting proteins. We also revealed a molecular mechanism by which UFBP1 regulates the protein level and the stability of its interacting proteins through promoting the interaction between the substrate and its E3 ligase, indicating the potential crosstalk between ubiquitination and the UFM1 conjugation system. This work may provide new insights in the functional study of UFBP1 besides its role in the ufmylation.

SUPPORTING INFORMATION: The following files are available free of charge at ACS website http://pubs.acs.org: Supporting Information.pdf: Effect of FLAG tag on UFM1 modification (Figure S1); Effect of SDS on the purification of FLAG-UFBP1 (Figure S2); Effect of GFP on UFBP1-interacting proteins (Figure S3); Effect of E3 ligases on ANT3 protein level (Figure S4); UFBP1 interacts with OAT (Figure S5). Table S1.xlsx: All proteins identified by MS (Table S1). Table S2.xlsx: MS identified UFBP1-interacting proteins (Table S2). Table S3.xlsx: Immunoblotting and MS quantification of three UFBP1-interacting proteins (Table S3). The MS data were deposited to the ProteomeXchange Consortium via the PRIDE37 partner repository with the dataset identifier PXD003729.

AUTHOR INFORMATION Corresponding Author: Guoqiang Xu, E-mail: [email protected], Tel: +86 512 65882723 Author contributions: #: Y.Z. and Q.L. contributed equally to this work. 25



Notes The authors declare no competing financial interest. Funding Sources This work was supported by National Natural Science Foundation of China (31470772, 3170072), Postgraduate Research and Practice Innovation Program of Jiangsu Province (KYCX17_2040), Suzhou Municipal Bureau of Science and Technology (SYS201718), Jiangsu Key Laboratory of Neuropsychiatric Diseases (BM2013003), a project funded by the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions.

ACKNOWLEDGMENT We thank Yarong Wang for her assistance during the MS analyses, which were performed at the Mass Spectrometry core facility of the Medical School of Soochow University. We also thank Crystal A. Mieres from Royal College of Surgeons in Ireland for critical reading of our manuscript.

ABBREVIATIONS ANT3, ADP/ATP translocase 3; ASC1, activating signal cointegrator 1; CDK5RAP3, CDK5 regulatory subunit-associated protein 3; ER, endoplasmic reticulum; FDR, false discovery rate; LC, liquid chromatography; MS, mass spectrometry; NUP160, nuclear pore complex protein NUP160; PEI, polyethyleneimine; PTM, post-translational modification; SF3B1, splicing factor 3B subunit 1; STRING, search tool for the retrieval of interacting genes/proteins; UFM1, ubiquitin-fold modifier 1; UBA5, UFM1-activating enzyme 5; Ubl, ubiquitin-like; UFBP1, UFM1-binding and PCI domain-containing protein 1 or DDRGK domain-containing protein 1; UFC1, UFM1-conjugating enzyme 1; UFL1, UFM1-protein ligase 1; UfSP1 and UfSP2, UFM1-specific protease 1 and 2.

REFERENCES 1. Hershko, A.; Ciechanover, A., The ubiquitin system for protein-degradation. Annu Rev Biochem 1992, 61, 761-807. 26


Page 26 of 39

Page 27 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2. Haglund, K.; Dikic, I., Ubiquitylation and cell signaling. EMBO J 2005, 24, (19), 3353-3359. 3. Kerscher, O.; Felberbaum, R.; Hochstrasser, M., Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol 2006, 22, 159-180. 4. Matic, I.; Schimmel, J.; Hendriks, I. A.; van Santen, M. A.; van de Rijke, F.; van Dam, H.; Gnad, F.; Mann, M.; Vertegaal, A. C. O., Site-specific identification of SUMO-2 targets in cells reveals an inverted SUMOylation motif and a hydrophobic cluster SUMOylation motif. Mol Cell 2010, 39, (4), 641-652. 5. Hendriks, I. A.; D'Souza, R. C. J.; Yang, B.; Verlaan-de Vries, M.; Mann, M.; Vertegaal, A. C. O., Uncovering global SUMOylation signaling networks in a site-specific manner. Nat Struct Mol Biol 2014, 21, (10), 927-936. 6. Impens, F.; Radoshevich, L.; Cossart, P.; Ribet, D., Mapping of SUMO sites and analysis of SUMOylation changes induced by external stimuli. Proc Natl Acad Sci USA 2014, 111, (34), 12432-12437. 7. Komatsu, M.; Chiba, T.; Tatsumi, K.; Iemura, S.; Tanida, I.; Okazaki, N.; Ueno, T.; Kominami, E.; Natsume, T.; Tanaka, K., A novel protein-conjugating system for Ufm1, a ubiquitin-fold modifier. EMBO J 2004, 23, (9), 1977-1986. 8. Sasakawa, H.; Sakata, E.; Yamaguchi, Y.; Komatsu, M.; Tatsumi, K.; Kominami, E.; Tanaka, K.; Kato, K., Solution structure and dynamics of Ufm1, a ubiquitin-fold modifier 1. Biochem Bioph Res Commun 2006, 343, (1), 21-26. 9. Tatsumi, K.; Sou, Y. S.; Tada, N.; Nakamura, E.; Iemura, S.; Natsume, T.; Kang, S. H.; Chung, C. H.; Kasahara, M.; Kominami, E.; Yamamoto, M.; Tanaka, K.; Komatsu, M., A novel type of E3 ligase for the Ufm1 conjugation system. J Biol Chem 2010, 285, (8), 5417-27. 10.Kang, S. H.; Kim, G. R.; Seong, M.; Baek, S. H.; Seol, J. H.; Bang, O. S.; Ovaa, H.; Tatsumi, K.; Komatsu, M.; Tanaka, K.; Chung, C. H., Two novel ubiquitin-fold modifier 1 (Ufm1)-specific proteases, UfSP1 and UfSP2. J Biol Chem 2007, 282, (8), 5256-62. 11. Hu, X.; Pang, Q.; Shen, Q.; Liu, H.; He, J.; Wang, J.; Xiong, J.; Zhang, H.; Chen, F., Ubiquitin-fold modifier 1 inhibits apoptosis by suppressing the endoplasmic reticulum stress response in Raw264.7 cells. Int J Mol Med 2014, 33, (6), 1539-46. 12.Liu, J.; Wang, Y.; Song, L.; Zeng, L.; Yi, W.; Liu, T.; Chen, H.; Wang, M.; Ju, Z.; Cong, Y. S., A critical role of DDRGK1 in endoplasmic reticulum homoeostasis via regulation of IRE1α stability. Nat Commun 2017, 8, 14186. 13.Zhang, M.; Zhu, X.; Zhang, Y.; Cai, Y.; Chen, J.; Sivaprakasam, S.; Gurav, A.; Pi, W.; Makala, L.; Wu, J.; Pace, B.; Tuan-Lo, D.; Ganapathy, V.; Singh, N.; Li, H., RCAD/Ufl1, a Ufm1 E3 ligase, is essential for hematopoietic stem cell function and murine hematopoiesis. Cell Death Differ 2015, 22, (12), 1922-34. 14.Cai, Y. F.; Pi, W. H.; Sivaprakasam, S.; Zhu, X. B.; Zhang, M. S.; Chen, J. J.; Makala, L.; Lu, C. W.; Wu, J. C.; Teng, Y.; Pace, B.; Tuan, D.; Singh, N.; Li, H. L., UFBP1, a key component of the ufm1 conjugation system, is essential for ufmylation-mediated regulation of erythroid development. PLoS Genetics 2015, 11, (11), e1005643. 15.Muona, M.; Ishimura, R.; Laari, A.; Ichimura, Y.; Linnankivi, T.; Keski-Filppula, R.; Herva, R.; Rantala, H.; Paetau, A.; Poyhonen, M.; Obata, M.; Uemura, T.; Karhu, T.; Bizen, N.; Takebayashi, H.; McKee, S.; Parker, M. J.; Akawi, N.; McRae, J.; Hurles, M. E.; Kuismin, O.; Kurki, M. I.; Anttonen, A. K.; Tanaka, K.; Palotie, A.; Waguri, S.; Lehesjoki, A. E.; Komatsu, M., Biallelic variants in UBA5 link dysfunctional UFM1 ubiquitin-like modifier pathway to severe infantile-onset encephalopathy. Am J Hum Genet 2016, 99, (3), 683-94. 27



16.Colin, E.; Daniel, J.; Ziegler, A.; Wakim, J.; Scrivo, A.; Haack, T. B.; Khiati, S.; Denomme, A. S.; Amati-Bonneau, P.; Charif, M.; Procaccio, V.; Reynier, P.; Aleck, K. A.; Botto, L. D.; Herper, C. L.; Kaiser, C. S.; Nabbout, R.; N'Guyen, S.; Mora-Lorca, J. A.; Assmann, B.; Christ, S.; Meitinger, T.; Strom, T. M.; Prokisch, H.; Consortium, F.; Miranda-Vizuete, A.; Hoffmann, G. F.; Lenaers, G.; Bomont, P.; Liebau, E.; Bonneau, D., Biallelic variants in UBA5 reveal that disruption of the UFM1 cascade can result in early-onset encephalopathy. Am J Hum Genet 2016, 99, (3), 695-703. 17.Yoo, H. M.; Kang, S. H.; Kim, J. Y.; Lee, J. E.; Seong, M. W.; Lee, S. W.; Ka, S. H.; Sou, Y. S.; Komatsu, M.; Tanaka, K.; Lee, S. T.; Noh, D. Y.; Baek, S. H.; Jeon, Y. J.; Chung, C. H., Modification of ASC1 by UFM1 is crucial for ERα transactivation and breast cancer development. Mol Cell 2014, 56, (2), 261-74. 18.Ong, S. E.; Blagoev, B.; Kratchmarova, I.; Kristensen, D. B.; Steen, H.; Pandey, A.; Mann, M., Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol Cell Proteomics 2002, 1, (5), 376-86. 19.Liu, H.; Sadygov, R. G.; Yates, J. R., 3rd, A model for random sampling and estimation of relative protein abundance in shotgun proteomics. Anal Chem 2004, 76, (14), 4193-201. 20.Selbach, M.; Mann, M., Protein interaction screening by quantitative immunoprecipitation combined with knockdown (QUICK). Nat Methods 2006, 3, (12), 981-983. 21.Sowa, M. E.; Bennett, E. J.; Gygi, S. P.; Harper, J. W., Defining the human deubiquitinating enzyme interaction landscape. Cell 2009, 138, (2), 389-403. 22.Huttlin, E. L.; Ting, L.; Bruckner, R. J.; Gebreab, F.; Gygi, M. P.; Szpyt, J.; Tam, S.; Zarraga, G.; Colby, G.; Baltier, K.; Dong, R.; Guarani, V.; Vaites, L. P.; Ordureau, A.; Rad, R.; Erickson, B. K.; Wuhr, M.; Chick, J.; Zhai, B.; Kolippakkam, D.; Mintseris, J.; Obar, R. A.; Harris, T.; Artavanis-Tsakonas, S.; Sowa, M. E.; De Camilli, P.; Paulo, J. A.; Harper, J. W.; Gygi, S. P., The BioPlex network: A systematic exploration of the human interactome. Cell 2015, 162, (2), 425-440. 23.Xu, G.; Jiang, X.; Jaffrey, S. R., A mental retardation-linked nonsense mutation in cereblon is rescued by proteasome inhibition. J Biol Chem 2013, 288, (41), 29573-85. 24.Shevchenko, A.; Tomas, H.; Havlis, J.; Olsen, J. V.; Mann, M., In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat Protoc 2006, 1, (6), 2856-60. 25.Xu, G.; Shin, S. B.; Jaffrey, S. R., Global profiling of protease cleavage sites by chemoselective labeling of protein N-termini. Proc Natl Acad Sci USA 2009, 106, (46), 19310-5. 26.Duan, W.; Chen, S.; Zhang, Y.; Li, D.; Wang, R.; Chen, S.; Li, J.; Qiu, X.; Xu, G., Protein C-terminal enzymatic labeling identifies novel caspase cleavages during the apoptosis of multiple myeloma cells induced by kinase inhibition. Proteomics 2016, 16, (1), 60-9. 27.The UniProt Consortium, UniProt: a hub for protein information. Nucleic Acids Res 2015, 43, (Database issue), D204-12. 28.Elias, J. E.; Gygi, S. P., Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat Methods 2007, 4, (3), 207-14. 29.Cox, J.; Hein, M. Y.; Luber, C. A.; Paron, I.; Nagaraj, N.; Mann, M., Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics 2014, 13, (9), 2513-2526. 30.Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M. Y.; Geiger, T.; Mann, M.; Cox, J., The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods 2016, 13, (9), 731-740. 28


Page 28 of 39

Page 29 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


31.Mi, H. Y.; Muruganujan, A.; Casagrande, J. T.; Thomas, P. D., Large-scale gene function analysis with the PANTHER classification system. Nat Protoc 2013, 8, (8), 1551-1566. 32.Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K. P.; Kuhn, M.; Bork, P.; Jensen, L. J.; von Mering, C., STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res 2015, 43, (D1), D447-D452. 33.Hou, X. O.; Si, J. M.; Ren, H. G.; Chen, D.; Wang, H. F.; Ying, Z.; Hu, Q. S.; Gao, F.; Wang, G. H., Parkin represses 6-hydroxydopamine-induced apoptosis via stabilizing scaffold protein p62 in PC12 cells. Acta Pharmacol Sin 2015, 36, (11), 1300-7. 34.Cowley, M. J.; Pinese, M.; Kassahn, K. S.; Waddell, N.; Pearson, J. V.; Grimmond, S. M.; Biankin, A. V.; Hautaniemi, S.; Wu, J., PINA v2.0: mining interactome modules. Nucleic Acids Res 2012, 40, (Database issue), D862-5. 35.Lemaire, K.; Moura, R. F.; Granvik, M.; Igoillo-Esteve, M.; Hohmeier, H. E.; Hendrickx, N.; Newgard, C. B.; Waelkens, E.; Cnop, M.; Schuit, F., Ubiquitin fold modifier 1 (UFM1) and its target UFBP1 protect pancreatic beta cells from ER stress-induced apoptosis. PLoS One 2011, 6, (4), e18517. 36.Zhang, Y.; Zhang, M.; Wu, J.; Lei, G.; Li, H., Transcriptional regulation of the Ufm1 conjugation system in response to disturbance of the endoplasmic reticulum homeostasis and inhibition of vesicle trafficking. PLoS One 2012, 7, (11), e48587. 37.Vizcaino, J. A.; Csordas, A.; del-Toro, N.; Dianes, J. A.; Griss, J.; Lavidas, I.; Mayer, G.; Perez-Riverol, Y.; Reisinger, F.; Ternent, T.; Xu, Q. W.; Wang, R.; Hermjakob, H., 2016 update of the PRIDE database and its related tools. Nucleic Acids Res 2016, 44, (D1), D447-56.

29



for TOC only

30


Page 30 of 39

Page 31 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 288x547mm (300 x 300 DPI)



Figure 2 231x282mm (300 x 300 DPI)


Page 32 of 39

Page 33 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 204x172mm (300 x 300 DPI)



Figure 4 290x474mm (300 x 300 DPI)


Page 34 of 39

Page 35 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5 274x449mm (300 x 300 DPI)



Figure 6 166x119mm (300 x 300 DPI)


Page 36 of 39

Page 37 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7 255x375mm (300 x 300 DPI)



Figure 8 258x335mm (300 x 300 DPI)


Page 38 of 39

Page 39 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC 110x74mm (300 x 300 DPI)


Proteomic and Biochemical Analyses Reveal a Novel Mechanism for

Recommend Documents