Proteomics Analysis of the Causative Agent of Typhoid Fever - Journal

Proteomics Analysis of the Causative Agent of Typhoid Fever Charles Ansong,† Hyunjin Yoon,‡ Angela D. Norbeck,† Jean K. Gustin,‡ Jason E. McDermott,† Heather M. Mottaz,§ Joanne Rue,‡ Joshua N. Adkins,† Fred Heffron,‡ and Richard D. Smith*,† Biological Sciences Division, and Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352, and Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, Oregon 97239 Received July 13, 2007; Accepted October 29, 2007

Typhoid fever is a potentially fatal disease caused by the bacterial pathogen Salmonella enterica serotype Typhi (S. typhi). S. typhi infection is a complex process that involves numerous bacterially encoded virulence determinants, and these are thought to confer both stringent human host specificity and a high mortality rate. In the present study, we used a liquid chromatography–mass spectrometry (LC-MS)based proteomics strategy to investigate the proteome of logarithmic, stationary phase, and low pH/ low magnesium (MgM) S. typhi cultures. This represents the first large-scale comprehensive characterization of the S. typhi proteome. Our analysis identified a total of 2066 S. typhi proteins. In an effort to identify putative S. typhi-specific virulence factors, we then compared our S. typhi results to those obtained in a previously published study of the S. typhimurium proteome under similar conditions (Adkins, J. N. et al. Mol. Cell. Proteomics 2006, 5, 1450-1461). Comparative proteomics analysis of S. typhi strain Ty2 and S. typhimurium strain LT2 revealed a subset of highly expressed proteins unique to S. typhi that were exclusively detected under conditions that are thought to mimic the infective state in macrophage cells. These proteins included CdtB, HlyE, and gene products of t0142, t1108, t1109, t1476, and t1602. The differential expression of T1108, T1476, and HlyE was confirmed by Western blot analysis. When our observations are taken together with the current literature, they suggest that this subset of proteins may play a role in S. typhi pathogenesis and human host specificity. Keywords: Salmonella typhi • Salmonella typhimurium • proteomics • pathogen • mass spectrometry

Introduction Typhoid fever is a life-threatening illness caused by Salmonella enterica serotype Typhi (S. typhi), a host-adapted bacterium that is highly specific for humans. Characterized by systemic infection, typhoid fever affects an estimated 16.6 million people and results in nearly 600 000 deaths worldwide each year.1 In comparison, the closely related bacterial pathogen Salmonella enterica serotype Typhimurium (S. typhimurium) has a broad host range and is one of the leading causes of salmonellosis, a severe form of food poisoning usually characterized by localized gastroenteritis. Approximately 40 000 cases of salmonellosis are reported yearly in the U.S.2 With the increasing prevalence of multidrug-resistant strains of S. typhi3,4 and the high mortality rate of S. typhi infections, an understanding of the growth and pathogenesis of this organism is important for developing new therapeutics. Murine typhoid is widely accepted as an animal model for human typhoid fever5–10 because mice infected with S. typhimurium exhibit a systemic infection similar to that of human * To whom correspondence should be addressed: P.O. Box 999/K8-98, Richland, WA 99352. Fax: 509-376-7722. E-mail: [email protected]. † Biological Sciences Division, Pacific Northwest National Laboratory. ‡ Oregon Health and Sciences University. § Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory.

546 Journal of Proteome Research 2008, 7, 546–557 Published on Web 01/01/2008

S. typhi infections. The primary concerns with regard to extrapolating the results from this model to human typhoid are that, in humans, S. typhimurium causes a nonsystemic rather than systemic infection and that many S. typhi genes, including those for host specificity, are absent from or functionally altered in S. typhimurium. The recently completed genome sequences of S. typhi strains CT18 and Ty2 and S. typhimurium strain LT211–13 show that, although S. typhi and S. typhimurium are closely related, relatively significant differences exist: ∼13% of the coding regions from CT18 Typhi are unique to S. typhi and ∼10% of the coding regions from LT2 are unique to S. typhimurium. One hypothesis is that the protein-coding regions found exclusively in S. typhi may encode key virulence factors that play a role in aspects of Salmonella pathogenesis unique to human hosts. In this study, we employed a capillary liquid chromatography–tandem mass spectrometry (LC-MS/MS)-based proteomics approach to perform the first comprehensive analysis of the S. typhi strain Ty2 proteome. MS-based analysis has been used in other bacterial studies to obtain a global overview of the proteins in cells cultured under conditions that induce the expression of some known virulence determinants, with the resulting protein information revealing new putative therapeutic targets that may allow for the development of new strategies to combat infection.14–17 Toward this goal, we evaluated 10.1021/pr070434u CCC: $40.75

 2008 American Chemical Society

research articles

Proteomics of S. typhi Table 1. Gene-Specific Primers Used in C-Terminal cyaA′ Tagging primers

target genes

sequences

hlyEcyaF1 hlyEcyaR1 t1476cyaF1 t1476cyaR1 bioBcyaF1 bioBcyaR1

hlyE hlyE t1476 t1476 bioB bioB

bioDcyaF1 bioDcyaR1 t1108cyaF1 t1108cyaR1 sseJcyaF1 sseJcyaR1

bioD bioD t1108 t1108 sseJ sseJ

5′-AAAGACACGGTAAGAAGACGCTTTTCGAGGTTCCTGACGTCCTGTCTCTTATACACATCTCA-3′ 5′-CTATCGGGCGTTAAAAGTACACAGATCGAATGAAAATGTATCACTGTCTCTTATACACATCTGGT-3′ 5′-ATTCTGGAGAAAATGCAGCAGAGTAATCGTACCCTGCGTAGACTGTCTCTTATACACATCTCA-3′ 5′-TAACATTCCAGAAGCTGGAAATACTGCCTGCTTCCTGCTTACTGTCTCTTATACACATCTGGT-3′ 5′-GACGCCTGACACCGATGATTATTACAACGCGGCAGCCTTACTGTCTCTTATACACATCTCA-3′ 5′-CCCGACGCGCCGTCAGCGCATCGTCGACGCGTTGTTGCCATGACATATGAATATCCTCCTTAG TTCTGTCTCTTATACACATCTGGT-3′ 5′-GACAGGACAGTATCTGGACCTTAGCCCCTTGGAACGCGCCCTGTCTCTTATACACATCTCA-3′ 5′-TCGTCTGATCCTGCAAGAAGGCGGTTTTTAAGCGCGGTCACTGTCTCTTATACACATCTGGT-3′ 5′-TTATGATGCAAGACCTGTAATAGAACTTATACTTTCTAAACTGTCTCTTATACACATCTCA-3′ 5′-ACGGGCTGTTTAATTTAATAGGCAACATAGGTAAGTTTCATTCTGTCTCTTATACACATCTGGT-3′ 5′-AATGTTAGAAAGTTTTATAGCTCATCATTATTCCACTGAACTGTCTCTTATACACATCTCA-3′ 5′-TGTGTTTTGCTCAAGGCGTACCGCAGCCGATGGAACTTTACTGTCTCTTATACACATCTGGT-3′

qualitative changes in S. typhi strain Ty2 protein abundance across three growth conditions: logarithmic (log) and stationary (stat) phase cultures and growth in an acidic, low magnesium [Mg2+] minimal media (MgM). Log and stationary phase cultures are the two best characterized phases of the bacterial growth curve and, thus, were chosen to represent standard freeliving growth conditions of S. typhi. Growth in MgM has been shown to approximate the environment found within the Salmonella-containing vacuoles (SCV) observed in infected host macrophages.14 This media induces the expression of the Salmonella pathogenicity island 2 (SPI-2)-encoded type-III secretion system (TTSS), a system critical for virulence and intramacrophage survival. The TTSS selectively secretes Salmonella proteins, many encoded outside the pathogenicity island, to the cytoplasm of infected cells, thereby mediating intracellular survival and replication.18–27 In light of these considerations, MgM was chosen to mimic the in vivo infectious host cell condition. We also compared the protein expression of S. typhi Ty2 to S. typhimurium LT2 prepared previously under the same growth conditions known to induce the expression of many virulence determinants14 to identify proteins that uniquely play a role in S. typhi pathogenesis and human host specificity. The data indicate that a comprehensive view of protein abundances, as they vary with respect to environment and genotype, can identify potential virulence factors.

Materials and Methods Reagents. The following reagents were used in proteomic sample preparation: Nanopure or Milli-Q quality water (∼18 MΩ cm or better), ammonium bicarbonate (NH4HCO3), bicinchoninic acid (BCA) or Coomassie protein assay reagents (Pierce, Rockford, IL), urea, thiourea, dithiothreitol (DTT), 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate (CHAPS), Rapigest surfactant (Waters), calcium chloride, sequencing-grade modified trypsin (Promega), HPLC-grade methanol (MeOH), trifluoroacetic acid (TFA), acetonitrile (ACN), ammonium formate, formic acid, and ammonium hydroxide (NH4OH). All reagents were obtained from Sigma Aldrich (St. Louis, MO), unless otherwise specified. Bacterial Growth. S. typhi strain Ty2 and associated mutant derivatives as well as a S. typhimurium 14028 mutant derivative was grown and harvested using standard batch culture procedures.28 S. typhi strain Ty2 was used for the proteomics analysis. Briefly, cells from a single colony were inoculated into 5 mL of Luria–Bertani (LB) medium and then grown for 16 h with shaking at 37 °C. This starter culture was then diluted 1:100

into 300 mL of fresh LB medium in a 2 L Erlenmeyer flask and grown for 16 h with shaking (200 rpm) at 37 °C. Once the log and stationary phase cultures reached an A600 of 0.6 and 2.0, respectively, the cells were harvested via centrifugation at 4000g. For the MgM cultures, cells were first grown in LB medium to stationary phase as described above, rinsed twice with MgM,29 resuspended in an equal volume of MgM, and then incubated at 37 °C with shaking (200 rpm) for 4 h. The cells were harvested as described above. After the cells were harvested for each culture condition, the cell pellets were washed twice with Cellgro Dulbecco’s phosphate-buffered saline (PBS; Mediatech) and finally pelleted in microcentrifuge tubes to an approximate wet weight of 0.1 g/tube. The cells were frozen and stored at -80 °C until needed. Strain Construction. Single-copy, chromosomal cyaA′tagged variants of the S. typhi t1108, t1476, bioB, bioD, and hlyE genes and the S. typhimurium sseJ gene were created using the polymerase chain reaction (PCR)-based method described by Geddes et al.30 and Datsenko et al.31 The adenylate cyclase domain used in cyaA′ tagging is contained within the first 400 amino acids of the hemolysin/adenylate cyclase toxin (CyaA) and is called CyaA′. The DNA cassette of cyaA′ and kanamycin resistance gene in pMini-Tn5-cycler30 was amplified with primers containing overhanging 5′ sequences specific to t1108, t1476, bioB, bioD, hlyE, and sseJ. In the case of bioB-cyaA′ construction, the reverse primer was designed to introduce a new ribosomal binding site and several N-terminal codons for the downstream gene bioF because bioB and bioF overlap each other and C-terminal tagging of bioB blocks bioF expression. The primers used in cyaA′-tagged genes are listed in Table 1. Then, the PCR products were used for homologous recombination to place both a cyaA′ tag at the 3′ end and a kanamycin resistance determinant immediately downstream of each gene. Diagnostic PCR was then performed to confirm the resulting recombinants. SseJ is an effector protein of the SPI-2 encoded TTSS and localizes to the Salmonella-containing vacuole (SCV) and Salmonella-induced filaments (Sif) after translocation into macrophage cells. According to Ohlson et al.,32 SseJ is involved in deacylation of lipids on the SCV membrane in animal cells and is required for full virulence. In this study, S. typhimurium strain 14028 SseJ was used as a positive reference control to determine expression within animal cells. Bacterial Infection of Cultured Macrophages. THP-1 human macrophage cell lines grown in RPMI-1640 were plated in 6-well plates at ∼2.4 × 106 cells/well and incubated overnight at 37 °C with 5% CO2 in the presence of Phorbol 12-myristate 13-acetate (PMA, 50 µg/mL). The next day, THP-1 cells were Journal of Proteome Research • Vol. 7, No. 2, 2008 547

research articles provided with fresh RPMI-1640 without PMA and incubated for another 3 h. Stationary-phase bacteria grown in LB overnight were washed with PBS, resuspended in RPMI-1640, and added at a multiplicity of infection of 250. Infections were initiated by centrifuging the bacteria onto the cell monolayers at 1000g for 5 min and then incubated at 37 °C with 5% CO2 for 30 min. To remove extracellular bacteria after the infection, the monolayers were washed twice with PBS and supplemented with RPMI-1640 medium containing gentamicin (100 µg/mL final concentration) for 1 h. The presence of gentamicin eliminates all extracellular bacteria. After that time, the cells were washed twice with PBS, overlaid with RPMI-1640 medium plus gentamicin (20 µg/mL final concentration), and incubated at 37 °C with 5% CO2 for the remainder of the experiment. Preparation of Host Cell Lysates. At 8 h after infection, the infected monolayers were washed once with PBS and lysed with 700 µL of lysis buffer [50 mM N-2-hydroxyethylpiperazine-N′2-ethanesulfonic acid (HEPES), 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM ethylene glycol bis(2-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 1% Triton, 100 mM phenylmethylsulphonyl fluoride (PMSF), protease inhibitor mixture (Roche Applied Science), 50 mM NaF, and 2 mM sodium orthovanadate] on ice for 30 min. The contents of each well were removed from the plate with a cell scraper, and an additional 500 µL of lysis buffer was poured in each well to wash out the remaining contents. The total 1.2 mL of animal cell lysate from each well was centrifuged at 10000g for 10 min, and the pellets containing Salmonella cells were resuspended in 1× Laemmli sample buffer and boiled for 5 min. Equal volumes of each sample were used for immunobot analyses. Immunoblot Analysis. S. typhi Ty2 and the following S. typhi Ty2 mutant derivatives t1108::cyaA′, t1476::cyaA′, bioB::cyaA′, bioD::cyaA′, and hlyE::cyaA′, as well as the S. typhimurium 14028 mutant derivative sseJ::cyaA′ were each cultured under the same three conditions (LB log, LB stationary, and MgM) described for our initial proteomic characterization of S. typhimurium,14 and the final optical density of each culture was recorded. There was no big difference in the growth rate between Ty2 strains. Cells at LB log phase exhibited OD600 value readings between 0.6 and 0.7, and cells harvested at LB stationary phase and MgM condition exhibited an OD600 value reading of approximately 2.4. Cells corresponding to an OD600 of 0.1 were harvested by centrifugation at 10000g in a microfuge at 4 °C, washed twice with an equal volume of ice-cold DPBS, resuspended in 50 µL of Laemmli 1× sample buffer, and boiled for 5 min. A 1/10th volume of the total cell lysate was loaded into the wells of 10% Tris-Cl sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels (BIO-RAD). After the proteins were separated on the gel, the proteins were electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). The membranes were blocked in Tris-buffered saline (TBS) plus 5% powdered nonfat dry milk for 1 h, probed with an anti- cyaA monoclonal antibody (Santa Cruz Biotechnology sc-13582, 1:400 dilution in block solution) for 1 h, washed 3 times for 5 min with TBS, probed with a goatantimouse 2° antibody (Sigma A4416, 1:5000 dilution in block solution) for 30 min, and finally washed 3 times for 5 min with TBS. The immune complexes were detected via chemiluminescence using Perkin-Elmer’s “Western Lightning” reagents and then exposed to XAR Biofilm (Kodak). Global and Soluble Protein Preparation. Cell pellets were resuspended in 100 mM NH4HCO3 at pH 8.4 buffer and lysed using 0.1 mM zirconia/silica beads in a 2.0 mL Cryovial with 548

Journal of Proteome Research • Vol. 7, No. 2, 2008

Ansong et al. vigorous vortexing for a total of 3 min with cooling steps. The supernatant and subsequent washes were transferred from the beads into new Cryovials. The beads were repeatedly washed until the supernatant was clear. After the protein concentration was determined for the samples, urea and thiourea were added to final concentrations of 7 and 2 M, respectively. After the addition of DTT (5 mM), the samples were incubated at 60 °C for 30 min. The samples were then diluted 10-fold with buffer, and CaCl2 was added (1 mM), followed by trypsin in a 1:50 trypsin/protein ratio. The samples were digested for 3 h at 37 °C and subsequently cleaned using a C18 solid-phase extraction (SPE) column (Supelco). Each 1 mL 100 or 50 mg SPE column was conditioned with MeOH and rinsed with 0.1% TFA in water. Samples were introduced to the columns and then washed with 95:5 H2O/ACN that contained 0.1% TFA. Excess liquid was removed from the columns under vacuum, and the samples were eluted with 80:20 ACN/H2O that contained 0.1% TFA and concentrated in a SpeedVac (Thermo-Savant) to a final volume of ∼100 µL. A BCA protein assay was performed to determine peptide concentrations prior to analysis. Insoluble Protein Preparation. Cell pellets were treated and lysed as described above for global and soluble protein preparations. The lysate was centrifuged at 1300g at 4 °C for 2 min, and the supernatant was transferred to polycarbonate ultracentrifuge tubes (Beckman) and centrifuged at 4 °C at 356000g for 10 min. Pellets were resuspended in 50 mM NH4HCO3 at pH 7.8 and ultracentrifuged under the same conditions as used in the previous step. A BCA protein assay33 was performed on the pellets resuspended in water, and the samples were ultracentrifuged once again (as described above) before discarding the supernatant. Pellets were resuspended in ∼200 µL of a solubilization solution (7 M urea, 2 M thiourea, and 1% CHAPS in 50 mM ammonium bicarbonate at pH 7.8), and DTT was added to a final concentration of 9.7 mM. Samples were incubated at 60 °C for 30 min, then diluted, and digested in the same manner as described for the global and soluble protein preparation. Samples were cleaned using an appropriately sized strong cation-exchange (SCX) SPE column (Supelco). Each 1 mL 100 mg column was conditioned with MeOH and rinsed in varying sequences and amounts with 10 mM ammonium formate in 25% ACN at pH 3.0, 500 mM ammonium formate in 25% ACN, and Nanopure water. Samples were acidified to a pH of e4.0 by adding 20% formic acid, followed by centrifugation at 16000g for 5 min. Samples were then introduced to the columns and washed with 10 mM ammonium formate in 25% ACN at pH 3.0. Excess liquid was removed from the columns under vacuum. The samples were eluted with 80:15:5 MeOH/H2O/NH4OH and concentrated to ∼100 µL using a SpeedVac. Final peptide concentrations were determined using a BCA protein assay. Rapigest Preparation. Sample preparation with Rapigest followed the protocol outlined in the instructions from Waters, with the exception of using 2.0% TFA instead of HCl to reduce the sample pH to 3.0 and incubating for 60 min at 37 °C to precipitate the surfactant. After digestion and acidification, the samples were centrifuged and the supernatant was transferred to a clean microcentrifuge tube. The sample pH was increased to ∼7 with NH4OH, and the peptide concentration was determined using a BCA protein assay. SCX Fractionation. SCX fractionation was performed as described previously.34 A brief description of the approach and modifications to the method are summarized here. The peptides were resuspended in 900 µL of mobile phase A and

Proteomics of S. typhi separated on an Agilent 1100 system (Agilent, Palo Alto, CA) that was equipped with a quaternary pump, degasser, diode array detector, and peltier-cooled autosampler and fraction collector (both set at 4 °C). The mobile phases consisted of 10 mM ammonium formate and 25% ACN at pH 3.0 (A) and 500 mM ammonium formate and 25% ACN at pH 6.8 (B). The gradient was maintained at 100% mobile phase A for the first 10 min and then increased by adding mobile phase B from 0 to 50% over the next 40 min and then from 50 to 100% over the following 10 min, before sustaining 100% mobile phase B for a final 10 min. A flow rate of 0.2 mL min-1 was maintained throughout the gradient. Spectra were obtained at 280 nm, and fractions were collected over the initial 70 min of the gradient. Capillary LC-MS Analysis. The HPLC system and method used for capillary LC have been described elsewhere.14 Briefly, reversed-phase capillary HPLC columns were manufactured inhouse by slurry-packing 5 µm Jupiter C18 stationary phase (Phenomenex, Torrence, CA) into a 60 cm length of 360 µm outer diameter × 150 µm inner diameter fused silica capillary tubing (Polymicro Technologies, Inc., Phoenix, AZ) that incorporated a 2 µm retaining screen in a 0.005 in. capillary-bore union (Valco Instruments Co., Houston, TX). The mobile phase consisted of 0.2% acetic acid and 0.05% TFA in water (A) and 0.1% TFA in 90% acetonitrile and 10% water (B). The mobile phase was degassed using an in-line Alltech vacuum degasser (Alltech Associates, Inc., Deerfield, IL). The HPLC system was equilibrated at 5000 psi with 100% mobile phase A, and then the mobile phase selection valve was switched 20 min after injection from position A to B, which created an exponential gradient as mobile phase B displaced A in the mixer. An approximately 5 cm length of 360 µm inner diameter fused silica tubing packed with 5 µm C18 particles was used to split ∼25 µL/min flow before it reached the injection valve. The split flow controlled the gradient speed under conditions of constant pressure operation. Flow through the capillary HPLC column when equilibrated to 100% mobile phase A was ∼2 µL/min. MS analysis was performed using an LTQ ion-trap mass spectrometer (ThermoScientific, Inc., San Jose, CA) with electrospray ionization. The HPLC column was coupled to the mass spectrometer using an in-house manufactured interface. Neither sheath gas nor makeup liquid was used. The heated capillary temperature and spray voltage were 200 °C and 2.2 kV, respectively. Data acquisition began 20 min after the sample was injected and continued for 100 min over a m/z range of 400–2000. For each cycle, the 10 most abundant ions from MS analysis were selected for MS/MS analysis, using a collision energy setting of 45%. A dynamic exclusion time of 60 s was used to discriminate against previously analyzed ions. Data Analysis. Peptides were identified using SEQUEST to search the mass spectra from the LC-MS/MS analyses against the annotated S. typhi strain Ty2 FASTA data file containing 4319 protein sequences provided by JCVI, formerly TIGR (http://www.jcvi.org, formerly http://www.tigr.org/, September 19, 2004, Stanford University). In addition, a standard parameter file with no modifications to amino acid residues was used, with a mass error window of 3 m/z units for precursor mass and 0 m/z units for fragmentation mass. Identifications were allowed for all possible peptide termini, i.e., not limited by the tryptic state. The large sets of tentative peptide identifications were subsequently filtered, combined, and binned by condition and strain. Spectra and requests for raw data may be directed to the National Institute of Allergy and Infectious Diseases funded Administrative Resource for Biodefense Proteomics

research articles Research Centers under the PNNL data section for S. typhi (http://www.proteomicsresource.org/). Peptides identified by SEQUEST were filtered using a combination of scores provided in the SEQUEST output files. Minimum threshold filters included those proposed by Washburn and Yates in 2001.35 Additional filter thresholds included a minimum discriminant value36 of 0.9 and a minimum Peptide Prophet probability37 of 0.85 to reduce the occurrence of falsepositive identifications. Using a minimum discriminant value of 0.9 as a filtering criterion in addition to the Washburn and Yates filtering criteria, we estimated a peptide identification false discovery rate of 0.06% in an earlier study.14 The inclusion of an additional filtering threshold in this study, minimum Peptide Prophet of 0.85, to allow for a broader comparison to a more widely adopted method and to increase the stringency of our filtering criteria, which we propose further, lowers the estimated false discovery rate estimated above. The previously analyzed S. typhimurium data14 were filtered according to the above criteria for the comparative analysis performed in this study. Both the discriminant score and Peptide Prophet probability use scores, such as Xcorr, delCN, and Sp, provided by SEQUEST to calculate a single score that could be used for confidence measurement for a given peptide sequence. Both scores are normalized to a scale of 0-1, with 1 being the most confident identification. The method of determining the score value differs conceptually between the two; in that, the discriminant score emphasizes separation of right and wrong answers, while Peptide Prophet probability uses score distributions and random chance calculations to determine the likelihood of the match. Detailed descriptions of both methods are provided elsewhere.36,37 The distributions of the discriminant scores and Peptide Prophet probabilities for peptide identifications that passed the first level of filtering35 were mostly similar, as indicated by the broad flat plane in Supplementary Figure 1 in the Supporting Information, which is log-transformed to highlight differences. Interestingly, some peptides were identified with very high Peptide Prophet probabilities but low discriminant values (top right). The peptide sequences for most of these identifications were nontryptic, even though trypsin was used during sample preparation. There is also a region of high discriminant score and low Peptide Prophet probability (bottom left corner), where the elution time parameter played a dominant role in the inflation of the discriminant score but is not considered for Peptide Prophet probabilities. Identifications used in this study fall within the region of high discriminant (0.9) and high Peptide Prophet (0.85) probabilities (center back corner) to provide a cross-validation of the two methods and for standardization against the more commonly used Peptide Prophet values. The number of peptide observations from each protein was used as a rough measure of relative abundance; no values called out in subsequent analyses differed by less than 3-fold between any two conditions. Multiple charge states of a single peptide were considered as individual observations, as were the same peptides detected in different mass spectral analyses. Similar approaches have been previously described.34,38–43 Protein identifications required at least three peptide observations meeting our SEQUEST, discriminant, and Peptide Prophet criteria. To compare proteins, the criteria for passing peptide observation counts for each protein were first normalized by summing across all comparative states. In this process, the observed counts for a particular protein for all conditions Journal of Proteome Research • Vol. 7, No. 2, 2008 549

research articles

Ansong et al.

Table 2 S. typhi Ty2 peptides and proteins observed for each growth condition

S. typhimurium LT2 peptides and proteins observed for each growth condition

A

log

stat

MgM

total

log

stat

MgM

total

peptide protein

30 763 1792

33 008 1820

31 980 1855

43 115 2066

28 529 1801

30 646 1951

32 076 2053

41 905 2261

S. typhi Ty2 peptides and proteins observed for each sample preparation method B

Rapigest

global

soluble

insoluble

total

peptide protein

24 817 1761

25 331 1613

24 784 1396

16 152 1385

43 115 2066

were first summed and then the count for each condition was divided by that sum value. An arbitrary value of 1 was supplied for missing data points (i.e., proteins not observed in a specific condition). The effect of this procedure was to normalize protein measurements to a similar magnitude, regardless of the total number of analyses and the total number of peptide identifications. Because of the assignment of 1 for missing data, those proteins with few total observations (i.e., peptides detected) were less likely to show significant differences between conditions. Proteins lists, including the observation counts per condition were subjected to hierarchical and K-means cluster analysis, using MeVv4.0 (TIGR, Rockville, MD),44 with a correlation by magnitude and shape. MeVv4.0 was then used to query the results for differences among growth conditions and strains. The search for S. typhi and S. typhimurium proteins with similar protein sequences as well as proteins present exclusively in S. typhi was carried out using the BLAST algorithm,45 with the annotated S. typhi Ty2 FASTA data file as the query identification and the annotated S. typhimurium LT2 FASTA data file as the subject identification.

Results and Discussion Sample Preparation Methods. To attain maximum proteome coverage, S. typhi cells from each growth condition, logarithmic and stationary phases and growth in MgM, were subjected to four differing sample preparation methods applicable to peptide level bottom-up proteomics: namely, (1) global tryptic digest on whole-cell lysates, (2) soluble preparation, (3) insoluble preparation on the pellet remaining from the soluble protein separation, and (4) commercially available Rapigest. The combined data sets from the above sample preparation methods were used for the proteomics analysis in this study. Major trends observed in the analysis of the aggregate data set held when individual sample preparation conditions were analyzed. Therefore, they constituted pseudoreplicate analyses. A similar pseudoreplicate analysis approach has been previously described.14 Table 2B shows the number of unique peptides and proteins observed for each sample preparation method. Samples prepared using the Rapigest method yielded 1761 proteins, representing ∼85% of the total identified proteins, and the global tryptic digest method yielded 1613 proteins, representing ∼78% of total protein identifications. Not surprisingly, the partitioned soluble (1396 proteins) and insoluble (1385 proteins) preparations had fewer identified proteins, representing 68 and 67% of the total identified proteins, respectively. Furthermore, proteomics analysis of unfractionated biological replicates prepared using the Rapigest method also revealed that major trends observed in the above-described aggregate data set held across biological 550


replicates (data not shown). More importantly, the major conclusions drawn from the proteomics analyses were supported by orthogonal validation methods. S. typhi Proteome. The S. typhi genome contains 4319 open reading frames that code for predicted proteins. Our analysis identified a combined total of 43 115 unique S. typhi peptides, from all growth conditions and subsequent sample preparation methods, which passed all filters with an estimated false discovery rate e 0.1% (see the Materials and Methods). These filter-passing peptides corresponded to 2066 S. typhi proteins (Table 2A), representing ∼50% coverage of the S. typhi annotated genome, with all protein identifications required to have at least three peptide observations that met our filtering criteria (see the Materials and Methods). This level of coverage represents a typical level of coverage in line with, and in some cases exceeding, results from previous Salmonella proteome analyses.14,46,47 However, we recognize the presence of multiple factors that potentially prevent 100% coverage. These include the fact that we are not sampling every possible growth condition for S. typhi. Furthermore, not all open reading frames are translated into proteins, and errors in genome annotation can lead to genomic sequences being misannotated as open reading frames. It is also possible that further protein and peptide separation methods could enable improved coverage of low abundance and previously unidentified proteins. In the present study, we collected 25 fractions from strong cation fractionations of the sample for subsequent capillary LC-MS analysis. The identified proteins represent a broad spectrum of gene products, with no apparent biases toward a specific functional category (Table 3). As a general overview, proteins thought to be involved in energy metabolism represented the largest group of proteins (450; ∼17%) observed in the S. typhi proteome, while proteins involved with signal transduction represented the smallest group of proteins (7; ∼0.3%) observed in the proteome. Growth Condition Comparisons. To gain a comprehensive view of the S. typhi Ty2 proteome, relative changes in protein abundance were examined across the three previously described growth conditions: logarithmic and stationary phases and growth in MgM (Table 2). Of the 2066 total proteins identified from the combined results, 1551 (75%) proteins were detected in all conditions and 1802 (87%) proteins were detected in at least two conditions. This is in line with the expectation that discrete sets of proteins will either be expressed or not expressed under a given growth condition. It is possible because of the stochastic nature by which peptides are detected that the lack of detection of proteins in certain conditions observed may be due to the lack of detection among mass spectrometry analyses. However, this is unlikely because trends observed in the analysis of the combined results held

research articles

Proteomics of S. typhi

Table 3. Functional Categories of Observed S. typhi Ty2 Proteome: The Institute for Genomic Research “Functional Categories for the Entire Annotated Genome and Characterized Genome” functional categories

amino acid biosynthesis biosynthesis of co-factors, prosthetic groups, and carriers cell envelope cellular processes central intermediary metabolism DNA metabolism energy metabolism fatty acid and phospholipid metabolism mobile and extrachromosomal element functions protein fate protein synthesis purines, pyrmidines, nucleosides, and nucleotides regulatory functions transcription transport and binding proteins unclassified or unknown function hypothetical proteins signal transduction

total from genome

percent of genome

total in observed proteome

percent of the observed proteome

fraction of category observed

121 155

1.9 2.5

104 114

4.0 4.4

0.86 0.74

258 247 158

4.1 4.0 2.5

144 134 101

5.5 5.2 3.9

0.56 0.54 0.64

147 1263 69

2.4 20.0 1.1

92 450 41

3.5 17.0 1.6

0.63 0.36 0.59

142

2.3

10

152 830 90

2.4 13.0 1.4

83 326 68

3.2 13.0 2.6

0.55 0.39 0.76

919 69 391

15.0 1.1 6.3

315 47 132

12.0 1.8 5.1

0.34 0.68 0.34

498

8.0

257

9.9

0.52

706 20

11.0 0.32

179 7

6.9 0.27

0.25 0.35

when individual sample preparation conditions were analyzed. Owing to the approximate similarity and size of the proteomes in the above growth conditions, hierarchical cluster analysis was used to provide a global overview that visually highlighted proteins disproportionately or exclusively observed in a particular growth condition (Figure 1). K-means clustering was then used to identify clusters of proteins that were uniquely and/or highly expressed in a particular growth condition (Figure 1 and Supplementary Table 1 in the Supporting Information). There were 129 proteins (from one cluster; top panel) that appeared to be both uniquely and highly expressed in the log growth condition. These proteins included known host cell invasion proteins (OrgA, InvH, SirA, SopE, SpaN, SpaT, SipA, SipB, and SipD), Vi polysaccharide biosynthesis proteins (TviE and TviD), and flagellar biosynthesis proteins (FlgD, FliZ, and FliT). A total of 81 proteins (from one cluster; bottom panel) were observed to be highly expressed almost exclusively under stationary growth conditions. These proteins included ribosome modulation factor (Rmf), a key indicator of the stationary-phase growth condition, and ethanolamine utilization proteins (EutB, EutL, and EutN). In the MgM growth condition, 97 proteins (from a single cluster; middle panel) were both highly abundant and almost uniquely expressed in this condition, including products of the biotin (bio) operon (BioA, BioB, BioD, and BioF), hemolysin E (HlyE), and a toxin-like protein (CdtB).48,49 Also included in this cluster were Mg2+ transport proteins (MgtA, MgtB, and MgtC), products of SPI-2 virulence genes (SseA, SseB, SsaU, and SsaV), PagC, PqaB, and PgtE. Faucher and colleagues recently analyzed the transcriptome of S. typhi within human macrophages.50 They observed that a number of genes were upregulated at all measured intracel-

0.40

0.07

lular time points once S. typhi was within macrophages, which suggests these genes are important for S. typhi survival within macrophages. These upregulated genes included pgtE, pagC, pagD, mig-14, mgtB, mgtC, and SPI-2 virulence genes, among others. These observations are in broad agreement with results from the present study, in which we observed high expression of SPI-2 virulence proteins (SseA, SseB, SsaU, and SsaV), MgtB, MgtC, PagC, and PgtE almost exclusively under the MgM growth condition, which is thought to loosely approximate the in vivo infectious host cell condition. Analysis of Proteins Common to S. typhi and S. typhimurium. An analysis of S. typhimurium LT2 data was performed in parallel with the S. typhi Ty2 work for comparative purposes. Our analyses identified a combined total of 41 905 unique S. typhimurium LT2 peptides and 2261 proteins (Table 2). There appeared to be a high degree of overlap between the S. typhi Ty2 and S. typhimurium LT2 proteomes, with a total of 1951 identified proteins common to both serotypes based on a filtering criteria of a percent sequence identity (% ID) value of g60% and a BLAST45 e value of e0.15. An analysis of relative changes in abundance of identified S. typhi Ty2 proteins and their corresponding homologues in S. typhimurium LT2 (% ID g 80%) as a function of the growth condition revealed a cluster of proteins that appeared to be highly expressed in both organisms under the log growth condition (top panel in Figure 2 and Supplementary Table 1 in the Supporting Information). The cluster contained 60 proteins, including multiple flagellar proteins (e.g., FliZ, FliT, and FlgD) and multiple conserved hypothetical proteins. When grown to log phase, Salmonella are known to express components of SPI-1 that are required for host cell invasion. The global regulator Fis, which has been shown to strongly activate Journal of Proteome Research • Vol. 7, No. 2, 2008 551

research articles

Ansong et al.

Figure 1. Heat map representation of the global overview of S. typhi Ty2 growth condition comparison showing specific clusters of identified proteins that were highly expressed and nearly unique in each of the three growth conditions is displayed. Observation counts of the peptides for each protein are used to represent a relative protein quantitation. The observation counts were normalized by dividing each protein value with the sum of values of that protein row, and the scale from least abundant to highest ranges from 0 to 1 and green to red. The columns in the heat map represent the growth conditions: log phase (Log), stationary phase (Stat), and MgM growth (MgM).

Figure 2. Heat map representation of identified proteins common to both S. typhi Ty2 (STP) and S. typhimuriym LT2 (STM), showing specific clusters of proteins that were highly expressed under log and MgM growth in both organisms and highly expressed under MgM growth in S. typhi Ty2 but not S. typhimurium LT2. Observations counts of the peptides for each protein are used to represent a relative protein quantitation. The observation counts were normalized by dividing each protein value with the sum of values of that protein row, and the scale from least abundant to highest ranges from 0 to 1 and green to red. The columns in the heat map represent the growth conditions: log phase (Log), stationary phase (Stat), and MgM growth (MgM).

SPI-1 virulence genes, also strongly activates flagellar gene expression.51,52 Hence, the presence of multiple flagellar proteins under conditions that induce expression of SPI-1 is not surprising. Indeed, Salmonella motility enhances cell contact to the benefit of the bacteria. 552


A cluster of proteins common to both S. typhi Ty2 and S. typhimurium LT2 appeared to be highly expressed under the MgM growth condition for both serotypes (middle panel in Figure 2 and Supplementary Table 1 in the Supporting Information). This cluster contained 46 proteins, including Mg2+ transport proteins (MgtA, MgtB, and MgtC), SPI-2 virulence proteins (SsaV and SseB), phosphate regulon sensor protein (PhoR), and outer membrane protease E (PgtE). The low pH, low Mg2+ MgM media, which is designed to approximate the phagosome of infected macrophages, is known to induce the expression of SPI-2 virulence genes and other genes related to virulence and intramacrophage survival.18–26 Thus, the observed upregulation of the products of SPI-2 virulence genes, pgtE, and the mgtBC operon is consistent and serves to further validate the data. In addition, Mg2+ is essential for membrane integrity,53 ribosome function,54 and cell growth,55 and the increased expression of Mg2+ transport proteins under low Mg2+ conditions would be expected for the bacterium to survive and grow. Additionally, a cluster of 63 proteins appeared to be highly expressed in one serotype (S. typhi Ty2) but not the other (S. typhimurium LT2) under the MgM growth condition (bottom panel in Figure 2 and Supplementary Table 1 in the Supporting Information). This observation is of interest because the MgM growth condition is thought to loosely mimic the low Mg2+ and low pH environment in a host cell, and proteins expressed under this condition in S. typhi but not S. typhimurium may contribute to S. typhi virulence within human macrophages. Further analysis of this cluster (Supplementary Figure 2 in the Supporting Information) revealed a striking difference between the two serotypes with regard to the peptide observation counts for products of the biotin (bio) operon; i.e., these products were observed more frequently in S. typhi Ty2 than in S. typhimurium LT2. Expression of the mgtBC operon, a known virulence determinant, is induced within macrophages, as well as under the MgM growth condition. Inspection of the mgtBC operon peptide count (Supplementary Figure 2 in the Supporting Information) revealed similar observation counts for S. typh-


research articles

Figure 3. Heat map representation of identified S. typhi Ty2-specific proteins showing specific cluster of proteins highly and uniquely expressed under MgM growth. Observations counts of the peptides for each protein are used to represent a relative protein quantitation. The observation counts were normalized by dividing each protein value with the sum of values of that protein row, and the scale from least abundant to highest ranges from 0 to 1 and green to red. The columns in the heat map represent the growth conditions: log phase (Log), stationary phase (Stat), and MgM growth (MgM).

imurium LT2 and S. typhi Ty2. These observations prompted us to further explore the strain specificity of the differential expression of biotin synthesis proteins. To this end, we included the S. typhimurium 14028 strain (previously published data)14 in our comparative analysis. We observed biotin synthesis proteins more frequently in the S. typhimurium 14028 and S. typhi Ty2 strains compared to the S. typhimurium LT2 strain (Supplementary Figure 2 and Supplementary Table 2 in the Supporting Information). Both S. typhimurium 14028 and S. typhi Ty2 possess a wild-type copy of rpoS. In contrast, S. typhimurium LT2 is known to harbor a nonfunctional rpoS that is responsible for virulence attenuation, among other things. The increased expression of biotin synthesis proteins in the more virulent S. typhimurium 14028 and S. typhi Ty2 strains under conditions considered to approximate the environment within a host cell condition seems to suggest a possible role for biotin synthesis proteins in Salmonella virulence. However, a more detailed and thorough examination of this interesting observation is warranted to determine the possible contribution of bio gene expression to Salmonella pathogenesis. Interestingly, a known regulator of Salmonella pathogenecity (Fis) has been shown to regulate both the biotin operon and the propanediol utilization (pdu) operon,51 which a recent study14 suggests contributes to S. typhimurium pathogenesis. Analysis of Proteins Exclusively Present in S. typhi. It is speculated that a number of proteins exclusively present in S. typhi versus S. typhimurium may represent virulence factors that play roles in aspects of its specificity for human hosts. We queried our list of identified S. typhi Ty2 proteins against a database of all S. typhi Ty2 proteins and their corresponding homologues in S. typhimurium LT2 (% ID g 60%) based on the genomic annotation. This search revealed a group of 50 identified S. typhi Ty2 proteins that were exclusively present in S. typhi Ty2 (Supplementary Table 1 in the Supporting Information), determined on the basis of having no significant homologues in S. typhimurium LT2. This group included virulence (Vi) antigen biosynthesis and export proteins, multiple hypothetical and conserved hypothetical proteins, a toxinlike protein (CdtB), hemolysin E (HlyE), and putative bacteriophage proteins. Further analysis of this protein group revealed a subset of proteins that were highly and uniquely expressed under the MgM growth condition (Figure 3) that included a conserved hypothetical protein [locus tag (t) 1109], a hypothetical protein [t1476], hemolysinE (HlyE) [t1477], a

toxin-like protein (CdtB) [t1111], and a putative pertussis-like toxin subunit [t1108]. This subset of proteins is of special interest because the MgM growth condition is thought to approximate the environment found within the Salmonella-containing vacuoles that are observed in infected host macrophages; proteins exclusively present in S. typhi and expressed under this condition may play a role in the host specificity of S. typhi and in virulence within human macrophages. HemolysinE (HlyE) [t1477] belongs to a newly defined family of pore-forming toxins that has been identified in Escherichia coli K12, avian E. coli, Shigella flexneri, and S. typhi but not in other Salmonella serotypes. Sequence comparisons show Shigella HlyE, S. typhi HlyE, and avian E. coli HlyE to be highly homologous (98, 92, and 74% sequence identity, respectively) to E. coli K12 HlyE. In fact, 68% of residues are identical among the four sequences.56 Some studies56–59 have suggested that cytolytic factors, such as this family of pore-forming toxins, are important for virulence of pathogenic bacteria. Furthermore, hemolysinE is a known virulence factor of avian pathogenic E. coli; infections with this pathogen cause colibacillosis, an acute and mostly systemic disease.60 Immediately adjacent to t1477 is t1476, which encodes a hypothetical protein with unknown function. Given their similar expression patterns and genomic location, it is interesting to speculate that t1476 and t1477 are part of an operon that plays a role in the human-specific aspects of S. typhi pathogenesis. A recent transcriptomic study50 has identified a set of genes that were upregulated at all measured intracellular time points once S. typhi was within macrophages and suggested that the upregulated genes are important for S. typhi survival within macrophages. Interestingly, this group of genes included t1476 and hlyE (t1477), providing further validation of our in vitro approach. Cytolethal distending toxins (Cdt) are produced by several pathogenic bacteria that cause persistent infectious diseases. This toxin is composed of three subunits: CdtB, the enzymatically active subunit, as well as CdtA and CdtC that mediate delivery of CdtB into host cells.61,62 S. typhi is the only Salmonella serotype known to possess an open reading frame (t1111) predicted to encode a CdtB homologue.11,13 A recent study demonstrated that S. typhi cdtB is only expressed inside host cells, producing a CdtB-dependent Cdt activity despite the absence of CdtA and CdtC.48 In addition, a transcriptomic analysis of S. typhi within human macrophages50 revealed that cdtB was highly expressed once S. typhi was phagocytosed, Journal of Proteome Research • Vol. 7, No. 2, 2008 553

research articles suggesting that cdtB may be required for adaptation and survival within human macrophages. In the former study, Haghjoo and co-workers observed no cdtB expression when S. typhi was grown in LB broth to late logarithmic growth phase, consistent with results from the present study; we also note no expression of cdtB when S. typhi was grown in LB broth to logarithmic or stationary growth phase. Expression of cdtB was however only detected by Haghjoo and co-workers upon S. typhi infection of host cells, in agreement with our observation of cdtB expression (data not shown) exclusively under the MgM growth condition, which is designed to mimic the intracellular condition. In combination, these observations further validate our proteomic observations and methods and also demonstrate the utility of the MgM culture condition as an appropriate model for host cell infection conditions. The role of Cdt in S. typhi pathogenesis remains unclear; however, the above observations invite speculation that CdtB may play a role in human host specificity of S. typhi. Genes t1108 and t1109 are predicted to encode a putative pertussis-like toxin subunit (the ADP- ribosylating activity subunit) and a conserved hypothetical protein of unknown function, respectively. A number of important bacterial exotoxins, including pertussis toxin, diphtheria toxin, and cholera toxin, are ADP-ribosyl transferases that modify host cell proteins.63 Whether the predicted gene product of t1108 is expressed and functional in S. typhi is still unclear. In the present study, we observed high expression of the predicted t1108 gene product under the MgM condition, validating the computationally predicted t1108 gene at the level of translation. Both t1108 and t1109 are part of a gene cluster that also includes t1111 (cdtB) within a region of the chromosome that is absent from other Salmonella serotypes. Interestingly, this region is marked by features characteristic of horizontally acquired genetic material, such as remnants of insertion sequences and a transposase gene. It is possible that the acquisition of these genes and their subsequent expression plays an important role in S. typhi pathogenesis. Furthermore, this apparent gene cluster (t1108, t1109, and t1111) has previously been observed to be upregulated after S. typhi entry into human macrophages,50 suggesting that these genes may encode specific factors required for virulence and survival in human macrophages. Validation of Differentially Expressed Proteins. To confirm some of the changes in protein expression observed in our proteomics analysis, we performed Western blot analysis for the differentially expressed proteins T1108, T1476, BioB, BioD, and HlyE. T1108, T1476, and HlyE were chosen on the basis of being exclusively present in S. typhi Ty2 and being highly expressed under conditions that are considered to loosely mimic the infective state in macrophage cells in the proteomics data. BioB and BioD, representative of the bio operon, were selected for verification because members of the bio operon exhibited increased expression in the more virulent S. typhimurium 14028 and S. typhi Ty2 strains in contrast to the virulence attenuated S. typhimurium LT2 strain under conditions that approximate the environment within the infected host cell in the proteomics data. We constructed S. typhi Ty2 mutant strains for these studies by placing a cyaA′ tag at the C termini of the t1108, t1476, bioB, bioD, and hlyE genes, which allowed for subsequent detection of the protein products via Western hybridization from each of these genes. S. typhi Ty2 was grown under the three previously described conditions. Immunoblot analysis of protein samples extracted from cells 554


Ansong et al. grown under each growth condition showed that BioB and BioD (Supplementary Figure 3 in the Supporting Information) and HlyE (Figure 4A) were highly expressed in MgM growth condition and not expressed under either log- or stationaryphase growth conditions, confirming the changes observed by proteomics analysis. Similarly, T1108 and T1476 appeared to be expressed at very low levels during the log-phase growth condition and not expressed under the stationary growth condition, in contrast to the MgM growth condition, where T1108 and T1476 are highly expressed (Figure 4A), in apparent agreement with the changes observed by proteomics analysis. As a negative control for the above experiment, we examined the expression of proteins from untagged S. typhi Ty2, designated as wild type (WT), and as a positive control, we examined the expression of S. typhimurium mutant strain sseJ-cyaA′. SseJ is a TTSS effector protein required for full virulence and has been shown to be expressed in vivo upon infection of macrophages. As expected, we observed high expression of SseJ in the MgM growth condition as well as a relatively lower expression level in the stationary growth condition. The WT control exhibited no detectable expression in line with our expectation. To evaluate the presence of these proteins in a more relevant environment for infection, we examined the expression of T1108, T1476, BioB, BioD, and HlyE in the THP-1 human macrophage cell line. Results from this experiment (Figure 4B) demonstrated that HlyE, T1108, and T1476 were indeed expressed in a macrophage-like cell line, in agreement with results from the model culture conditions, perhaps suggesting a role for T1108, T1476, and HlyE during macrophage infection. However, the results (Figure 4B) also showed that BioB and BioD were not expressed in a macrophage-like cell line. This apparent disparity between results from the model culture condition and the macrophage-like cell line highlights the “model” nature of media-based approaches and demonstrates the need to further validate proteomic results verified in model culture conditions in the appropriate cellular context. We also examined the expression of SseJ in the THP-1 human macrophage cell line as a positive control and the expression of proteins from WT and a no infection control condition as negative controls. In line with the expected results, SseJ was expressed, while there was no expression detected in the lanes marked “No infection” and “WT”. Thus, for T1108, T1476, and HlyE, the Western blot results confirmed the changes observed by proteomic analysis. When these results are taken together, they suggest that T1108, T1476, and HlyE play a role in S. typhi intramacrophage survival and virulence. In addition, these results further demonstrate the utility of the model culture conditions for identifying proteins that may be regulated for pathogenesis and, importantly, also demonstrate that caution must be taken in interpreting results solely in the context of media-based approaches.

Conclusion Despite being very similar genetically, S. typhi and S. typhimurium have markedly different infection profiles. S. typhi possesses a narrow host range and causes a systemic infection, while S. typhimurium has a broad host range and causes gastroenteritis in humans. We performed a comparative LC-MSbased proteomics study of S. typhi Ty2 and S. typhimurium LT2 to gain insights into the molecular determinants that contribute to the narrow host range and pathogenecity of S. typhi. To this end, we evaluated relative changes in protein abundances across log- and stationary-phase cultures that


research articles

Figure 4. (A) Immunoblot analysis of T1108, T1476, and HlyE protein levels from S. typhi Ty2 log-phase LB, stationary-phase LB, and MgM cultures. Strains expressing cyaA′-tagged variants of t1108 (t1108-cyaA), t1476 (t1476-cyaA), hlyE (hlyE-cyaA), and sseJ (sseJ-cyaA) genes were cultured as described in the Materials and Methods. SseJ was included as a positive reference control to demonstrate the expression of a known secreted effector required for virulence. As a negative control, the expression of proteins from untagged S. typhi Ty2, designated as WT, was also examined. Protein samples corresponding to equivalent cell numbers were probed for the presence of each epitope-tagged protein. HlyE is not expressed during log- or stationary-phase growth. Exposure to MgM media strongly induced the synthesis of HlyE. T1108 and T1476 are expressed at very low levels during log-phase growth and not expressed during stationary-phase growth, in contrast to MgM, where T1108 and T1476 are highly expressed. The expression pattern of controls WT and SseJ is as expected, with no special expression and MgM-based expression respectively. (B) Immunoblot analysis of T1108, T1476, BioB, BioD, and HlyE protein levels from S. typhi, following infection of a THP-1 human macrophage cell line. T1108, T1476, and HlyE are expressed, while BioB and BioD are not expressed upon S. typhi infection of human macrophages, suggesting that T1108, T1476, and HlyE play a role in S. typhi intramacrophage survival and virulence. As expected, no expression is seen in the WT and No infection controls, while SseJ, a known secreted effector, is expressed. Journal of Proteome Research • Vol. 7, No. 2, 2008 555

research articles represented standard free-living growth and growth in MgM, which is designed to mimic the intracellular environment within infected macrophages. A number of proteins identified as unique to S. typhi Ty2 appeared highly expressed in MgM media. This subset of proteins is of special interest because the MgM growth condition is thought to approximate the environment found within the Salmonella-containing vacuoles that are observed in infected host macrophages; proteins exclusively present in S. typhi and expressed under this condition may play a role in the host specificity of S. typhi and in virulence within human macrophages. These proteins included a toxin-like protein (CdtB), hemolysinE (HlyE), and gene products of t0142, t1108, t1109, t1476, and t1602. The observed differential expression of the HlyE, T1108, and T1476 proteins was confirmed by Western blot analysis and suggests a role for this subset of proteins in S. typhi pathogenesis.

Acknowledgment. The authors gratefully acknowledge the contributions of Liang Shi, Therese R. W. Clauss, Matthew Monroe, and Penny Colton for their assistance in preparing this paper. This work was funded by the National Institute of Allergy and Infectious Diseases NIH/DHHS through interagency agreement Y1-AI-4894-01. Significant portions of the work were performed in the Environmental Molecular Science Laboratory, a U.S. Department of Energy (DOE) national scientific user facility at Pacific Northwest National Laboratory (PNNL) in Richland, WA. PNNL is operated for the DOE by Battelle Memorial Institute under contract DE-AC05-76RLO-1830. Supporting Information Available: Supplementary Tables 1 and 2 and Figures 1-3. This information is available free of charge via the Internet at http://pubs.acs.org. In addition to the material hosted by Journal of Proteome Research, supporting results, spectra, and protocols are available at the National Institute of Allergy and Infectious Diseases funded Administrative Resource for Biodefense Proteomics Research Centers under the PNNL data section for S. typhi (http:// www.proteomicsresource.org/). References (1) Pang, T.; Bhutta, Z. A.; Finlay, B. B.; Altwegg, M. Typhoid fever and other salmonellosis: A continuing challenge. Trends Microbiol. 1995, 3, 253–255. (2) Chalker, R. B.; Blaser, M. J. A review of human salmonellosis: III. Magnitude of Salmonella infection in the United States. Rev. Infect. Dis. 1988, 10, 111–124. (3) Ivanoff, B.; Levine, M. M. Typhoid fever: Continuing challenges from a resilient bacterial foe. Bull. Inst. Pasteur 1997, 95, 129– 142. (4) Rowe, B.; Ward, L. R.; Threlfall, E. J. Multidrug-resistant Salmonella typhi: A worldwide epidemic. Clin. Infect. Dis. 1997, 24 (Suppl. 1), S106–S109. (5) Eisenstein, T. K. Mucosal immune defense: The Salmonella typhimurium model. In Intracellular Bacterial Vaccine Vectors; Paterson, Y., Ed.; Wiley-Liss, Inc.: New York, 1999; pp 51–109. (6) Jones, B. D.; Falkow, S. Salmonellosis: Host immune responses and bacterial virulence determinants. Annu. Rev. Immunol. 1996, 14, 533–561. (7) Mastroeni, P. Immunity to systemic Salmonella infections. Curr. Mol. Med. 2002, 2, 393–406. (8) Mittrucker, H. W.; Kaufmann, S. H. Immune response to infection with Salmonella typhimurium in mice. J. Leukocyte Biol. 2000, 67, 457–463. (9) Santos, R. L.; Zhang, S.; Tsolis, R. M.; Kingsley, R. A.; Adams, L. G.; Baumler, A. J. Animal models of Salmonella infections: Enteritis versus typhoid fever. Microbes Infect. 2001, 3, 1335–1344. (10) Tsolis, R. M.; Kingsley, R. A.; Townsend, S. M.; Ficht, T. A.; Adams, L. G.; Baumler, A. J. Of mice, calves, and men. Comparison of the

556


Ansong et al.

(11)

(12)

(13)

(14)

(15)

(16) (17)

(18)

(19)

(20)

(21) (22) (23) (24) (25)

(26)

(27) (28)

mouse typhoid model with other Salmonella infections. Adv. Exp. Med. Biol. 1999, 473, 261–274. Deng, W.; Liou, S. R.; Plunkett, G., III; Mayhew, G. F.; Rose, D. J.; Burland, V.; Kodoyianni, V.; Schwartz, D. C.; Blattner, F. R. Comparative genomics of Salmonella enterica serovar Typhi strains Ty2 and CT18. J. Bacteriol. 2003, 185, 2330–2337. McClelland, M.; Sanderson, K. E.; Spieth, J.; Clifton, S. W.; Latreille, P.; Courtney, L.; Porwollik, S.; Ali, J.; Dante, M.; Du, F.; Hou, S.; Layman, D.; Leonard, S.; Nguyen, C.; Scott, K.; Holmes, A.; Grewal, N.; Mulvaney, E.; Ryan, E.; Sun, H.; Florea, L.; Miller, W.; Stoneking, T.; Nhan, M.; Waterston, R.; Wilson, R. K. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 2001, 413, 852–856. Parkhill, J.; Dougan, G.; James, K. D.; Thomson, N. R.; Pickard, D.; Wain, J.; Churcher, C.; Mungall, K. L.; Bentley, S. D.; Holden, M. T.; Sebaihia, M.; Baker, S.; Basham, D.; Brooks, K.; Chillingworth, T.; Connerton, P.; Cronin, A.; Davis, P.; Davies, R. M.; Dowd, L.; White, N.; Farrar, J.; Feltwell, T.; Hamlin, N.; Haque, A.; Hien, T. T.; Holroyd, S.; Jagels, K.; Krogh, A.; Larsen, T. S.; Leather, S.; Moule, S.; O’Gaora, P.; Parry, C.; Quail, M.; Rutherford, K.; Simmonds, M.; Skelton, J.; Stevens, K.; Whitehead, S.; Barrell, B. G. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 2001, 413, 848–852. Adkins, J. N.; Mottaz, H. M.; Norbeck, A. D.; Gustin, J. K.; Rue, J.; Clauss, T. R.; Purvine, S. O.; Rodland, K. D.; Heffron, F.; Smith, R. D. Analysis of the Salmonella typhimurium proteome through environmental response toward infectious conditions. Mol. Cell. Proteomics 2006, 5, 1450–1461. Hixson, K. K.; Adkins, J. N.; Baker, S. E.; Moore, R. J.; Chromy, B. A.; Smith, R. D.; McCutchen-Maloney, S. L.; Lipton, M. S. Biomarker candidate identification in Yersinia pestis using organism-wide semiquantitative proteomics. J. Proteome Res. 2006, 5, 3008–3017. Lucas, R. L.; Lee, C. A. Unravelling the mysteries of virulence gene regulation in Salmonella typhimurium. Mol. Microbiol. 2000, 36, 1024–1033. Shi, L.; Adkins, J. N.; Coleman, J. R.; Schepmoes, A. A.; Dohnkova, A.; Mottaz, H. M.; Norbeck, A. D.; Purvine, S. O.; Manes, N. P.; Smallwood, H. S.; Wang, H.; Forbes, J.; Gros, P.; Uzzau, S.; Rodland, K. D.; Heffron, F.; Smith, R. D.; Squier, T. C. Proteomic analysis of Salmonella enterica serovar typhimurium isolated from RAW 264.7 macrophages: Identification of a novel protein that contributes to the replication of serovar typhimurium inside macrophages. J. Biol. Chem. 2006, 281, 29131–29140. Alpuche Aranda, C. M.; Swanson, J. A.; Loomis, W. P.; Miller, S. I. Salmonella typhimurium activates virulence gene transcription within acidified macrophage phagosomes. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 10079–10083. Beuzon, C. R.; Banks, G.; Deiwick, J.; Hensel, M.; Holden, D. W. pH-dependent secretion of SseB, a product of the SPI-2 type III secretion system of Salmonella typhimurium. Mol. Microbiol. 1999, 33, 806–816. Buchmeier, N.; Blanc-Potard, A.; Ehrt, S.; Piddington, D.; Riley, L.; Groisman, E. A. A parallel intraphagosomal survival strategy shared by mycobacterium tuberculosis and Salmonella enterica. Mol. Microbiol. 2000, 35, 1375–1382. Chakravortty, D.; Rohde, M.; Jager, L.; Deiwick, J.; Hensel, M. Formation of a novel surface structure encoded by Salmonella pathogenicity island 2. EMBO J. 2005, 24, 2043–2052. Deiwick, J.; Hensel, M. Regulation of virulence genes by environmental signals in Salmonella typhimurium. Electrophoresis 1999, 20, 813–817. Deiwick, J.; Nikolaus, T.; Erdogan, S.; Hensel, M. Environmental regulation of Salmonella pathogenicity island 2 gene expression. Mol. Microbiol. 1999, 31, 1759–1773. Garcia Vescovi, E.; Soncini, F. C.; Groisman, E. A. Mg2+ as an extracellular signal: Environmental regulation of Salmonella virulence. Cell 1996, 84, 165–174. Heithoff, D. M.; Conner, C. P.; Hentschel, U.; Govantes, F.; Hanna, P. C.; Mahan, M. J. Coordinate intracellular expression of Salmonella genes induced during infection. J. Bacteriol. 1999, 181, 799– 807. Rappl, C.; Deiwick, J.; Hensel, M. Acidic pH is required for the functional assembly of the type III secretion system encoded by Salmonella pathogenicity island 2. FEMS Microbiol. Lett. 2003, 226, 363–372. Worley, M. J.; Ching, K. H.; Heffron, F. Salmonella SsrB activates a global regulon of horizontally acquired genes. Mol. Microbiol. 2000, 36, 749–761. Hmiel, S. P.; Snavely, M. D.; Miller, C. G.; Maguire, M. E. Magnesium transport in Salmonella typhimurium: Characteriza-

research articles


(29)

(30) (31) (32)

(33)

(34)

(35) (36)

(37)

(38) (39)

(40)

(41) (42)

(43)

(44)

tion of magnesium influx and cloning of a transport gene. J. Bacteriol. 1986, 168, 1444–1450. Beuzon, C. R.; Meresse, S.; Unsworth, K. E.; Ruiz-Albert, J.; Garvis, S.; Waterman, S. R.; Ryder, T. A.; Boucrot, E.; Holden, D. W. Salmonella maintains the integrity of its intracellular vacuole through the action of SifA. EMBO J. 2000, 19, 3235–3249. Geddes, K.; Worley, M.; Niemann, G.; Heffron, F. Identification of new secreted effectors in Salmonella enterica serovar Typhimurium. Infect. Immun. 2005, 73, 6260–6271. Datsenko, K. A.; Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 6640–6645. Ohlson, M. B.; Fluhr, K.; Birmingham, C. L.; Brumell, J. H.; Miller, S. I. SseJ deacylase activity by Salmonella enterica serovar Typhimurium promotes virulence in mice. Infect. Immun. 2005, 73, 6249–6259. Smith, P. K.; Krohn, R. I.; Hermanson, G. T.; Mallia, A. K.; Gartner, F. H.; Provenzano, M. D.; Fujimoto, E. K.; Goeke, N. M.; Olson, B. J.; Klenk, D. C. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85. Adkins, J. N.; Varnum, S. M.; Auberry, K. J.; Moore, R. J.; Angell, N. H.; Smith, R. D.; Springer, D. L.; Pounds, J. G. Toward a human blood serum proteome: Analysis by multidimensional separation coupled with mass spectrometry. Mol. Cell. Proteomics 2002, 1, 947–955. Washburn, M. P.; Wolters, D.; Yates, J. R., III. Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat. Biotechnol. 2001, 19, 242–247. Strittmatter, E. F.; Kangas, L. J.; Petritis, K.; Mottaz, H. M.; Anderson, G. A.; Shen, Y.; Jacobs, J. M.; Camp, D. G., II; Smith, R. D. Application of peptide LC retention time information in a discriminant function for peptide identification by tandem mass spectrometry. J. Proteome Res. 2004, 3, 760–769. Keller, A.; Nesvizhskii, A. I.; Kolker, E.; Aebersold, R. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal. Chem. 2002, 74, 5383– 5392. Gao, J.; Opiteck, G. J.; Friedrichs, M. S.; Dongre, A. R.; Hefta, S. A. Changes in the protein expression of yeast as a function of carbon source. J. Proteome Res. 2003, 2, 643–649. Ishihama, Y.; Oda, Y.; Tabata, T.; Sato, T.; Nagasu, T.; Rappsilber, J.; Mann, M. Exponentially modified protein abundance index (emPAI) for estimation of absolute protein amount in proteomics by the number of sequenced peptides per protein. Mol. Cell. Proteomics 2005, 4, 1265–1272. Jacobs, J. M.; Diamond, D. L.; Chan, E. Y.; Gritsenko, M. A.; Qian, W.; Stastna, M.; Baas, T.; Camp, D. G., II; Carithers, R. L., Jr.; Smith, R. D.; Katze, M. G. Proteome analysis of liver cells expressing a full-length hepatitis C virus (HCV) replicon and biopsy specimens of posttransplantation liver from HCV-infected patients. J. Virol. 2005, 79, 7558–7569. Liu, H.; Sadygov, R. G.; Yates, J. R., III. A model for random sampling and estimation of relative protein abundance in shotgun proteomics. Anal. Chem. 2004, 76, 4193–4201. Qian, W. J.; Jacobs, J. M.; Camp, D. G., II; Monroe, M. E.; Moore, R. J.; Gritsenko, M. A.; Calvano, S. E.; Lowry, S. F.; Xiao, W.; Moldawer, L. L.; Davis, R. W.; Tompkins, R. G.; Smith, R. D. Comparative proteome analyses of human plasma following in vivo lipopolysaccharide administration using multidimensional separations coupled with tandem mass spectrometry. Proteomics 2005, 5, 572–584. VerBerkmoes, N. C.; Shah, M. B.; Lankford, P. K.; Pelletier, D. A.; Strader, M. B.; Tabb, D. L.; McDonald, W. H.; Barton, J. W.; Hurst, G. B.; Hauser, L.; Davison, B. H.; Beatty, J. T.; Harwood, C. S.; Tabita, F. R.; Hettich, R. L.; Larimer, F. W. Determination and comparison of the baseline proteomes of the versatile microbe Rhodopseudomonas palustris under its major metabolic states. J. Proteome Res. 2006, 5, 287–298. Saeed, A. I.; Sharov, V.; White, J.; Li, J.; Liang, W.; Bhagabati, N.; Braisted, J.; Klapa, M.; Currier, T.; Thiagarajan, M.; Sturn, A.;

(45) (46)

(47)

(48)

(49) (50)

(51)

(52)

(53) (54) (55) (56)

(57) (58) (59)

(60) (61) (62) (63)

Snuffin, M.; Rezantsev, A.; Popov, D.; Ryltsov, A.; Kostukovich, E.; Borisovsky, I.; Liu, Z.; Vinsavich, A.; Trush, V.; Quackenbush, J. TM4: A free, open-source system for microarray data management and analysis. BioTechniques 2003, 34, 374–378. Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. Coldham, N. G.; Woodward, M. J. Characterization of the Salmonella typhimurium proteome by semi-automated two dimensional HPLC-mass spectrometry: Detection of proteins implicated in multiple antibiotic resistance. J. Proteome Res. 2004, 3, 595–603. Nunn, B. L.; Shaffer, S. A.; Scherl, A.; Gallis, B.; Wu, M.; Miller, S. I.; Goodlett, D. R. Comparison of a Salmonella typhimurium proteome defined by shotgun proteomics directly on an LTQ-FT and by proteome pre-fractionation on an LCQ-DUO. Briefings Funct. Genomics Proteomics 2006, 5, 154–168. Haghjoo, E.; Galan, J. E. Salmonella typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterial-internalization pathway. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 4614–4619. Haghjoo, E.; Galan, J. E. Identification of a transcriptional regulator that controls intracellular gene expression in Salmonella typhi. Mol. Microbiol. 2007, 64, 1549–1561. Faucher, S. P.; Porwollik, S.; Dozois, C. M.; McClelland, M.; Daigle, F. Transcriptome of Salmonella enterica serovar Typhi within macrophages revealed through the selective capture of transcribed sequences. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 1906–1911. Kelly, A.; Goldberg, M. D.; Carroll, R. K.; Danino, V.; Hinton, J. C.; Dorman, C. J. A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella enterica serovar Typhimurium. Microbiology 2004, 150, 2037–2053. Wilson, R. L.; Libby, S. J.; Freet, A. M.; Boddicker, J. D.; Fahlen, T. F.; Jones, B. D. Fis, a DNA nucleoid-associated protein, is involved in Salmonella typhimurium SPI-1 invasion gene expression. Mol. Microbiol. 2001, 39, 79–88. Laires, M. J.; Monteiro, C. P.; Bicho, M. Role of cellular magnesium in health and human disease. Front. Biosci. 2004, 9, 262–276. Klein, D. J.; Moore, P. B.; Steitz, T. A. The contribution of metal ions to the structural stability of the large ribosomal subunit. RNA 2004, 10, 1366–1379. Hartwig, A. Role of magnesium in genomic stability. Mutat. Res. 2001, 475, 113–121. Wallace, A. J.; Stillman, T. J.; Atkins, A.; Jamieson, S. J.; Bullough, P. A.; Green, J.; Artymiuk, P. J. E. coli hemolysin E (HlyE, ClyA, SheA): X-ray crystal structure of the toxin and observation of membrane pores by electron microscopy. Cell 2000, 100, 265–276. Finlay, B. B.; Falkow, S. Common themes in microbial pathogenicity revisited. Microbiol. Mol. Biol. Rev. 1997, 61, 136–169. Oscarsson, J.; Mizunoe, Y.; Li, L.; Lai, X. H.; Wieslander, A.; Uhlin, B. E. Molecular analysis of the cytolytic protein ClyA (SheA) from Escherichia coli. Mol. Microbiol. 1999, 32, 1226–1238. Oscarsson, J.; Westermark, M.; Lofdahl, S.; Olsen, B.; Palmgren, H.; Mizunoe, Y.; Wai, S. N.; Uhlin, B. E. Characterization of a poreforming cytotoxin expressed by Salmonella enterica serovars typhi and paratyphi A. Infect. Immun. 2002, 70, 5759–5769. Ewers, C.; Janssen, T.; Wieler, L. H. Avian pathogenic Escherichia coli (APEC). Berl. Muench. Tierarztl. Wochenschr. 2003, 116, 381– 395. Lara-Tejero, M.; Galan, J. E. CdtA, CdtB, and CdtC form a tripartite complex that is required for cytolethal distending toxin activity. Infect. Immun. 2001, 69, 4358–4365. Lara-Tejero, M.; Galan, J. E. Cytolethal distending toxin: Limited damage as a strategy to modulate cellular functions. Trends Microbiol. 2002, 10, 147–152. Pallen, M. J.; Lam, A. C.; Loman, N. J.; McBride, A. An abundance of bacterial ADP-ribosyltransferases—Implications for the origin of exotoxins and their human homologues. Trends Microbiol. 2001, 9, 302–307, discussion 308.

PR070434U

Journal of Proteome Research • Vol. 7, No. 2, 2008 557

Proteomics Analysis of the Causative Agent of Typhoid Fever - Journal

Recommend Documents