Pterostilbene enhances TRAIL-induced apoptosis through the

Article Cite This: J. Agric. Food Chem. 2017, 65, 11179−11191

pubs.acs.org/JAFC

Pterostilbene Enhances TRAIL-Induced Apoptosis through the Induction of Death Receptors and Downregulation of Cell Survival Proteins in TRAIL-Resistance Triple Negative Breast Cancer Cells Chao-Ming Hung,†,‡ Liang-Chih Liu,§,∥ Chi-Tang Ho,⊥ Ying-Chao Lin,*,#,¶,£ and Tzong-Der Way*,¥,$ †

Department of General Surgery, E-Da Hospital, I-Shou University, Kaohsiung, Taiwan School of Medicine, I-Shou University, Kaohsiung, Taiwan § Department of Surgery, China Medical University Hospital, Taichung, Taiwan ∥ School of Medicine, College of Medicine, China Medical University, Taichung, Taiwan ¥ Department of Biological Science and Technology, College of Biopharmaceutical and Food Sciences, China Medical University, Taichung, Taiwan ⊥ Department of Food Science, Rutgers University, New Brunswick, New Jersey 08901, United States # Division of Neurosurgery, Buddhist Tzu Chi General Hospital, Taichung Branch, Taichung, Taiwan ¶ School of Medicine, Tzu Chi University, Hualien, Taiwan £ Department of Medical Imaging and Radiological Science, Central Taiwan University of Science and Technology, Taichung, Taiwan $ Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan ‡

ABSTRACT: Tumor necrosis factor-related apoptosis-induced ligand (TRAIL) is nontoxic to normal cells and preferentially cytotoxic to cancer cells. Recent data suggest that malignant breast cancer cells often become resistant to TRAIL. Pterostilbene (PTER), a naturally occurring analogue of resveratrol found in blueberries, is known to induce cancer cells to undergo apoptosis. In the present study, we examined whether PTER affects TRAIL-induced apoptosis and its mechanism in TRAIL-resistant triple negative breast cancer (TNBC) cells. Our data indicated that PTER induced apoptosis (14.68 ± 3.78% for 40 μM PTER vs 1.98 ± 0.25% for control, p < 0.01) in TNBC cells and enhanced TRAIL-induced apoptosis in TRAIL-resistant TNBC cells (18.45 ± 4.65% for 40 μM PTER vs 29.38 ± 6.35% for combination of 40 μM PTER and 100 ng/mL TRAIL, p < 0.01). We demonstrated that PTER induced death receptors DR5 and DR4 as well as decreased decoy receptor DcR-1 and DcR-2 expression. PTER also decreased the antiapoptotic proteins c-FLIPS/L, Bcl-Xl, Bcl-2, survivin, and XIAP. PTER induced the cleavage of bid protein and caused proapoptotic Bax accumulation. Moreover, we found that PTER induced the expression of DR4 and DR5 through the reactive oxygen species (ROS)/ endoplasmic reticulum (ER) stress/ERK 1/2 and p38/C/EBP-homologous protein (CHOP) signaling pathways. Overall, our results showed that PTER potentiated TRAIL-induced apoptosis via ROS-mediated CHOP activation leading to the expression of DR4 and DR5. KEYWORDS: TRAIL, pterostilbene, triple negative breast cancer, death receptor, ROS

■

receptor, i.e., osteoprotegerin (OPG).3 The DR4 and DR5 can trigger apoptosis in TRAIL-sensitive human cancer cells,4 whereas DcR-1 and DcR-2 completely or partially lack functional death domains, and therefore cannot trigger apoptosis.5 Moreover, compared to the other death receptors, OPG has a lower binding affinity to TRAIL.6 It has been demonstrated that TRAIL has long been perceived as a potential chemotherapeutic agent. However, it has now emerged that many human cancer cells are intrinsically resistant to TRAIL.3 Therefore, it would be necessary to identify sensitizing agents capable of increasing TRAIL-mediated cell death. Deregulation of apoptotic pathways plays important roles in the resistance of human cancer cells to TRAIL-induced

INTRODUCTION Triple-negative breast cancer (TNBC) is a heterogeneous group of diseases with poor prognosis. TNBC does not express estrogen receptor/progesterone receptor (ER/PR) or HER-2, which can be targeted by available therapies. Therefore, TNBC does not respond to hormonal therapy (such as tamoxifen or aromatase inhibitors) or therapies that target HER2 (such as Herceptin).1 TNBC can only be treated with combination therapies such as radiation therapy, surgery, and chemotherapy, therefore, identification of novel targeted and biologic therapies for TNBC would be of great benefit. A proapoptotic molecule, tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), selectively induces apoptosis in a variety of human tumor cell lines without affecting normal cells.2 Previous studies showed interaction of human TRAIL ligand with two agonistic receptors, i.e., TRAIL receptors 1 (DR4) and 2 (DR5), two antagonistic decoy receptors, i.e., TRAIL receptors 3 (DcR-1) and 4 (DcR-2), and a soluble © 2017 American Chemical Society

Received: Revised: Accepted: Published: 11179

May 20, 2017 November 20, 2017 November 22, 2017 November 22, 2017 DOI: 10.1021/acs.jafc.7b02358 J. Agric. Food Chem. 2017, 65, 11179−11191

Article

Journal of Agricultural and Food Chemistry

Figure 1. PTER induced apoptosis in TRAIL-resistant cells. (A) Chemical structure of PTER. (B) BT-20 and MDA-MB-468 cells were treated with TRAIL (0, 25, 50, 100, and 200 ng/mL) for 48 h, and cell viability was quantitated by MTT assay. (C) BT-20 and MDA-MB-468 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h, and cell viability was quantitated by MTT assay. (D) In the colony formation assay, BT-20 cells were treated with 10, 20, and 40 μM PTER and stained with Giemsa. (E) BT-20 cells were treated with 40 μM PTER for 12, 24, and 48 h. (F) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. Cells were stained with PI, and the sub-G1 fraction was analyzed using flow cytometry. (G) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (H) BT-20 cells were treated with 40 μM PETR for 12, 24, 48 h. Whole-cell extracts were prepared and analyzed by Western blotting using antibodies against PARP and cleaved-PARP. Western blot data presented are representative of those obtained in at least three separate experiments. Data are expressed as mean ± SD. *, P < 0.05; **, P < 0.01.

endoplasmic reticulum kinase (PERK), inositol-requiring kinase 1 (IRE1), and activating transcription factor 6 (ATF6), conduct ER stress. During ER stress, the PERK/eukaryotic initiation factor-2α (eIF2α) signaling pathway plays an important role in the three pathways.14,15 Recent studies found that pterostilbene (PTER), a natural dimethylated analogue of resveratrol from blueberries, have biological activities including anticancer, anti-inflammation, and so on. Previous research has indicated that PTER triggers cell cycle arrest or apoptosis in lung cancer,16 leukemia,17 breast cancer,18 and prostate cancer.19 We reported recently that PTER stimulates Fas signaling, which drives epithelial−mesenchymal transition (EMT) through the ERK1/2 and GSK3β/β-catenin signaling pathway and also triggers autophagy in TNBC.20 However, it is unclear whether PTER can sensitize TNBC cells to TRAIL-induced apoptosis.

apoptosis. Mutations in DR4 and DR5 or absent of them on the cell surface can cause human cancer cell resistance to TRAILmediated apoptosis.7 Moreover, the upregulation of DcR-1 and DcR-2 does not have the ability to trigger apoptosis.8 The downregulation of caspase 8 or Fas-associated death domain (FADD),7 overexpression of cFLIP or antiapoptotic Bcl-xL or Bcl-2, or loss of Bax proapoptotic function shows a correlation with TRAIL resistance in multiple cancers.9,10 Recent studies indicated that DR5 is a critical mediator of endoplasmic reticulum (ER) stress-induced apoptosis.11,12 Several studies have suggested that C/EBP-homologous protein (CHOP) is one of the most highly inducible genes during ER stress, and this provides an important role for the link between DR5 and ER stress. It has also been documented that CHOP can regulate the transcriptional expression of DR5 through binding to the CHOP-binding site in the DR5 gene 5′-flanking regions.13 Three ER stress transducers, namely, protein kinase R-like 11180

DOI: 10.1021/acs.jafc.7b02358 J. Agric. Food Chem. 2017, 65, 11179−11191

Article


Figure 2. PTER-potentiated TRAIL-induced apoptosis of TNBC cells. (A) BT-20 and MDA-MB-468 cells were treated with TRAIL (100 ng/mL) and with or without 40 μM PTER for 48 h. Cell viability was determined by MTT assay, as described in Materials and Methods. #, ##, P < 0.05, significant when compared to PTER. (B) In the colony formation assay, BT-20 and MDA-MB-468 cells were treated with TRAIL (100 ng/mL) and with or without 40 μM PTER and stained with Giemsa. (C) BT-20 and MDA-MB-468 cells were treated with TRAIL (100 ng/mL) and with or without 40 μM PTER for 48 h. Cells were stained with PI, and the sub-G1 fraction was analyzed using flow cytometry. Data are expressed as mean ± SD. #, P < 0.001, significant when compared to PTER. (D) BT-20 and MDA-MB-468 cells were treated with TRAIL (100 ng/mL) and with or without 40 μM PTER for 48 h. Whole-cell extracts were prepared and analyzed by Western blotting using antibodies against procaspase-3, procaspase-8, procaspase-9, and cleaved-PARP. Western blot data presented are representative of those obtained in at least three separate experiments. USA). We purchased recombinant human soluble TRAIL from PeproTech (Rocky Hill, NJ, USA). Cell Culture and Treatments. We obtained BT-20, MCF-7, MDAMB-468, HL-60, SKOV3, MDA-MB-231, PC3, DU145, A549, and H1299 cells from the American Type Culture Collection (Manassas, VA, USA). The cells were maintained in medium supplemented with 10% fetal bovine serum (FBS), 100 μg of streptomycin, 100 U of penicillin, and 2 mM L-glutamine (Invitrogen Corporation, Carlsbad, CA, USA). Cells were kept at 37 °C in a humidified 5% CO2 incubator. MTT Assay. To determine the cell viability, the number of all viable cells was estimated by the uptake of the MTT. Approximately 1 × 104 cells were plated in 24-well plates overnight. Cells were treated with reagents as indicated in the legend. Cells were then incubated with 100 μL of 1 μg/mL MTT for 2 h at 37 °C. The purple insoluble formazan was further dissolved using 80 μL of DMSO. Readings were recorded at 570 nm using an enzyme-linked immunosorbent assay (ELISA) microplate reader. Cell Clonogenic Assay. Cells were plated overnight in six-well plates and then treated with reagents as indicated in the legend. The colonies were cultured in an incubator at 5% CO2 with a controlled temperature of 37 °C. The colony formation varies from 2 to 3 weeks for different cells. Finally, colonies were fixed for 15 min by 100% ice-cold methanol and stained with Giemsa staining. Colonies with >50 cells were counted using an inverted microscope. Flow Cytometric Analysis. Approximately 5 × 105 cells were treated with different reagents as indicated in the legend. The cells were fixed with 500 μL of precooled 70% ethanol at −20 °C overnight and

We aim to identify the effect of PTER on TRAIL-induced apoptosis in TRAIL-resistance TNBC cells. Overall, our results demonstrate that PTER could sensitize the TRAIL-induced apoptosis through upregulating the expression of DR4 and DR5 and modulating the antiapoptotic proteins expression. Moreover, PTER induces the expression of DR4 and DR5 via the ROS/ER stress/ERK 1/2 and p38/CHOP signaling pathways.

■

MATERIALS AND METHODS

Chemicals. We purchased β-actin antibody, N-acetylcysteine (NAC), PTER, propidium iodide (PI), and 3-[4,5-dimethylthiazol-2yl]-2,5-diphenyltetrazolium (MTT) from Sigma Chemical Co. (St. Louis, MO, USA). We purchased SB203580, SP600125, and PD98059 from Calbiochem (San Diego, CA, USA). We purchased PARP, cleavedPARP, procaspase-9, procaspase-8, procaspase-3, survivin, Bcl-xL, Bcl-2, p-ERK1/2 (Thr202/Tyr204), ERK1/2, p-JNK1/2 (Thr 183/Tyr 185), JNK1/2, p-p38 (Thr180/Tyr182), p38, CHOP, p-eIF2α (Ser51), and GRP78 antibodies from Cell Signaling Technology (Danvers, MA, USA). We purchased DR4 and DR5 antibodies from Abcam Inc. (Cambridge, MA, USA) and Novus Biologicals (Littleton, CO, USA), respectively. We purchased Bax, Bid, XIAP, c-FLIP-S, and c-FLIP-L antibodies from Santa Cruz Biotechnology (Santa Cruz, CA, USA). We purchased DcR1 and DcR2 antibodies from ProSci Inc. (Poway, CA, USA). We purchased HRP-conjugated goat anti-mouse IgG and goat anti-rabbit IgG secondary antibodies from Millipore (Billerica, MA, 11181


Article


Figure 3. Effects of PTER on antiapoptotic and proapoptotic protein expression. (A) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (B) BT-20 cells were treated with 40 μM for 12, 24, and 48 h. Whole-cell extracts were prepared and analyzed by Western blotting using antibodies against cFLIP-L, cFLIP-S, Bcl-2, Bcl-xL, survivin, and XIAP. (C) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (D) BT-20 cells were treated with 40 μM PTER for 12, 24, and 48 h. Whole-cell extracts were prepared and analyzed by Western blotting using antibodies against Bax and Bid. Western blot data presented are representative of those obtained in at least three separate experiments. considered statistically significant and highly significant (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

then were washed, pelleted, and resuspended in PBS containing 100 mg/mL RNase, 0.1% Triton X-100, and 0.04 mg/mL of PI. The level of apoptotic cells was analyzed by FACScan and Cell Quest software. For DR5 staining, live cells were incubated with DR5 antibody. Western Blotting Analysis. Protein expressions were carried out by Western blotting according to our previous study.21 Cells on 10 cm culture dishes (1 × 106 cells/dish) were treated with reagents as indicated in the legend. Protein concentration was determined by BioRad Protein Assay (Bio-Rad, Hercules, CA, USA). Proteins (50 μg) from the whole cell were separated using sodium dodecyl sulfate− polyacrylamide gel electrophoresis (SDS−PAGE) and transferred to nitrocellulose membrane. The membranes were blocked in TBST contained 5% nonfat milk and 0.1% NaN3. Finally, membrane was hybridized with primary and secondary antibody, and immunoreactive bands were presented using the ECL Prime Western Blotting Detection Reagent (GE Healthcare UK Ltd.). Transfection. The shRNA and siRNA sequences used here were as follows: DR5, AAGUUGCAGCCGUAGUCUUGA; CHOP, AAGAACCAGCAGAGGUCACAA. The cells were transiently transfected in 2 mL of OPTI-MEM (GIBCO, Carlsbad, CA, USA) containing 9 μL of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), with 50 nmol/L CHOP-siRNA and DR5-shRNA. After 6 h of transfection, the medium was changed to complete growth medium for 24 h. Determination of ROS. Approximately 5 × 104 cells were treated with different reagents as indicated in the legend for 24 h. Cells were stained with 10 mM DCFDA in 1× buffer for 15 min, and the intensity of fluorescence was measured by flow cytometry. Statistical Analysis. Student’s t-tests can be used to detect a statistical difference in means between two groups. All results were expressed as means ± standard deviation (SD) of at least three independent experiments. The P values of less than 0.05 were

■

RESULTS PTER Inhibits the Proliferation and Induces Apoptosis in Highly TRAIL-Resistant BT20 Cells. To examine the mechanisms of TRAIL resistance in TNBC cells, we compared the sensitivity of TRAIL in MDA-MB-468 and BT-20 cells. As shown in Figure 1B, MDA-MB-468 cells were less sensitive and BT-20 cells were resistant to TRAIL-induced apoptosis. Our findings indicated that the BT-20 cells were highly resistant to TRAIL-induced apoptosis. We next examined the antiproliferative activity of PTER (Figure 1A) in MDA-MB-468 and BT-20 cells. The MDA-MB-468 and BT-20 cells were treated with increasing concentrations of PTER for 48 h, and a marked dosedependent inhibition of cell proliferation was consistently observed (Figure 1C). Interestingly, PTER inhibited the proliferation in highly TRAIL-resistant BT20 cells. The colony formation test also revealed that PTER inhibited the colony formation in highly TRAIL-resistant BT20 cells (Figure 1D). To confirm whether PTER induced apoptosis, we observed the distribution of apoptotic cells by PI staining in BT-20 cells. An apoptotic fraction of subdiploid cells was detected as a “sub-G1” peak. We found that PTER treatment significantly induced apoptosis in a time-dependent (Figure 1E) and dose-dependent manner (Figure 1F). Moreover, PTER effectively enhanced PARP cleavage in a dose-dependent (Figure 1G) and timedependent manner (Figure 1H). Our results provide the first set 11182


Article


Figure 4. PTER induced DR4 and DR5 expression and suppressed decoy receptors. (A) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (B) BT-20 cells were treated with 40 μM for 12, 24, 48 h. Whole-cell extracts were prepared and analyzed for DR4 and DR5 expression by Western blotting. (C) BT-20 cells were treated with 40 μM PTER for 48 h, and flow cytometry was used to analyze DR5 surface expression. (D) BT-20 cells were transfected with DR5 shRNA. Twenty-four hours after the transfection, the cells were treated with TRAIL (100 ng/ mL) and 40 μM PTER for 48 h. Cell viability was determined by MTT assay, as described in Materials and Methods. Data are expressed as mean ± SD. **, P < 0.01. (E) Several cancer cells were treated with 40 μM PTER for 48 h. Whole-cell extracts were prepared and analyzed for DR4 and DR5 expression by Western blotting. (F) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (G) BT-20 cells were treated with 40 μM PTER for 12, 24, and 48 h. Whole-cell extracts were prepared and analyzed for DcR1 and DcR2 expression by Western blotting. Western blot data presented are representative of those obtained in at least three separate experiments.

combination with TRAIL in MDA-MB-468 and BT-20 cells. The combined treatment with PTER and TRAIL strongly reduced cell viability (Figure 2A) and the colony formation in TRAILresistant TNBC cells (Figure 2B). Our results suggest that PTER plus TRAIL combined therapy effectively inhibited cell viability in TRAIL-resistant TNBC cells. We next examined whether the

of evidence that PTER inhibits the proliferation and induces apoptosis in highly TRAIL-resistant BT20 cells. PTER Sensitizes TNBC Cells to TRAIL-Induced Apoptosis. Next, we identified whether PTER was able to sensitize TRAIL-resistant TNBC cells to TRAIL-induced apoptosis. We sought to identify the potential toxicity effect of PTER alone or in 11183


Article


Figure 5. Upregulation of DR4 and DR5 by PTER was mediated by ROS. (A) BT-20 cells were treated with 40 μM PTER for indicated times and then stained with DCFDA. (B) BT-20 cells were pretreated with 10 mM NAC for 1 h, then treated with or without PTER (0, 10, 20, or 40 μM) for 6 h, and then stained with DCFDA. The flow cytometry was used to determine the fluorescence intensity of DCFDA in the cells. (C) BT-20 cells were pretreated with 1, 5, or 10 mM NAC for 1 h and then treated with 40 μM PTER for 48 h. Whole-cell extracts were prepared and analyzed for DR4 and DR5 expression by Western blotting. (D) BT-20 cells were pretreated with 10 mM NAC for 1 h and then treated with 40 μM PTER or 100 ng/mL TRAIL for 48 h. Whole-cell extracts were prepared and analyzed for PARP and cleaved-PARP expression by Western blotting. Western blot data presented are representative of those obtained in at least three separate experiments. (E) BT-20 cells were pretreated with 10 mM NAC for 1 h and then treated with 40 μM PTER or 100 ng/mL TRAIL for 48 h. Cells were stained with PI, and the sub-G1 fraction was analyzed using flow cytometry. Data are expressed as mean ± SD. **, P < 0.01.

expression of proapoptotic proteins. The cleaved form of Bid (tBid) and the upregulation of proapoptotic member bax was also induced by PTER in a dose-dependent (Figure 3C) and timedependent manner (Figure 3D). Our data suggest that the mitochondrial pathway of apoptosis provided an important component in PTER sensitizing TNBC cells to TRAIL-induced apoptosis. PTER Upregulates the Expression of Death Receptors in TNBC Cells. A recent study found that if cancer cells lose expression of DR4 and DR5 expression may develop resistance to TRAIL.7 This study aimed to investigate the effects of PTER on DR4 and DR5 expression in TNBC cells. These data confirm that PTER significantly induced the expression of DR4 and DR5 in a dose-dependent (Figure 4A) and time-dependent manner (Figure 4B). We next used flow cytometry to identify whether PTER induced the expression of DR5. As shown in Figure 4C, PTER increased the expression of DR5 on the cell surface. To analyze whether the upregulation of DR5 played an important role in mediating TRAIL-induced apoptosis by PTER, we stably transfected BT-20 cells with shRNA against DR5. As shown in

decreased cell viability from combined treatment was due to induction of apoptosis. A combined treatment of 100 ng/mL TRAIL and 40 μM PTER for 48 h significantly increased apoptosis (Figure 2C), whereas PTER or TRAIL alone did not. Moreover, our study indicated that the combined therapy significantly increased the activity of caspase-3, caspase-8, caspase-9, and PARP (Figure 2D). These results suggest that PTER sensitizes TNBC cells to TRAIL-induced apoptosis through the activation of caspase activity. PTER Suppresses the Expression of Antiapoptotic Members. The antiapoptotic members of the Bcl-2 family are well-known for their ability to suppress TRAIL-induced apoptosis.9,10 Next, we investigated whether the alteration in expression levels of antiapoptotic proteins involved in PTER enhanced TRAIL-induced apoptosis. We treated BT-20 cells with PTER and then investigated the expression of Bcl-2, Bcl-xL, cFLIP-L, cFLIP-S, survivin, and XIAP. The data indicated that expression of antiapoptotic members was suppressed by PTER in a dose-dependent (Figure 3A) and time-dependent manner (Figure 3B). Next, we tested whether PTER affected the 11184


Article


Figure 6. Upregulation of DR4 and DR5 was ERK1/2 and p38 dependent. (A) BT-20 cells were treated with 40 μM PTER for 12, 24, and 48 h, and whole-cell extracts were subjected to Western blotting for phosphorylated ERK1/2, p38, and JNK and ERK1/2, p38, and JNK. BT-20 cells were pretreated with 20 μM JNK inhibitor, SP600125 (B); 10 μM p38 inhibitor, SB203580 (C); and 20 μM ERK1/2 inhibitor, PD98059 (D), for 1 h and then treated with 40 μM PTER for 48 h. Whole-cell extracts were prepared and analyzed by Western blotting using DR4 and DR5 antibodies. (E) BT-20 cells were pretreated with 10 mM NAC for 1 h and then treated with 40 μM PTER for indicated times. Whole-cell extracts were prepared and analyzed for phosphorylated ERK1/2, p38, and JNK and ERK1/2, p38, and JNK. Western blot data presented are representative of those obtained in at least three separate experiments.

(SKOV3), breast cancer cells (MCF-7 and MDA-MB-231), lung cancer cells (H1299 and A549), and leukemia cells (HL60). Therefore, it suggests that PTER induction of the expression of DR4 and DR5 is not cell type specific. PTER Downregulates DcRs. Antiapoptotic receptors, DcRs can compete with DRs for TRAIL binding.5 Next, we analyzed whether PTER potentiated TRAIL-induced apoptosis by downregulating DcRs expression. As expected, PTER treatment resulted in downregulating DcR-1 and DcR-2 expression in a dose-dependent (Figure 4F) and time-dependent manner

Figure 4D, transfection of cells with shRNA of DR5 effectively inhibited the PTER/TRAIL-induced apoptosis. Our results find that PTER potentiates TRAIL-induced cytotoxicity in TNBC cells via upregulating DR4 and DR5 expression. PTER Induces the Expression of DR4 and DR5 Is Not Restricted to Only One Cell Type. We also investigated whether PTER induction of the expression of DR4 and DR5 was specific to TNBC cells or also occurred in other cell types. Figure 4E shows that PTER induced the expression of DR4 and DR5 in prostate cancer cells (PC3 and DU145), ovarian cancer cells 11185


Article


Figure 7. PTER induced ER stress. (A) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (B) BT-20 cells were treated with 40 μM PTER for 12, 24, and 48 h. Whole-cell extracts were prepared and analyzed for p-eIF2α and GRP78 expression by Western blotting. (C) BT-20 cells were pretreated with 10 mM NAC for 1 h and then treated with 40 μM PTER or 100 ng/mL TRAIL for 48 h. Whole-cell extracts were prepared and analyzed for p-eIF2α and GRP78 expression by Western blotting. Western blot data presented are representative of those obtained in at least three separate experiments. The values below the figures represent change in protein expression of the bands normalized to β-actin.

activation of ERK1/2, p38, and JNK1/2, the inhibitors for p38 (SB203580), JNK1/2 (SP600125), and ERK1/2 (PD98059) were used. We found that treatment with SP600125 (JNK1/2 inhibitor) cannot inhibit PTER-induced DR4 and DR5 upregulation (Figure 6B). However, the SB203580 (p38 inhibitor) (Figure 6C) and PD98059 (ERK1/2 inhibitor) (Figure 6D) suppressed PTER-induced DR4 and DR5 upregulation, which suggested that ERK1/2 and p38 were needed for DR4 and DR5 upregulation. Next, we examined whether ROS regulated PTER-induced activation of ERK1/2 and p38. We found that pretreating cells with NAC suppressed PTER-induced phosphorylation of ERK1/2 and p38 (Figure 6E). Overall, our findings indicate that PTER-induced ROS production is important for the activation of ERK1/2 and p38, which in turn led to induction of the DR4 and DR5. PTER Induces ER Stress Response and Leads to DR4and DR5-Dependent Apoptosis. Recent study demonstrated that ER stress is critical for TRAIL-induced cell death by inducing the expression of DR5.25,26 We next investigated whether PTER affected the ER stress-induced pathways. We observed that PTER increased the protein expression or phosphorylation of ER stress marker (e.g., p-eIF2α and GRP78) in a dose-dependent (Figure 7A) and time-dependent manner (Figure 7B). Since oxidative stress was involved in ER stress-induced ischemic neuronal cell death,27 we further demonstrated whether ROS production could be involved in PTER-induced ER stress. As shown in Figure 7C, NAC pretreatment inhibited PTER/ TRAIL-induced phosphorylation of eIF2α and GRP78 upregulation. These data support our hypothesis that ROS generation is critical for PTER/TRAIL-induced ER stress. PTER Induces DR4 and DR5 Expression through CHOP Activation. A recent study showed that CHOP is an ER stressinduced transcription factor and important transcription factor of DR5;13 we next examined whether PTER induced CHOP expression. We found that PTER treatment could result in a greatly increased amount of CHOP protein levels in a dose-

(Figure 4G). Thus, it is clear that PTER might potentiate TRAIL-induced apoptosis by downregulating DcR-1 and DcR-2 expression. PTER Upregulation of DR4 and DR5 Expression Appear To Be Dependent on the Formation of ROS. Recent studies have shown that increased oxidative stress will induce the expression of DRs.22 Therefore, we examined whether PTER increased the intracellular ROS levels. After treatment with PTER, we used dichlorofluorescein diacetate (DCFH-DA) dye to detect the levels of intracellular ROS produced. We found that ROS induction by PTER occurred in a time-dependent manner (Figure 5A). We next used N-acetylcysteine (NAC), a thiol antioxidant which is known to function as a reactive oxygen intermediate scavenger, to test whether ROS were involved in PTER/TRAIL-induced apoptosis. Our study found that NAC pretreatment reduced the upregulation of ROS by PTER treatment (Figure 5B). NAC also suppressed PTER-induced DR4 and DR5 upregulation (Figure 5C). Moreover, PTER significantly enhanced TRAIL-induced PARP cleavage in BT-20 cells, and NAC pretreatment significantly attenuated PTER/ TRAIL-induced PARP cleavage (Figure 5D). A combination of 40 μM PTER and 100 ng/mL TRAIL significantly enhanced the accumulation of cells in the sub-G1 phase (Figure 5E), and NAC pretreatment significantly attenuated PTER/TRAIL-induced apoptosis. Therefore, our data find that the generation of ROS and caspase activation are critical for PTER/TRAIL-induced apoptosis. Upregulation of DR4 and DR5 by PTER Are ERK1/2 and p38 Dependent. Several studies have shown that the signals of MAPKs are very likely related to the induction of TRAIL receptor;23,24 we examined whether ERK1/2, p38, or JNK activation exerted their role in PTER-induced DR4 and DR5 upregulation. Our data indicated that treatment with PTER resulted in an activation of ERK1/2, p38, and JNK1/2 in a timedependent manner (Figure 6A). Next, to investigate whether PTER upregulated DR4 and DR5 expression by modulating the 11186


Article


Figure 8. Induction of DR4 and DR5 by PTER was mediated through CHOP activation. (A) BT-20 cells were treated with various concentrations of PTER (0, 10, 20, 40, and 80 μM) for 48 h. (B) BT-20 cells were treated with 40 μM PTER for 12, 24, and 48 h. Whole-cell extracts were prepared and analyzed for CHOP expression by Western blotting. (C) BT-20 cells were pretreated with 10 mM NAC for 1 h and then treated with 40 μM PTER or 100 ng/mL TRAIL for 48 h. BT-20 cells were transfected with CHOP siRNA. (D) Twenty-four hours after the transfection, the cells were treated with 40 μM PTER for 48 h. Whole-cell extracts were prepared and analyzed for CHOP, DR4, and DR5 expression by Western blotting. (E) Twenty-four hours after the transfection, the cells were treated with 40 μM PTER or 100 ng/mL TRAIL for 48 h. Cells were stained with PI, and the sub-G1 fraction was analyzed using flow cytometry. BT-20 cells were pretreated with (F) 10 μM p38 inhibitor, SB203580, and (G) 20 μM ERK1/2 inhibitor, PD98059, for 1 h and then treated with 40 μM PTER for 48 h. Whole-cell extracts were prepared and analyzed by Western blotting using CHOP antibody. (H) BT20 cells were pretreated with 10 μM p38 inhibitor, SB203580, or 20 μM ERK1/2 inhibitor, PD98059, for 1 h and then treated with 40 μM PTER or 100 ng/mL TRAIL for 48 h. Cells were stained with PI, and the sub-G1 fraction was analyzed using flow cytometry. Western blot data presented are representative of those obtained in at least three separate experiments. Data are expressed as mean ± SD. **, P < 0.01; ***, P < 0.001.

dependent (Figure 8A) and time-dependent manner (Figure 8B). We further demonstrated whether ROS generation is critical for PTER-induced upregulation of CHOP and DRs. We observed that NAC pretreatment significantly attenuated PTER-induced upregulation of DR4, DR5, and CHOP expression (Figure 8C). We used CHOP siRNA to examine whether CHOP played a critical role in PTER-induced upregulation of DR4 and DR5. The results revealed that transfection with CHOP siRNA significantly attenuated PTERinduced upregulation of DR4 and DR5 (Figure 8D), while

control-transfected (scrambled RNA) had no effect. A combination of 40 μM PTER and 100 ng/mL TRAIL significantly induced apoptosis (Figure 8E), while CHOP siRNA significantly attenuated PTER/TRAIL-induced apoptosis. This result suggests that CHOP seems to play an important role in PTER-induced upregulation of DR4 and DR5 and PTER/ TRAIL-induced apoptosis. Upregulation of CHOP by PTER Is Mediated through ERK1/2 and p38. We next investigated whether PTER induced CHOP upregulation through ERK1/2 and p38 activation. Our 11187


Article


activation in TNBC cells through upregulating DR4 and DR5 expression. To our best knowledge, our results highlight the combined PTER and TRAIL treatment induced apoptosis through a novel DRs-mediated mechanism in TNBC cells. Recent studies reported that ROS generation could trigger TRAIL-dependent apoptosis through the upregulation of DRs.37,38 Numerous studies have been described that some flavonoids generate ROS in cancer cells. Yang et al. found that 8bromo-7-methoxychrysin (BrMC) induces apoptosis through the ROS generation in human hepatocellular carcinoma cells.39 Moreover, PTER represses the proliferation of human esophageal cancer cells by upregulating ROS generation and ER stress.40 In agreement with the previous studies, our results indicated that PTER upregulated ROS generation, and NAC, ROS scavengers, attenuated PTER-induced upregulation of DR4 and DR5. Alosi et al. indicated that PTER increased mitochondrial ROS production to trigger human breast cancer cell apoptosis.41 Mannal et al. found that treatment with PTER increased O2− production and caspase-3 activity in breast cancer cells.42 Studies performed by Chakraborty et al. indicated that treatment with PTER induced apoptosis through the production of H2O2 and singlet oxygen in breast cancer cells.43 Collectively, our study is consistent with these findings and implies that PTER increases cellular oxidation to induce TNBC apoptosis. MAPKs have been shown to play a key role in ROS downstream signaling pathways. Moreover, various studies have suggested that MAPKs, including ERK1/2, p38, and JNK, activation is involved in DRs upregulation.44,45 In our study, we found that PTER-induced DR4 and DR5 induction was ERK1/2 and p38 dependent, but not JNK. Our study is consistent with a previous study showing that ERK1/2 and p38 activation mediated emodin-induced apoptosis through upregulating DRs expression.46 Moreover, ampelopsin also upregulates DR4 and DR5 expression through the ERK1/2 and p38 activation.47 Several ER stress inducers, such as thapsigargin,12 tunicamycin,11 and MG132,48 have been implicated in the upregulation of DR5. Here, we found that PTER treatment increased the phosphorylation of eIF2a and upregulation of GRP78, suggesting that PTER induced ER stress. CHOP is an inducible ER stress transcription factor involved in DR5 gene transcription and provided evidence that this links between DR5 and ER stress.13 Here, our findings suggest that CHOP may still be an important mediator for PTER-induced DR4 and DR5 upregulation. Using CHOP siRNA in BT-20 cells significantly blocked PTERinduced DR4 and DR5 upregulation. Therefore, this suggests that PTER upregulated DR4 and DR5 through the ER stressinduced CHOP expression in TNBC cells. A recent study found that berberine-induced apoptosis via ER stress was mediated by ROS in human glioblastoma cells.49 Here, our data revealed that PTER induced CHOP and GRP78 expression via ER stress, while NAC pretreatment attenuated these effects. Overall, our study is consistent with these findings and implies that generation of ROS activates ER stress and CHOP protein expression in TNBC cells. These above results indicated that PTER induced ER stress, CHOP, and DR4/DR5 expression via ROS generation. Moreover, PTER-upregulated ROS generation plays an important role in PTER/TRAIL-induced apoptosis in TNBC cells. A recent study found that piperlongumine selectively induced apoptosis and preferentially inhibited migration/invasion via ROS-ERMAPKs-CHOP axis in HCC cells.50 The possibility is that ER stress induced ERK1/2 and p38 activation and then inducing the expression of CHOP. Further study is necessary to elucidate

study found that the SB203580 (p38 inhibitor) (Figure 8F) and PD98059 (ERK1/2 inhibitor) (Figure 8G) suppressed PTERinduced CHOP upregulation. We further determined whether PTER/TRAIL induced apoptosis through ERK1/2 and p38 activation. The results revealed that PTER/TRAIL significantly increased apoptosis, however, SB203580 (p38 inhibitor) and PD98059 (ERK1/2 inhibitor) significantly attenuated PTER/ TRAIL-induced apoptosis (Figure 8H). These studies indicate that PTER-induced CHOP upregulation and PTER/TRAILinduced apoptosis are mediated through ERK1/2 and p38 activation.

■

DISCUSSION Although amount of tumors remains sensitive to TRAIL-induced apoptosis, some mismatch-repair-deficient tumors evade the proapoptotic effects of TRAIL. Therefore, it is important to find improved and optimized methods that sensitize tumor cells to TRAIL. In our current study, we demonstrated that PTERpotentiated TRAIL-resistant TNBC cells induced apoptosis by upregulating the expression of DR4 and DR5 and by downregulating the expression of survival proteins. Moreover, PTERinduced DR4 and DR5 upregulation is mediated through the ROS/ERK1/2 and p38/CHOP pathway. A previous study indicated that most human breast cancer cell lines are resistant to TRAIL-mediated apoptosis.28 The present study found that BT-20 cells were TRAIL-resistant cells and MDA-MB-468 cells were less sensitive to TRAIL. A recent study found that the mesenchymal phenotype TNBC cells are TRAILsensitive, and the TRAIL-resistant TNBC cells have an epithelial phenotype.29 Our results were consistent with previous studies; the TRAIL-resistant TNBC cells (BT-20 and MDA-MB-468 cells) had an epithelial phenotype. Specifically, our studies found that PTER greatly improved the cytotoxic activity and the antitumor efficacy of TRAIL in TRAIL-resistant TNBC cells. Moreover, our results demonstrated for the first time that PTER enhanced TRAIL-induced caspase-8, caspase-3 activation and PARP cleavage in TNBC cells. Several TRAIL resistance mechanisms have been proposed, including overexpression of antiapoptotic Bcl-2 family members and decoy receptors.7−10 In our study, we found that PTER exerted its effects via several mechanisms. First, PTER decreased the expression of DcR-1 and DcR-2. Moreover, PTER significantly downregulated the expression of antiapoptotic Bcl-2 family members, including Bcl-2, Bcl-xL, cFLIP-L, cFLIPS, survivin, and XIAP.30,31 A recent study found that downregulation of c-FLIP expression sensitizes TRAIL-induced apoptosis in chemotherapy.32 The proapoptotic Bcl-2 family members have been shown to block apoptosis by keeping mitochondrial function.33 Kaempferol enhances TRAIL-mediated apoptosis in human glioma cells through downregulating survivin via proteasome-mediated degradation.34 In agreement with the study, our results indicated that PTER enhanced TRAIL-mediated apoptosis in TNBC cells through downregulating survivin. Overall, our results indicate that Bcl-2, BclxL, cFLIP-L, cFLIP-S, survivin, and XIAP downregulation contributed to PTER-facilitated TRAIL-mediated apoptosis. Studies have shown that DR4 and/or DR5 upregulation can lead to TRAIL-resistant cells to TRAIL-responsive apoptosis.35,36 Here, we have shown that PTER-induced DR4 and DR5 upregulation can convert TRAIL-resistant TNBC cells to TRAIL-responsive apoptosis, as gene silencing of DR5 by RNAi attenuated the PTER/TRAIL-induced apoptosis. Moreover, we reported that PTER enhanced TRAIL-induced caspase 11188


Article


ECL, enhanced chemiluminescence; eIF2α, PERK/eukaryotic initiation factor-2α; ERK, extracellular signal-regulated kinase; ER, estrogen receptor; FADD, fas-associated protein with death domain; FBS, fetal bovine serum; IRE1, inositol-requiring kinase 1; JNK, c-Jun N-terminal kinase; MTT, 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide; MAPKs, mitogen-activated protein kinases; NAC, N-acetylcysteine; OPG, osteoprotegerin; PARP, poly ADP-ribose polymerase; PBS, phosphatebuffered saline; PERK, protein kinase R-like endoplasmic reticulum kinase; PI, propidium iodide; PR, progesterone receptor; ROS, reactive oxygen species; SDS−PAGE, sodium dodecyl sulfate−polyacrylamide; TRAIL, tumor necrosis factor (TNF)-related apoptosis-inducing ligand

whether ERK1/2 and p38 could provide a key mechanistic link between ROS and ER stress. A recent study found that phase II metabolism, including sulfation and glucuronidation, represents the main clearance pathways for PTER.51 Moreover, the levels of the PTER metabolites (both glucuronide and sulfate conjugates) in plasma were significantly higher than the parent compound.51 A recent study also found that PTER exhibits capacity limited elimination as the conjugating enzymes may be saturated at higher doses.52 Interestingly, PTER exhibited superior metabolic stability than resveratrol (10-fold longer transit time and 5-fold lower clearance than resveratrol). This result can be justified by resveratrol having three hydroxyl groups, while PTER contains one hydroxyl group and two methoxy groups. The two methoxy groups cause PTER to be more lipophilic and increase oral absorption. Recent studies found that, given oral intake of PTER, no deaths or abnormal changes were observed in mice.53 In this study, we found that PTER exhibited anticancer activation at the concentration of 40 μM. It is interesting to know how many dietary intakes are needed to reach systemic concentrations of 40 μM in human. After 50 and 250 mg/kg PTER intraperitoneal administration, Pan et al. found that the plasma levels of PTER were 2.24 and 26.85 μg/mL at 30 min, respectively. Moreover, the plasma levels of PTER were 0.05 and 0.39 μg/mL at 24 h, respectively.54 According to this previous study, we suggested that PTER at 40 μM is corresponding to ∼568 mg of daily administration in a 70 kg body weight adult human. In future, the focus of a phase I study will be needed to evaluate the safety of PTER and dosing in humans. Overall, we demonstrate that PTER enhances TRAIL-induced apoptosis via the upregulation of DR4 and DR5 in TNBC cells. Moreover, PTER induces TRAIL sensitivity via the ROS/ER stress/ERK1/2 and p38/CHOP signaling pathways. PTER also downregulated antiapoptotic Bcl-2 family members, including Bcl-2, Bcl-xL, cFLIP-L, cFLIP-S, survivin, and XIAP. All of these data indicate that PTER could be developed as a novel chemopreventive agent for TNBC.

■

■

REFERENCES

(1) Brenton, J. D.; Carey, L. A.; Ahmed, A. A.; Caldas, C. Molecular classification and molecular forecasting of breast cancer: ready for clinical application? J. Clin. Oncol. 2005, 23, 7350−7360. (2) Pitti, R. M.; Marsters, S. A.; Ruppert, S.; Donahue, C. J.; Moore, A.; Ashkenazi, A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J. Biol. Chem. 1996, 271, 12687−12690. (3) Trivedi, R.; Mishra, D. P. Trailing TRAIL resistance: Novel targets for TRAIL sensitization in cancer cells. Front. Oncol. 2015, 5, 69. (4) Fulda, S. The dark side of TRAIL signaling. Cell Death Differ. 2013, 20, 845−846. (5) Held, J.; Schulze-Osthoff, K. Potential and caveats of TRAIL in cancer therapy. Drug Resist. Updates 2001, 4, 243−252. (6) Emery, J. G.; McDonnell, P.; Burke, M. B.; Deen, K. C.; Lyn, S.; Silverman, C.; Dul, E.; Appelbaum, E. R.; Eichman, C.; DiPrinzio, R.; Dodds, R. A.; James, I. E.; Rosenberg, M.; Lee, J. C.; Young, P. R. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J. Biol. Chem. 1998, 273, 14363−14367. (7) Zhang, L.; Fang, B. Mechanisms of resistance to TRAIL-induced apoptosis in cancer. Cancer Gene Ther. 2005, 12, 228−237. (8) Guicciardi, M. E.; Gores, G. J. Life and death by death receptors. FASEB J. 2009, 23, 1625−1637. (9) Song, J. J.; An, J. Y.; Kwon, Y. T.; Lee, Y. J. Evidence for two modes of development of acquired tumor necrosis factor-related apoptosisinducing ligand resistance. Involvement of Bcl-xL. J. Biol. Chem. 2007, 282, 319−328. (10) Wu, X.; Lippman, S. M. An intermittent approach for cancer chemoprevention. Nat. Rev. Cancer 2011, 11, 879−885. (11) Jiang, C. C.; Chen, L. H.; Gillespie, S.; Kiejda, K. A.; Mhaidat, N.; Wang, Y. F.; Thorne, R.; Zhang, X. D.; Hersey, P. Tunicamycin sensitizes human melanoma cells to tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis by up-regulation of TRAIL-R2 via the unfolded protein response. Cancer Res. 2007, 67, 5880−5888. (12) He, Q.; Lee, D. I.; Rong, R.; Yu, M.; Luo, X.; Klein, M.; El-Deiry, W. S.; Huang, Y.; Hussain, A.; Sheikh, M. S. Endoplasmic reticulum calcium pool depletion-induced apoptosis is coupled with activation of the death receptor 5 pathway. Oncogene 2002, 21, 2623−2633. (13) Yamaguchi, H.; Wang, H. G. CHOP is involved in endoplasmic reticulum stress-induced apoptosis by enhancing DR5 expression in human carcinoma cells. J. Biol. Chem. 2004, 279, 45495−45502. (14) Harding, H. P.; Novoa, I.; Zhang, Y.; Zeng, H.; Wek, R.; Schapira, M.; Ron, D. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol. Cell 2000, 6, 1099−1108. (15) Scheuner, D.; Song, B.; McEwen, E.; Liu, C.; Laybutt, R.; Gillespie, P.; Saunders, T.; Bonner-Weir, S.; Kaufman, R. J. Translational control is required for the unfolded protein response and in vivo glucose homeostasis. Mol. Cell 2001, 7, 1165−1176. (16) Yang, Y.; Duan, W.; Liang, Z.; Yi, W.; Yan, J.; Wang, N.; Li, Y.; Chen, W.; Yu, S.; Jin, Z.; Yi, D. Curcumin attenuates endothelial cell oxidative stress injury through notch signaling inhibition. Cell. Signalling 2013, 25, 615−629.

AUTHOR INFORMATION

Corresponding Authors

*Department of Biological Science and Technology, China Medical University, Taiwan. Address: No. 91 Hsueh-Shih Road, Taichung, Taiwan 40402. Tel: +886-4-2205-3366 ext 2509. Fax: +886-4-2203-1075. E-mail: [email protected]. *Co-corresponding author. School of Medicine, Tzu Chi University, Hualien, Taiwan. Address: No.701, Sec. 3, Zhongyang Road, Hualien 97004, Taiwan. E-mail: yiengtwn@ gmail.com. ORCID

Chi-Tang Ho: 0000-0001-8273-2085 Tzong-Der Way: 0000-0001-5934-0008 Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS We would like to thank Ming-Ching Kao (China Medical University) for his assistance in editing the manuscript. ABBREVIATIONS USED ATF6, activating transcription factor 6; c-FLIP, FLICE inhibitory protein; CHOP, C/EBP-homologous protein; DcR, decoy receptor; DMSO, dimethyl sulfoxide; DR, death receptor; 11189


Article

Journal of Agricultural and Food Chemistry (17) Siedlecka-Kroplewska, K.; Jozwik, A.; Boguslawski, W.; Wozniak, M.; Zauszkiewicz-Pawlak, A.; Spodnik, J. H.; Rychlowski, M.; Kmiec, Z. Pterostilbene induces accumulation of autophagic vacuoles followed by cell death in HL60 human leukemia cells. J. Physiol. Pharmacol. 2013, 64, 545−556. (18) Nikhil, K.; Sharan, S.; Chakraborty, A.; Bodipati, N.; Krishna Peddinti, R.; Roy, P. Role of isothiocyanate conjugate of PTER on the inhibition of mcf-7 cell proliferation and tumor growth in ehrlich ascitic cell induced tumor bearing mice. Exp. Cell Res. 2014, 320, 311−328. (19) Lin, V. C.; Tsai, Y. C.; Lin, J. N.; Fan, L. L.; Pan, M. H.; Ho, C. T.; Wu, J. Y.; Way, T. D. Activation of ampk by PTER suppresses lipogenesis and cell-cycle progression in p53 positive and negative human prostate cancer cells. J. Agric. Food Chem. 2012, 60, 6399−6407. (20) Chen, W. C.; Hsu, K. Y.; Hung, C. M.; Lin, Y. C.; Yang, N. S.; Ho, C. T.; Kuo, S. C.; Way, T. D. The anti-tumor efficiency of PTER is promoted with a combined treatment of Fas signaling or autophagy inhibitors in triple negative breast cancer cells. Food Funct. 2014, 5, 1856−1865. (21) Way, T. D.; Tsai, S. J.; Wang, C. M.; Jhan, Y. L.; Ho, C. T.; Chou, C. H. Cinnamtannin D1 from Rhododendron formosanum induces autophagy via the inhibition of Akt/mTOR and activation of ERK1/2 in non-small-cell lung carcinoma cells. J. Agric. Food Chem. 2015, 63, 10407−10417. (22) Farooqi, A. A.; Li, K. T.; Fayyaz, S.; Chang, Y. T.; Ismail, M.; Liaw, C. C.; Yuan, S. S.; Tang, J. Y.; Chang, H. W. Anticancer drugs for the modulation of endoplasmic reticulum stress and oxidative stress. Tumor Biol. 2015, 36, 5743−5752. (23) Ichijo, H. From receptors to stress-activated MAP kinases. Oncogene 1999, 18, 6087−6093. (24) Sarker, M.; Ruiz-Ruiz, C.; López-Rivas, A. Activation of protein kinase C inhibits TRAIL-induced caspases activation, mitochondrial events and apoptosis in a human leukemic T cell line. Cell Death Differ. 2001, 8, 172−181. (25) Huang, L.; Xu, J.; Li, K.; Zheng, M.H.; Kumta, S. M. Thapsigargin potentiates TRAIL-induced apoptosis in giant cell tumor of bone. Bone 2004, 34, 971−981. (26) Martín-Pérez, R.; Niwa, M.; López-Rivas, A. ER stress sensitizes cells to TRAIL through down-regulation of FLIP and Mcl-1 and PERKdependent up-regulation of TRAIL-R2. Apoptosis 2012, 17, 349−363. (27) Hayashi, T.; Saito, A.; Okuno, S.; Ferrand-Drake, M.; Dodd, R. L.; Nishi, T.; Maier, C. M.; Kinouchi, H.; Chan, P. H. Oxidative damage to the endoplasmic reticulum is implicated in ischemic neuronal cell death. J. Cereb. Blood Flow Metab. 2003, 23, 1117−1128. (28) Keane, M. M.; Ettenberg, S. A.; Nau, M. M.; Russell, E. K.; Lipkowitz, S. Chemotherapy augments TRAIL-induced apoptosis in breast cell lines. Cancer Res. 1999, 59, 734−741. (29) Rahman, M.; Davis, S. R.; Pumphrey, J. G.; Bao, J.; Nau, M. M.; Meltzer, P. S.; Lipkowitz, S. TRAIL induces apoptosis in triple-negative breast cancer cells with a mesenchymal phenotype. Breast Cancer Res. Treat. 2009, 113, 217−230. (30) Shakibaei, M.; Harikumar, K. B.; Aggarwal, B. B. Resveratrol addiction: to die or not to die. Mol. Nutr. Food Res. 2009, 53, 115−128. (31) Azuhata, T.; Scott, D.; Griffith, T. S.; Miller, M.; Sandler, A. D. Survivin inhibits apoptosis induced by TRAIL, and the ratio between Survivin and TRAIL receptors is predictive of recurrent disease in neuroblastoma. J. Pediatr. Surg. 2006, 41, 1431−1440. (32) Yoon, M. J.; Kang, Y. J.; Kim, I. Y.; Kim, E. H.; Lee, J. A.; Lim, J. H.; Kwon, T. K.; Choi, K. S. Monensin, a polyether ionophore antibiotic, overcomes TRAIL resistance in glioma cells via endoplasmic reticulum stress, DR5 upregulation and c-FLIP downregulation. Carcinogenesis 2013, 34, 1918−1928. (33) Newmeyer, D. D.; Ferguson-Miller, S. Mitochondria: releasing power for life and unleashing the machineries of death. Cell 2003, 112, 481−490. (34) Siegelin, M. D.; Reuss, D. E.; Habel, A.; Herold-Mende, C.; von Deimling, A. The flavonoid kaempferol sensitizes human glioma cells to TRAIL-mediated apoptosis by proteasomal degradation of Survivin. Mol. Cancer Ther. 2008, 7, 3566−3574.

(35) Lim, B.; Allen, J. E.; Prabhu, V. V.; Talekar, M. K.; Finnberg, N. K.; El-Deiry, W. S. Targeting TRAIL in the treatment of cancer: new developments. Expert Opin. Ther. Targets 2015, 19, 1171−1185. (36) Liu, Y. J.; Lin, Y. C.; Lee, J. C.; Kuo, S. C.; Ho, C. T.; Huang, L. J.; Kuo, D. H.; Way, T. D. CCT327 enhances TRAIL-induced apoptosis through the induction of death receptors and downregulation of cell survival proteins in TRAIL-resistant human leukemia cells. Oncol. Rep. 2014, 32, 1257−1264. (37) Yodkeeree, S.; Sung, B.; Limtrakul, P.; Aggarwal, B. B. Zerumbone enhances TRAIL-induced apoptosis through the induction of death receptors in human colon cancer cells: Evidence for an essential role of reactive oxygen species. Cancer Res. 2009, 69, 6581−6589. (38) Prasad, S.; Yadav, V. R.; Ravindran, J.; Aggarwal, B. B. ROS and CHOP are critical for dibenzylideneacetone to sensitize tumor cells to TRAIL through induction of death receptors and downregulation of cell survival proteins. Cancer Res. 2011, 71, 538−549. (39) Yang, X. H.; Zheng, X.; Cao, J. G.; Xiang, H. L.; Liu, F.; Lv, Y. 8Bromo-7-methoxychrysin-induced apoptosis of hepatocellular carcinoma cells involves ROS and JNK. World J. Gastroenterol. 2010, 16, 3385− 3393. (40) Feng, Y.; Yang, Y.; Fan, C.; Di, S.; Hu, W.; Jiang, S.; Li, T.; Ma, Z.; Chao, D.; Feng, X.; Xin, Z.; Pang, S.; Li, X.; Yan, X. PTER inhibits the growth of human esophageal cancer cells by regulating endoplasmic reticulum stress. Cell. Physiol. Biochem. 2016, 38, 1226−1244. (41) Alosi, J. A.; McDonald, D. E.; Schneider, J. S.; Privette, A. R.; McFadden, D. W. Pterostilbene inhibits breast cancer in vitro through mitochondrial depolarization and induction of caspase-dependent apoptosis. J. Surg. Res. 2010, 161, 195−201. (42) Mannal, P.; McDonald, D.; McFadden, D. Pterostilbene and tamoxifen show an additive effect against breast cancer in vitro. Am. J. Surg. 2010, 200, 577−580. (43) Chakraborty, A.; Gupta, N.; Ghosh, K.; Roy, P. In vitro evaluation of the cytotoxic, anti-proliferative and anti-oxidant properties of pterostilbene isolated from Pterocarpus marsupium. Toxicol. In Vitro 2010, 24, 1215−1228. (44) Ohtsuka, T.; Zhou, T. Bisindolylmaleimide VIII enhances DR5mediated apoptosis through the MKK4/JNK/p38 kinase and the mitochondrial pathways. J. Biol. Chem. 2002, 277, 29294−29303. (45) Shenoy, K.; Wu, Y.; Pervaiz, S. LY303511 enhances TRAIL sensitivity of SHEP-1 neuroblastoma cells via hydrogen peroxidemediated mitogen-activated protein kinase activation and up-regulation of death receptors. Cancer Res. 2009, 69, 1941−1950. (46) Cui, Y.; Lu, P.; Song, G.; Liu, Q.; Zhu, D.; Liu, X. Involvement of PI3K/Akt, ERK and p38 signaling pathways in emodin-mediated extrinsic and intrinsic human hepatoblastoma cell apoptosis. Food Chem. Toxicol. 2016, 92, 26−37. (47) Qi, S.; Kou, X.; Lv, J.; Qi, Z.; Yan, L. Ampelopsin induces apoptosis in HepG2 human hepatoma cell line through extrinsic and intrinsic pathways: Involvement of P38 and ERK. Environ. Toxicol. Pharmacol. 2015, 40, 847−854. (48) Yoshida, T.; Shiraishi, T.; Nakata, S.; Horinaka, M.; Wakada, M.; Mizutani, Y.; Miki, T.; Sakai, T. Proteasome inhibitor MG132 induces death receptor 5 through CCAAT/enhancer-binding protein homologous protein. Cancer Res. 2005, 65, 5662−5667. (49) Eom, K. S.; Kim, H. J.; So, H. S.; Park, R.; Kim, T. Y. Berberineinduced apoptosis in human glioblastoma T98G cells is mediated by endoplasmic reticulum stress accompanying reactive oxygen species and mitochondrial dysfunction. Biol. Pharm. Bull. 2010, 33, 1644−1649. (50) Chen, Y.; Liu, J. M.; Xiong, X. X.; Qiu, X. Y.; Pan, F.; Liu, D.; Lan, S. J.; Jin, S.; Yu, S. B.; Chen, X. Q. Piperlongumine selectively kills hepatocellular carcinoma cells and preferentially inhibits their invasion via ROS-ER-MAPKs-CHOP. Oncotarget 2015, 6, 6406−6421. (51) Kapetanovic, I. M.; Muzzio, M.; Huang, Z.; Thompson, T. N.; McCormick, D. L. Pharmacokinetics, oral bioavailability, and metabolic profile of resveratrol and its dimethylether analog, pterostilbene, in rats. Cancer Chemother. Pharmacol. 2011, 68, 593−601. (52) Yeo, S. C.; Ho, P. C.; Lin, H. S. Pharmacokinetics of pterostilbene in Sprague-Dawley rats: the impacts of aqueous solubility, fasting, dose 11190


Article

Journal of Agricultural and Food Chemistry escalation, and dosing route on bioavailability. Mol. Nutr. Food Res. 2013, 57, 1015−1025. (53) Ruiz, M. J.; Fernández, M.; Picó, Y.; Mañes, J.; Asensi, M.; Carda, C.; Asensio, G.; Estrela, J. M. Dietary administration of high doses of pterostilbene and quercetin to mice is not toxic. J. Agric. Food Chem. 2009, 57, 3180−3186. (54) Pan, M. H.; Chiou, Y. S.; Chen, W. J.; Wang, J. M.; Badmaev, V.; Ho, C. T. Pterostilbene inhibited tumor invasion via suppressing multiple signal transduction pathways in human hepatocellular carcinoma cells. Carcinogenesis 2009, 30, 1234−1242.

11191


Pterostilbene enhances TRAIL-induced apoptosis through the

Recommend Documents