Purification, Characterization, cDNA Cloning and In Vitro Expression

Article pubs.acs.org/JAFC

Purification, Characterization, cDNA Cloning and In Vitro Expression of a Serine Proteinase from the Intestinal Tract of Sea Cucumber (Stichopus japonicus) with Collagen Degradation Activity Long-Jie Yan,† Chun-Lan Zhan,† Qiu-Feng Cai, Ling Weng, Cui-Hong Du, Guang-Ming Liu, Wen-Jin Su, and Min-Jie Cao* College of Biological Engineering, Jimei University, Jimei, Xiamen 361021, China Fujian Provincial Key Laboratory of Food Microbiology and Enzyme Engineering, Xiamen, Fujian Province 361021, China ABSTRACT: Sea cucumber (Stichopus japonicus) autolysis during transportation and processing is a major problem and the specific proteinases responsible for autolysis have not yet been identified. In the present study, a 34 kDa serine proteinase (SP) was isolated to high purity from sea cucumber intestinal tract by a series of column chromatographies. Peptide mass fingerprinting revealed that six peptide fragments were identical to a proprotein convertase subtilisin/kexin type 9 preproprotein from sea cucumber A. japonicus. The enzyme hydrolyzed gelatin effectively at pH 6.0−9.0 and 35−40 °C, and the enzyme activity was strongly inhibited by SP inhibitors. Sea cucumber collagen was hydrolyzed significantly by purified SP at 37 °C and more gradually at 4 °C, suggesting that SP may be involved in autolysis. In addition, the SP gene that codes for 377 amino acid residues was cloned into an E. coli expression vector and expressed in vitro. A polyclonal antibody against rSP was prepared and found to react specifically against both rSP and endogenous SP, which may prove useful for future studies on the physiological functions of SP. KEYWORDS: sea cucumber intestinal tract, serine proteinase, purification, molecular cloning, in vitro expression, autolysis

■

INTRODUCTION Sea cucumber (Stichopus japonicus) is traditionally regarded as a seafood delicacy and is widely consumed in China, Japan, Korea, and other Asian countries.1 In China, the total output of sea cucumber production is increasing annually to meet consumer demand.2 However, sea cucumbers are easily subject to autolysis, which is a major problem in transportation and processing.3 Autolysis, or self-digestion, is a common phenomenon that occurs in various aquatic products4−6 and some species of fish.7 After the death of these animals, biochemical reactions responsible for anabolism cease while endogenous proteinases involved in catabolism retain their function. Major digestive organs secrete proteinases such as trypsin, chymotrysin, and cathepsin. Among these proteolytic enzymes, serine proteinase (SP) have significant activity in the hydrolysis of collagen8−10 and myofibrillar proteins.11,12 In the edible portions of sea cucumbers, the highly insoluble collagen fibers account for about 70% of total protein.13 As a result, collagen hydrolysis is likely the main factor in sea cucumber autolysis. Recently, we identified a gelatinolytic metalloproteinase (GMP) from the body wall of sea cucumber active in collagen degradation.14 Considering the significant autolysis rate of harvested sea cucumbers, we propose that yet unidentified proteinases in the sea cucumber intestinal tract may also play an important role during collagen degradation. Although several reports regarding enzymes from the intestinal tract of sea cucumber have been published, including a highly alkaline proteinase,15 a novel β-1,3-glucanase,16 and a cathepsin L-like proteinase,17 little information exists on how they may act on collagen. © 2014 American Chemical Society

In this paper, we report the identification of a unique SP from the intestinal tract of sea cucumber and investigated its enzymatic characteristics while focusing in on its activity on collagen. The gene encoding this SP was cloned, overexpressed in Escherichia coli, and the recombinant SP (rSP) was purified to homogeneity. A specific polyclonal antibody against rSP was produced, which reacted positively with SP purified from sea cucumber. Our present study provides valuable information for further analysis of the relationship between SPs and sea cucumber autolysis.

■

MATERIALS AND METHODS

Intestinal Tract Removal. Sea cucumbers with body weight of 150−200 g were purchased alive from January to March from an aquaculture base in Quangang, Fujian Province, China. Following purchase, the sea cucumbers were placed in cold seawater and transported to the laboratory within 4 h. The digestive tracts were immediately removed, rinsed carefully with cold distilled water and either used for experiments or stored at −80 °C. Chemicals. DEAE-Sephacel, Sephacryl S-200 HR, Mini-Q, HisTrap HP, and Protein A Sepharose were purchased from GE Healthcare (Waukesha, WI, U.S.A.). Protein markers and bovine serum albumin were purchased from Bio-Rad (Richmond, CA, U.S.A.). The t-Butyloxy-carbonyl-Phe-Ser-Arg-4-methyl-coumaryl7-amide (Boc-Phe-Ser-Arg-MCA) and other synthetic fluorogenic peptide substrates (MCA-substrates) were purchased from Peptide Institute (Osaka, Japan). Benzamidine, 1,10-phenanthroline monohydrate, Received: Revised: Accepted: Published: 4769

February April 25, April 28, April 28,

21, 2014 2014 2014 2014

dx.doi.org/10.1021/jf500923y | J. Agric. Food Chem. 2014, 62, 4769−4777

Journal of Agricultural and Food Chemistry

Article

EDTA, EGTA were purchased from Sigma (St. Louis, MO, U.S.A.). Bovine gelatin, L-3-carboxytrans-2, 3-epoxypropionyl- L-leucine4-guanidinobutylamide (E-64), and Triton X-100 were products of Amresco (Solon, OH, U.S.A.). Pepstatin A was purchased from Roche (Mannheim, Germany). The 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride (Pefabloc SC) was a product of Merck (Darmstadt, Germany). Purification of SP. All procedures were performed at 4 °C. Briefly, the digestive tracts of sea cucumbers (200 g) were homogenized in 4-fold (v/w) of 20 mM Tris-HCl (pH 8.0) with 0.02% NaN3 (buffer A) and centrifuged at 10000 g for 20 min. The supernatant was then collected as the crude enzyme fraction and subsequently applied to an ion-exchange column DEAE-Sephacel (2.5 × 10 cm) previously equilibrated with buffer A. After washing the column with buffer A until the absorbance at 280 nm reached baseline, bound proteins were eluted with a 0 to 0.5 M linear NaCl gradient in buffer A. Active fractions were pooled and concentrated by ultrafiltration using a YM-10 membrane (Millipore) and loaded on a gel filtration column of Sephacryl S-200 (2.5 × 98 cm) equilibrated with buffer A containing 0.15 M NaCl. Active fractions were collected, dialyzed against buffer A, and applied to a Mini-Q high performance ion exchange column (1 mL). A linear gradient elution using 0−0.5 M NaCl was performed at a flow rate of 0.5 mL/min. Active fractions were collected as purified proteinase and were used for enzymatic characterization. Protein Concentration Analysis. Protein concentrations were estimated by measuring the absorbance at 280 nm using a Lambda 35 spectrophotometer (PerkinElmer, U.S.A.). The concentration of proteins after each purification step except the Mini-Q was determined by the method of Lowry18 using bovine serum albumin as the standard. Assay of Enzyme Activity. SP activity was measured as described by Guo et al.,11 using Boc-Phe-Ser-Arg-MCA as a substrate. The reaction was initiated by adding 50 μL of enzyme solution to the reaction mixture containing 900 μL of 20 mM Tris-HCl (pH 8.0) and 50 μL of 10 μM substrate and incubated at 37 °C for 10 min. The reaction was stopped by adding 1.5 mL stopping agent (methyl alcohol/n-butyl alcohol/distilled water = 35:30:35, v/v/v), and enzyme activity was detected by measuring the fluorescence intensity of the liberated 7-amino-4-methylcoumarin (AMC) at an excitation wavelength of 380 nm and emission wavelength of 450 nm in a fluorescence spectrophotometer (FP-6200, Jasco, Japan). One unit of enzyme is defined as the amount of enzyme required to liberate 1 nmol of AMC per min. SDS-PAGE and Gelatin Zymography. SDS-PAGE was performed based on the protocol of Laemmli.19 Samples were separated using 12% polyacrylamide gels and stained with silver. Gelatin zymography was performed according to the method described by Herron et al.20 Samples were mixed 3:1 with 4 × SDS sample buffer (200 mM Tris-HCl, pH 6.8 containing 8% SDS, 0.4% brommophenol blue and 40% glycerol) and were electrophoresed in 12% polyacrylamide gels containing 0.1% bovine gelatin at 4 °C. After electrophoresis, the gels were washed with 2.5% (v/v) Triton X-100 for 30 min by gently shaking to remove SDS, followed by a deionized water rinse. After incubation at 37 °C for 12 h in 20 mM Tris-HCl (pH 8.0), the gel was stained with Coomassie Brilliant Blue (CBB) R-250. The area of enzyme activity appeared as a clear band on the CBB-stained dark blue background, and the clarity of the band correlates positively to enzyme activity. MALDI-TOF/TOF-MS/MS Analysis. Purified SP was separated on a 12% SDS-PAGE gel and stained with silver and the target protein band was selected for mass spectrometry analysis.21 The target protein band was excised and destained using 30 mM K3Fe(CN)6 and 100 mM Na2S2O3, followed by addition of 100 mM NH4HCO3 and incubated at room temperature for 15 min. The band was digested with trypsin at 37 °C overnight. Peptides were extracted with 100 μL of extraction solution containing 50% acetonitrile and 0.1% trifluoroacetic acid for 15 min. Obtained peptide solution was desalted using Ziptip C-18 columns (Pierce), lyophilized, and analyzed by 4800 plus MALDI-TOF analyzer (Applied Biosystems, Foster City, U.S.A.) in the School of Life Science, Sun Yat-Sen University, China.

Figure 1. Column chromatography purification of the SP from the intestinal tract of sea cucumber. (A) DEAE-Sephacel chromatography. (B) Sephacryl S-200 chromatography. (C) Mini-Q chromatography. Absorbance at 280 nm (---); Enzymatic activity to Boc-Phe-Ser-Arg-MCA (-•-). SDS-PAGE and gelatin zymography of purified proteinase are shown in the inset of part C. Lane M, protein marker; lane 1, purified SP on silver stained 12% SDS-PAGE gel; lane 2, purified SP on gelatin zymography. The resulting data were searched against the NCBI database using Matrix Science’s Mascot 2.2 search engine. Effect of Proteinase Inhibitors. To investigate the effects of different proteinase inhibitors on the proteinase, gels resulting from gelatin zymography gel electrophoresis were washed and rinsed as described above and subsequently allowed to incubate in buffer A with inhibitors at 37 °C for 12 h, followed by CBB staining. Control tests were performed in the absence of proteinase inhibitor. The effect of proteinase inhibitors on the proteinase was also analyzed using BocPhe-Ser-Arg-MCA as substrate. Briefly, purified SP was preincubated with corresponding inhibitors at different final concentrations for 30 min at 4 °C in 20 mM Tris-HCl buffer (pH 8.0), and the remaining enzymatic activity was determined as described above. Preparation of Sea Cucumber Collagen. All procedures were performed at 4 °C as described.14 Briefly, sea cucumber body wall (80 g wet weight) was minced and orderly washed by distilled water, 0.1 M Tris-HCl (pH 8.0) containing 5 mM EDTA, distilled water and 0.1 M NaOH with continuous stirring to remove noncollagenous material and pigment. The insoluble component was digested with 4770



Article

Figure 2. Peptide mass fingerprinting of purified SP. (A) Ions identified using mass spectrometry (MS). The sequences of six peptide fragments are shown in the above table. (B) Protein sequence alignment of SP with the sequence of proprotein convertase subtilisin/kexin type 9 preproprotein (gi:86277304) from A. japonicus. Identical amino acid residues are shown with black background. porcine pepsin in 0.5 M acetic acid overnight, followed by centrifugation at 12000 g for 30 min. Collagen in the supernatant was salted out by adding NaCl to a final concentration of 0.8 M. After centrifugation, the collagen was collected and dissolved in 0.5 M acetic acid, and extensively dialyzed against 0.02 M sodium phosphate buffer (pH 8.0). The purified collagen was lyophilized and stored at −80 °C until analysis. Degradation of Sea Cucumber Collagen. The purified enzyme was allowed to react with sea cucumber collagen in buffer A at 37 °C for different time intervals. After incubation, samples were applied to 7.5% gel for electrophoresis followed by CBB staining. RNA Preparation and cDNA Synthesis. Total RNA was isolated from the intestinal tract of sea cucumber using the Trizol method.11 First strand cDNA was synthesized with TIANScript RT Kit according to the manufacturer’s instructions. Reverse Transcription Polymerase Chain Reaction (RT-PCR). Degenerate primers (PF1 5′-TTGACCAACAAGACTTACCTC-3′ and PR1 5′-GTCATCACTAGCAGAGGAAGC-3′) to amplify partial

sequences of the SP gene were designed according to the MALDITOF mass spectra results. Using these primers and the synthesized cDNA, a 500 bp fragment of the SP gene was amplified by PCR in a Gene Amp 9700 (Applied Biosystems, U.S.A.) thermal cycler. The PCR program was as follows: 5 min at 94 °C followed by 30 cycles of 30 s at 94 °C, 45 s at 55 °C, 60 s at 72 °C, and a final extension of 10 min at 72 °C. The PCR product was purified by agarose gel electrophoresis and cloned into pMD-18T vector (TakaRa) followed by DNA sequence analysis. DNA sequencing was performed at Invitrogen Biotechnological Co. Ltd. (Guangzhou, China) using the ABI Prism 3730 (CA, U.S.A.) DNA sequencer. 5′- and 3′- Rapid Amplification of cDNA Ends (5′- and 3′- RACE). The full-length sequence was obtained by 5′-RACE and 3′-RACE with several gene-specific primers (PF 5′-TGCTCCTCTGGCTATCACTG-3′ and PR 5′-CACAGTGAGAACCATGTCCAT-3′). RACE and RACE-PCR were performed with the SMART RACE cDNA Amplification Kit and Advantage 2 PCR Kit (Clontech, U.S.A.). Touchdown PCR was used to improve the 4771



Article

Figure 5. Effect of proteinase inhibitors on the purified SP. Gelatin zymography was conducted to investigate the inhibitory effect of proteinase inhibitors on the purified SP at 37 °C for 12 h in buffer A, followed by CBB staining. Lane C, control (without inhibitor); Lane 1, Pefabloc SC (2 mM); Lane 2, benzamidine (5 mM); Lane 3, Leupeptin (5 mM); Lane 4, Chymostatin (5 mM); Lane 5, E-64 (0.01 mM); Lane 6, Pepstatin A (0.015 mM); and Lane 7, EDTA (10 mM). PCR products were ligated into the digested pET-28a (+) plasmid to generate pET-28a-SP recombinant plasmids. Expression and Purification of the Recombinant SP. pET28a-SP was transformed into E. coli BL21 (DE3) to make the expression strain BL-pET-SP. Overnight culture of the transformants (2 mL) was transferred into 200 mL kanamycin-containing Luria− Bertani broth for large scale culture while shaking at 37 °C. When the optical density at 600 nm reached 0.6, isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to the final concentration of 1 mM for induction of recombinant proteinase expression. After culturing at 37 °C for 4 h, bacteria were collected by centrifugation at 9000 g for 5 min and resuspended in 1/10 cold buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0). The bacteria were lysed by sonication and centrifuged at 12000 g for 20 min to remove the supernatant. The inclusion bodies were solubilized in a denaturing solution (20 mM Tris-HCl, pH 8.0 containing 150 mM NaCl and 4 M urea) and the His-tagged recombinant proteinase was purified using a Ni-NTA agarose affinity column and eluted with denaturing solution containing 100 mM imidazole. Following elution, the purified rSP was dialyzed against a renaturation buffer (20 mM Tris-HCl, 150 mM NaCl, pH 8.0) and its enzyme activity and purity were analyzed. Preparation of Antiserum Against rSP. Purified rSP was used as antigen to produce polyclonal antibodies. Approximately 100 μg highly purified rSP was mixed with 1 mL complete Freund’s adjuvant. The thoroughly mixed samples were subcutaneously injected into a rabbit. The same amount of antigen (100 μg) was mixed with incomplete Freund’s adjuvant and injected subcutaneously into the rabbit on a biweekly basis and repeated four times. Blood sample was collected after the last booster. Anti-rSP polyclonal antibodies were purified by passing the sera through a Protein A Sepharose column.

Figure 3. Optimal pH of SP. (A) Gelatin zymography analysis of pH on SP. Gelatin-incorporated gels were allowed to incubate at 37 °C for 12 h in different buffers at pH 4.0−10.0. (B) Effect of pH on purified SP using Boc-Phe-Ser-Arg-MCA as substrate.

■

Figure 4. Optimal temperature of SP. (A) Gelatin zymography analysis of temperature on SP. Gelatin-incorporated gels were allowed to incubate in buffer A for 12 h at different temperatures from 20 to 50 °C. (B) Effect of temperature on purified SP using Boc-Phe-SerArg-MCA as substrate.

RESULTS Purification of SP. Following a series of column chromotogaphy purifications, a SP was purified to homogeneity. As shown in Figure 1A, SP was eluted from DEAE-Sephacel with a linear gradient of 0−0.5 M NaCl. Active fractions from the first column were further purified by Sephacryl S-200 gel filtration (Figure 1B). After Mini-Q ion exchange column purification, the enzymatically active peak migrated as a single band with a molecular mass of 34 kDa on SDS-PAGE (Figure 1C). Gelatin zymography analysis showed a corresponding gelatinolytic active band, suggesting that the proteinase was purified to homogeneity. The purification steps were summarized in Table 1. Approximately 0.1 mg of highly purified SP was obtained from 200 g of sea cucumber intestinal tract, the specific activity was 85.0 U/mg with a 331.7-fold increase and 1.6% recovery.

specificity of SMARTer RACE amplification. The PCR products, 5′-RACE (550 bp) and 3′-RACE (500 bp) were purified, cloned and sequenced. The RT-PCR fragments as well as the 3′-RACE and 5′-RACE fragments were combined using the DNAman program to generate the full-length SP cDNA. Construction of Recombinant Plasmids. The SP fragment without signal peptide was amplified by primers P5F 5′CATATGATTGCACCTCTCCAC −3′ (containing the NdeI site) and P3R 5′- GAATTCACCAACATACAAGAGCAG −3′ (containing the EcoRI site). The plasmids containing PCR products and the pET28a plasmid were digested with restriction enzymes NdeI and EcoRI. 4772



Article

peptide fragments in the 800−5000 Da m/z range, and peaks with signal-to-noise ratios (SNR) > 50 were compared with the NCBI. It is interesting to note that the amino acid sequence of six peptide fragments containing a total of 111 amino acid residues were 100% identical to a proprotein convertase subtilisin/kexin type 9 preproprotein (gi:86277304) from Apostichopus japonicus, which is also a SP (Figure 2B). Effects of pH and Temperature. We sought to determine the maximum gelatinolytic activity of the purified SP. At 37 °C, a clear proteolytic band can be observed between pH 4.0−11.0. As shown in Figure 3A, the clearest band can be seen at pH 7.0 and the proteolytic band is negligible below pH 5.0 or above pH 9.0. Using Boc-Phe-Ser-Arg-MCA as the substrate, the maximum activity of SP was also detected at pH 7.0 (Figure 3B). The temperature-dependence of SP activity was determined using gelatin zymography (Figure 4A) and fluorogenic substrate hydrolyzing activity (Figure 4B). The results from both methods demonstrated that SP is maximally active at 40 °C. Effect of Proteinase Inhibitors on the Purified SP. By gelatin zymography (Figure 5) and fluorogenic substrate hydrolyzing activity assays as readouts, the purified SP was almost completely suppressed by Pefabloc SC and benzamidine, which are known as specific SP inhibitors (Table 2). As an

Table 1. Summary of the Purification of SP from the Intestinal Tract of Sea Cucumber purification steps crude enzyme DEAESephacel Sephacryl S-200 Mini-Q

total protein (mg)

total activity (U)

specific activity (U/mg)

yield (%)

2024.8

518.8

0.3

100.0

1.0

302.4

125.9

0.4

24.3

1.6

9.9

23.7

2.4

4.6

9.3

0.1

8.5

85.0

1.6

331.7

purification (fold)

MALDI-TOF/TOF-MS/MS. To determine the amino acid sequence of the purified protein, the protein band was excised from SDS-PAGE and in-gel digested with trypsin. The resulting peptide mixture was analyzed by MALDI-TOF/TOF-MS/MS. Peptide mass fingerprinting (PMF) shown in Figure 2A revealed

Table 2. Effect of Proteinase Inhibitors on the SP Activity inhibitor

concn. (mM)

relative activity (%)

control Pefabloc SC

0 0.2 2 0.5 5 0.01 0.1 0.01 0.1 0.015 0.1 0.015 0.1 1 10

100 12.5 + 0.1 7.4 + 0.4 15.9 + 0.3 9.1 + 0.5 55.2 + 0.8 43.5 + 1.2 85.7 + 0.6 86.9 + 1.4 90.4 + 2.0 91.2 + 1.2 86.3 + 3.6 84.7 + 2.8 103.6 + 2.8 127.6 + 2.3

benzamidine leupeptin chymostatin E-64 pepstatinA EDTA

inhibitor both to serine and cysteine proteinases, leupeptin could not completely suppress the activity of purified SP. On the other hand, inhibitors to the other three types of proteinases (cysteine proteinase, aspartic proteinase, and metalloproteinase) did not show any inhibitory effect toward SP. These results strongly suggest that the purify enzyme is a SP. Collagen Hydrolysis by SP. To confirm the involvement of SP in sea cucumber autolysis, its activity in the hydrolysis of collagen was investigated. As shown in Figure 6A, in the presence of SP, the β- and γ-chains of sea cucumber collagen were hydrolyzed after incubation at 37 °C for 15 min, and the original collagen bands (α, β and γ) completely disappeared after 3 h incubation. However, in the presence of SP inhibitors, collagen hydrolysis was completely suppressed when incubated with SP (Figure 6B). Leupeptin also significantly suppressed collagen hydrolysis although it only partially inhibited the activity of SP in gelatin zymography. Aspartic proteinase, cysteine proteinase and metalloproteinase inhibitors, on the other hand, did not show any inhibitory effects on collagen

Figure 6. Degradation of sea cucumber collagen by SP. (A) SP (≈20 ng) and sea cucumber collagen (≈40 μg) were incubated in buffer A at 37 °C for different intervals. (B) Proteolysis patterns of collagen incubated with or without SP in the presence of various proteinase inhibitors at 37 °C in buffer A for 15 min. Lane M, protein marker; Lane 1, sea cucumber collagen; Lane 2, control (without inhibitor); Lane 3, Pefabloc SC (2 mM); Lane 4, benzamidine (5 mM); Lane 5, leupeptin (5 mM); Lane 6, chymostatin (5 mM); Lane 7, E-64 (0.01 mM); Lane 8, pepstatin A (0.015 mM); and Lane 9, EDTA (10 mM). 4773



Article

Figure 7. Nucleic acid and deduced amino acid sequences of SP. Base pair numbers and amino acid residue numbers are indicated to the left of each row. The signal peptide sequence is underlined. The Asp138, His176 and Ser325 that form the catalytic triad of SP are shown with a black background.

■

hydrolysis. Proteolysis of collagen by SP at 4 °C was slower than that at 37 °C, but a similar proteolysis pattern was also be observed (data not shown). cDNA Cloning of SP. The complete sequence of SP was cloned from S. japonicus and has been deposited in GenBank under the accession number KF888630. The full-length sequence of SP (1367 bp) contains an open reading frame (ORF) of 1131 bp encoding a putative protein of 377 amino acid residues with a 15 amino acids signal peptide located at the N-terminus (Figure 7). The molecular mass of mature SP is predicted to be 37.51 kDa and the pI, 4.44. BLASTp analysis showed that SP shares 99% identity to proprotein convertase subtilisin/kexin type 9 preproprotein (serine proteinnase-like) from sea cucumber (A. japonicus), 53% to an extracellular serine proteinase-like from sea urchin (Strongylocentrotus purpuratus) (Figure 8). Expression and Purification of rSP. The recombinant BL-pET28a-SP was induced with IPTG for 4 h. The molecular mass of rSP is about 42 kDa when the 6 × His-tag (4.5 kDa) is taken into account, a mass that is similar to the theoretical value. Though the recombinant protein was mainly found in inclusion bodies, the His-tagged protein was easily purified using affinity chromatography to high purity. Subsequently, anti-rSP polyclonal antibody was successfully prepared using purified rSP as the antigen. Western Blot Analysis. Western blot analysis showed that the anti-rSP polyclonal antibody specifically reacts both to rSP, native SP and even crude extract from the intestinal tract of sea cucumber (Figure 9), suggesting its high specificity.

DISCUSSION Sea cucumbers are exceptionally sensitive to autolysis upon changing environmental factors such as increased temperature, change of salinity, and UV exposure. Hydrolysis of the collagen causes the disintegration of sea cucumber microstructures and the reduction of texture. As the body wall of sea cucumbers is mainly composed of collagen,13 we propose that sea cucumber autolysis is mainly due to collagen hydrolysis. Though previous studies on sea cucumber proteinases have been reported,14,22 information on the possible roles they play on autolysis is not available. Consequently, discovering and characterizing endogenous collagenolytic proteinases in sea cucumber may be beneficial to the elucidation of the mechanism behind sea cucumber autolysis. Recently, we identified a GMP from the body wall of the sea cucumber S. japonicus and found that GMP maintains collagen proteolytic activity even at 4 °C. Considering the rapid rate of autolysis in harvested sea cucumbers, we proposed that the intestinal tract, which contains various proteinases, may be involved in autolysis. To find out what types of endogenous collagenolytic proteinases are responsible for collagen proteolysis, various proteinase inhibitors were added to crude extract from sea cucumber intestinal tract. The results showed that SP inhibitors and metalloproteinase inhibitors effectively suppressed collagen proteolysis, while other inhibitors exhibited no inhibitory effects (data not shown). It is clear then that serine proteinase and metalloproteinase are the major proteinases responsible for collagen proteolysis, which agrees well to a previously published report using casein-zymography.23 In the present study, we purified the SP from the intestinal tract of sea cucumbers and characterized its enzymatic 4774



Article

Figure 8. Alignment of primary structures of SP. The sequence of sea cucumber SP was compared with that of proprotein convertase subtilisin/kexin type 9 preproprotein (ABC87995, A. japonicus) and extracellular serine proteinase-like (XP_791416, Strongylocentrotus purpuratus). Identical amino acid residues are shown with black background.

properties. Based on an enzyme activity assay using Boc-PheSer-Arg-MCA as the substrate, a SP with a molecular mass of approximately 34 kDa was purified through a series of column chromatographies. The molecular mass of the purified proteinase was close to that of a SP from sea urchin (Strongylocentrotus purpuratus, 35 kDa).24 According to the MALDI-TOF/TOF-MS/MS spectrum analysis, six peptide fragments consisting of 111 amino acid residues were identical to the sequence of a proprotein convertase subtilisin/kexin type 9 preproprotein (PCSK 9) (gi: 86277304) from A. japonicus (Figure 3A). PSCK9 belongs to the family of mammalian secretory kexin-like subtilases25 and shares high homology with the C family of serine proteases.26 Recently, Sun et al.27 reported that PCSK9 is one of the top 10 down-regulated genes during sea cucumber regeneration. The optimum pH for SP activity was 7.0 (Figure 4A) and the highest enzymatic activity was found at 35 °C (Figure 5A) using both gelatin zymography and fluorogenic substrates. The optimum pH of SP is similar to SPs from filefish (Novoden modestrus)28 and fresh water prawn (Macrobrachium rosenbergii).8

Figure 9. Western blotting analysis using anti-rSP polyclonal antibody. Lane 1, purified rSP; Lane 2, crude extract from the intestinal tract of sea cucumber; Lane 3, purified native SP. 4775



Article

prepare an immunoaffinity column for purification of native SP more effectively.

Meanwhile, the optimum temperature of purified SP is similar to another SP from the hepatopancreas of the northern shrimp.10 The enzymatic activity of the purified SP was strongly inhibited by SP inhibitors such as Pefabloc SC and benzamidine, while no significant inhibitory effects were observed using aspartic proteinase, cysteine proteinase and metalloproteinase inhibitors. Different from specific SP inhibitors such as Pefabloc SC and benzamidine, leupeptin is a reversible, competitive inhibitor both to serine and cysteine proteinases. Leupeptin could not completely suppress the purified SP during the 12 h incubation of gelatin-zymography (Figure 5). However, in collagen hydrolysis, as the reaction was performed only for 30 min, thus, no obvious degradation by SP could be observed on SDS-PAGE in the presence of leupeptin (Figure 6B). These indicate that the purified proteinase is different from trypsin-type collagenolytic SPs. Previous study showed that serine collagenase can be inhibited by metalloproteinase inhibitor EDTA as well as by SP inhibitors such as TLCK, DFP and soybean trypsin inhibitor.7,9,28 To ascertain the biological function of SP in sea cucumber autolysis, sea cucumber collagen hydrolysis patterns was examined using purified SP. With longer reaction times, significant degradation of the original band (α, β, and γ) of collagen was found when SP was incubated with sea cucumber collagen both at 37 °C (Figure 6A) and 4 °C (data not shown). Collagen proteolysis is completely suppressed by SP inhibitors (Figure 6B). Because SP from sea cucumber intestinal tract showed highly collagenolytic activity, we infer that endogenous SP is responsible for the degradation of collagenous fibrils in sea cucumber autolysis. To further understand the underlying mechanism of sea cucumber autolysis, we successfully cloned the full-length cDNA (Figure 7) of SP. It contained a signal peptide, a prodomain, a catalytic domain and a carboxyl-terminal. Comparing the primary sequence of SP with other SPs, the purified SP shared relatively high identities to proprotein convertase subtilisin/kexin type 9 preproprotein and an extracellular serine proteinase from sea urchin (Figure 8), suggesting their close relationship. Like other SPs,11 the catalytic domain consists Asp138, His176 and Ser325, which is the active site responsible for the enzymatic activity of SP. There are 4 cysteine residues at positions 170, 177, 202, and 310 that may form two intramolecular disulfide bonds in the tertiary structure. The difference in molecular mass between the native SP (34 kDa) and the calculated molecular weight from the nucleotide sequence (37.51 kDa) may be attributed to a cleavage site at ASA15-MI, which may be where the signal peptide is cleaved from the protein. The theoretical pI of the mature protein is 4.44, which is consistent with the observation that we were able to purify SP in Tris-HCl pH 8.0 using DEAESephacel weak anion exchange chromatography and Mini-Q strong anion exchange chromatography. Thereafter, we used the E. coli expression vector pET28a to produce rSP. Although rSP revealed very low biological activity after following purification using denaturation buffer followed by renaturation, we were able to prepare a polyclonal antibody using rSP as the antigen and Western blot analysis (Figure 9) showed that both native SP and rSP reacted specifically with the rabbit anti-rSP polyclonal antibody. Based on its specificity, the antibody prepared in the present work can be applied to investigate the existence of SP in different tissues of sea cucumber by immunohistochemical study. It is also possible to

■

AUTHOR INFORMATION

Corresponding Author

*Tel.: +86-592-6180378. Fax: +86-592-6180470. Email: [email protected]. Author Contributions †

L.J.Y. and C.L.Z. contributed equally to this manuscript.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was sponsored by the National Natural Scientific Foundation of China (Nos. 31271838), the Key Project of the M i n i s t r y o f S c i e n ce a n d T e c h n o l o g y o f C h i n a (2012BAD38B09), Public Science and Technology Research Funds Projects of Ocean (201305015-3), and the Science and Technology Bureau of Xiamen (3502Z20133020).

■

REFERENCES

(1) Yu, L.; Ge, L.; Xue, C.; Chang, Y.; Zhang, C.; Xu, X.; Wang, Y. Structural study of fucoidan from sea cucumber Acaudina molpadioides: A fucoidan containing novel tetrafucose repeating unit. Food Chem. 2014, 142, 197−200. (2) China Fisheries Yearbook; China Agricultural Press: Beijing, China, 2013 (in Chinese). (3) Wu, H. T.; Li, D. M.; Zhu, B. W.; Sun, J. J.; Zheng, J.; Wang, F. J.; Konno, K.; Jiang, X. Proteolysis of noncollagenous proteins in sea cucumber, Stichopus japonicus, body wall: Characterization and the effects of cysteine protease inhibitors. Food Chem. 2013, 141, 1287− 1294. (4) Eakpetch, P.; Benjakul, S.; Visessanguan, W.; Kijroongrojana, K. Autolysis of Pacific white shrimp (Litopenaeus vannamei) meat: Characterization and the effects of protein additives. J. Food Sci. 2008, 73, 95−103. (5) Wang, J. H.; Ma, W. C.; Su, J. C.; Chen, C. S.; Jiang, S. T. Comparison of the properties of m-calpain from tilapia and grass shrimp muscles. J. Agric. Food Chem. 1993, 41, 1379−1384. (6) Kimio, N.; Yukio, K.; Teruyoshi, M.; Daizo, Y. Classification of proteases in antarctic krill (Euphausia superba). Agric. Biol. Chem. 1983, 47, 2577−2583. (7) Siringan, P.; Raksakulthai, N.; Yongsawatdigul, J. Autolytic activity and biochemical characteristics of endogenous proteinases in Indian anchovy (Stolephorus indicus). Food Chem. 2006, 98, 678−684. (8) Sriket, C.; Benjakul, S.; Visessanguan, W.; Kishimura, H. Collagenolytic serine protease in fresh water prawn (Macrobrachium rosenbergii): Characteristics and its impact on muscle during iced storage. Food Chem. 2011, 124, 29−35. (9) Hayet, B. K.; Rym, N.; Ali, B.; Sofiane, G.; Moncef, N. Low molecular weight serine protease from the viscera of sardinelle (Sardinella aurita) with collagenolytic activity: Purification and characterisation. Food Chem. 2011, 124, 788−794. (10) Aoki, H.; Ahsan, M. N.; Matsuo, K.; Hagiwara, T.; Watabe, S. Purification and characterization of collagenolytic proteases from the hepatopancreas of northern shrimp (Pandalus eous). J. Agric. Food Chem. 2002, 51, 777−783. (11) Guo, C.; Cao, M. J.; Liu, G. M.; Lin, X. S.; Hara, K.; Su, W. J. Purification, characterization, and cDNA cloning of a myofibril-bound serine proteinase from the skeletal muscle of crucian carp (Carassius auratus). J. Agric. Food Chem. 2007, 55, 1510−1516. (12) Cao, M. J.; Jiang, X. J.; Zhong, H. C.; Zhang, Z. J.; Su, W. J. Degradation of myofibrillar proteins by a myofibril-bound serine proteinase in the skeletal muscle of crucian carp (Carasius auratus). Food Chem. 2006, 94, 7−13. 4776



Article

(13) Saito, M.; Kunisaki, N.; Urano, N.; Kimura, S. Collagen as the major edible component of sea cucumber (Stichopus japonicus). J. Food Sci. 2002, 67, 1319−1322. (14) Wu, H. L.; Hu, Y. Q.; Shen, J. D.; Cai, Q. F.; Liu, G. M.; Su, W. J.; Cao, M. J. Identification of a novel gelatinolytic metalloproteinase (GMP) in the body wall of sea cucumber (Stichopus japonicus) and its involvement in collagen degradation. Process Biochem. 2013, 48, 871− 877. (15) Fu, X. Y.; Xue, C. H.; Miao, B. C.; Li, Z. J.; Yang, W. G.; Wang, D. F. Study of a highly alkaline protease extracted from digestive tract of sea cucumber (Stichopus japonicus). Food Res. Int. 2005, 38, 323− 329. (16) Zhu, B. W.; Zhao, J. G.; Yang, J. F.; Mikiro, T.; Zhang, Z. S.; Zhou, D. Y. Purification and partial characterization of a novel β-1,3glucanase from the gut of sea cucumber Stichopus japonicus. Process Biochem. 2008, 43, 1102−1106. (17) Zhou, D. Y.; Chang, X. N.; Bao, S. S.; Song, L.; Zhu, B. W.; Dong, X. P.; Zong, Y.; Li, D. M.; Zhang, M. M.; Liu, Y. X.; Murata, Y. Purification and partial characterisation of a cathepsin L-like proteinase from sea cucumber (Stichopus japonicus) and its tissue distribution in body wall. Food Chem. 2014, 158, 192−199. (18) Lowry, O. H.; Rosebrough, N.; Farr, A.; Randall, R. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265−275. (19) Laemmli, U. Cleavage of structural proteins during the assembly of the head. Nature 1970, 227, 680−685. (20) Herron, G. S.; Banda, M. J.; Clark, E. J.; Gavrilovc, J.; Werb, Z. Secretion of metalloproteinases by stimulated capillary endothelial cells. J. Biol. Chem. 1986, 261, 2814−2818. (21) Mortz, E.; Krogh, T. N.; Vorum, H.; Görg, A. Improved silver staining protocols for high sensitivity protein identification using matrix-assisted laser desorption/ionization-time of flight analysis. Proteomics 2001, 1, 1359−1363. (22) Zhu, B. W.; Yu, J. W.; Zhang, Z.; Zhou, D. Y.; Yang, J. F.; Li, D. M.; Murata, Y. Purification and partial characterization of an acid phosphatase from the body wall of sea cucumber Stichopus japonicus. Process Biochem. 2009, 44, 875−879. (23) Fu, X. Y.; Xue, C. H.; Miao, B. C.; Li, Z. J.; Gao, X.; Hirata, T. Distribution and seasonal activity variation of proteases in digestive tract of sea cucumber Stichopus japonicus. Fish. Sci. 2006, 72, 1130− 1132. (24) Haley, S. A.; Wessel, G. W. The cortical granule serine protease CGSP1 of the sea urchin, Strongylocentrotus purpuratus, is autocatalytic and contains a low-density lipoprotein receptor-like domain. Dev. Biol. 1999, 211, 1−10. (25) Seidah, N. G.; Benjannet, S.; Wickham, L.; Marcinkiewicz, J.; Jasmin, S. B.; Stifani, S.; Basak, A.; Prat, A.; Chrétien, M. The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): Liver regeneration and neuronal differentiation. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 928−933. (26) Timms, K. M.; Wagner, S.; Samuels, M. E.; Forbey, K.; Goldfine, H.; Jammulapati, S.; Skolnick, M. H.; Hopkins, P. N.; Hunt, S. C.; Shattuck, D. M. A mutation in PCSK9 causing autosomaldominant hypercholesterolemia in a Utah pedigree. Hum. Genet. 2004, 114, 349−353. (27) Sun, L.; Chen, M.; Yang, H.; Wang, T.; Liu, B.; Shu, C.; Gardiner, D. M. Large scale gene expression profiling during intestine and body wall regeneration in the sea cucumber (Apostichopus japonicus). Comp. Biochem. Physiol. D 2011, 6, 195−205. (28) Kim, S.; Park, P.; Kim, J.; Shahidi, F. Purification and characterization of a collagenolytic protease from the filefish, Novoden modestrus. J. Biochem. Mol. Biol. 2002, 35, 165−171.

4777


Purification, Characterization, cDNA Cloning and In Vitro Expression

Recommend Documents