Pyrazolo[1,5-a]pyridine Inhibitor of the Respiratory Cytochrome bcc

Subscriber access provided by the Henry Madden Library | California State University, Fresno

Article

A pyrazolo[1,5-a]pyridine inhibitor of the respiratory cytochrome bcc complex for the treatment of drug-resistant tuberculosis Xiaoyun Lu, Zoe Williams, Kiel Hards, Jian Tang, Chen-Yi Cheung, Htin Lin Aung, Bangxing Wang, Zhiyong Liu, Xianglong Hu, Anne J. Lenaerts, Lisa Woolhiser, Courtney Hastings, Xiantao Zhang, Zhe Wang, Kyu Y. Rhee, Ke Ding, Tianyu Zhang, and Gregory M Cook ACS Infect. Dis., Just Accepted Manuscript • DOI: 10.1021/acsinfecdis.8b00225 • Publication Date (Web): 28 Nov 2018 Downloaded from http://pubs.acs.org on November 29, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Infectious Diseases

A pyrazolo[1,5-a]pyridine inhibitor of the respiratory cytochrome bcc complex for the treatment of drug-resistant tuberculosis Authors: Xiaoyun Lu1,*, Zoe Williams2, Kiel Hards2,3, Jian Tang4, Chen-Yi Cheung2, Htin Lin Aung2,3, Bangxing Wang4,5, Zhiyong Liu4,6, Xianglong Hu1, Anne Lenaerts7, Lisa Woolhiser7, Courtney Hastings7, Xiantao Zhang8, Zhe Wang9, Kyu Rhee9, Ke Ding1, Tianyu Zhang4,6, and Gregory M. Cook2,3,* 1 School

of pharmacy, Jinan University, 601 Huangpu Avenue West, Guangzhou 510632,

China 2 Department

of Microbiology and Immunology, School of Biomedical Sciences, University of

Otago, Dunedin 9054, New Zealand 3 Maurice

Wilkins Centre for Molecular Biodiscovery, The University of Auckland, Private Bag

92019, Auckland 1042, New Zealand 4Tuberculosis

Research Laboratory, State Key Laboratory of Respiratory Disease,

Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, 190 Kaiyuan Ave, Science Park, Huangpu District, Guangzhou 510530, China. 5Institute

of Physical Science and Information Technology, Anhui University, 111 Jiulong

Road, Shushan District, Hefei 230009, China. 6University

of Chinese Academy of Sciences (UCAS), 19 Yuquan Road, Shijingshan District,

Beijing 100049, China. 7Colorado

State University, 200W, Lake Street, Fort Collins, Colorado 80523

8Guangzhou 9Weill

Eggbio Co., Ltd, 3 Ju Quan Road, Science Park, Guangzhou, 510663, China

Department of Medicine, Weill Cornell Medical College, New York, NY 10021, USA

X.L., ZW and K.H. contributed equally to this work. *To whom correspondence should be addressed: Xiaoyun Lu, E-mail: [email protected] Greg Cook, Email: [email protected]

ACS Paragon Plus Environment

1

ACS Infectious Diseases 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 42

Respiration is a promising target for the development of new antimycobacterial agents, with a growing number of compounds in clinical development entering this target space. However, more candidate inhibitors are needed to expand the therapeutic options available for drug-resistant Mycobacterium tuberculosis infection. Here, we characterize a putative respiratory complex III (QcrB) inhibitor, TB47: a pyrazolo[1,5-a]pyridine-3-carboxamide. TB47 is active (MIC between 0.016 - 0.500 µg/mL) against a panel of 56 M. tuberculosis clinical isolates, including 37 multi-drug resistant and 2 extensively-drug resistant strains. Pharmacokinetic and toxicity studies showed promising profiles, including negligible CYP450 interactions, cytotoxicity and hERG channel inhibition. Consistent with other reported QcrB inhibitors, TB47 inhibits oxygen consumption only when the alternative oxidase, cytochrome bd, is deleted. A point mutation in the qcrB cd2-loop (H190Y, M. smegmatis numbering) rescues the inhibitory effects of TB47. Metabolomic profiling of TB47-treated M. tuberculosis H37Rv cultures revealed accumulation of steps in TCA cycle and pentose phosphate pathway that are linked to reducing-equivalents, suggesting that TB47 causes metabolic redox stress. In mouse infection models, a TB47 monotherapy was not bactericidal. However, TB47 was strongly synergistic with pyrazinamide and rifampicin, suggesting a promising role in combination therapies. We propose that TB47 is an effective lead compound for the development of novel tuberculosis chemotherapies. Key words: tuberculosis, Mycobacterium tuberculosis, cytochrome bcc complex, QcrB, respiratory inhibitor


2

Page 3 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Tuberculosis (TB) remains one of the leading worldwide causes of infectious disease mortality globally with over one million annual deaths.1 The emergence of multidrug-resistant (MDR), extensively drug-resistant (XDR) and totally drugresistant (TDR) strains of Mycobacterium tuberculosis threatens to return society to the pre-antibiotic era for this disease.2 Current drugs for treating drug-resistant TB disease are slow-acting and even drug-sensitive strains require treatment with up to four drugs for at least six months.3 At present, MDR-TB is treated with a combination of eight to ten drugs lasting up to 18-24 months.4 Bedaquiline (BDQ; SIRTURO®) was approved by FDA in 2012 as part of combination therapy for the treatment of adults with pulmonary MDR-TB.5,6 However, Phase 2 clinical trials showed a higher mortality rate in subjects assigned to the BDQ cohort compared to the placebo group.7 A full evaluation of BDQ’s safety is not expected until the completion of the phase III STREAM clinical trial, anticipated to complete in 2020.1 Furthermore, adverse effects and long treatment timeframes are a significant factor affecting patient nonadherence.8 Taken together, these factors highlight the need for effective and fast-acting anti-TB drugs with good safety profiles. BDQ targets the energy-generating machinery (F1Fo-ATP synthase) of M. tuberculosis 9,10 and so energy generation has been proposed as a new targetspace for antimicrobial drug development.11 BDQ is generally bactericidal even against highly drug-resistant mycobacterial species.12,13 It acts quickly compared to most TB drugs, but still requires many weeks of therapy and resistance to this new drug has already been reported.14 Other proteins in the energy generation pathway are now being explored as potential drug targets: SQ109 (a 1,2-diamine related to ethambutol), has been shown to inhibit menaquinone biosynthesis 15,16 and Q203 (an imidazopyridine amide) targets the cytochrome bcc complex (i.e. complex III; 17). Cytochrome bcc is an intermediate step in the terminal reduction of oxygen in aerobic electron transport chains.18,19 It accepts electrons from quinones and reduces cytochrome c, which is subsequently used by cytochrome aa3 (i.e. complex IV) for the reduction of oxygen. Complex III and IV are thought to


3


Page 4 of 42

operate as a supercomplex in mycobacteria.20,21 Cytochrome bcc translocates protons as part of the Q-cycle,22,23 which distinguishes it from the alternative oxygen-reductase in mycobacteria; cytochrome bd. Cytochrome bd is a highaffinity quinol oxidase that plays essential roles in a number of important physiological functions, allowing pathogenic and commensal bacteria to colonise oxygen-deficient environments.24 It has been shown that Q203 binds the quinol oxidation site (Qp) in the cytochrome b subunit of complex III (QcrB) to cause bacteriostasis.17,25 Bactericidal activity is achieved when Q203 is combined with the inactivation of cytochrome bd,25 suggesting functional redundancy in terminal electron reduction. Imidazopyridine amides (IPAs) are the most well-known QcrB inhibitors for M. tuberculosis treatment, but there is much interest in developing additional compound scaffolds to expand the therapeutic toolbox against QcrB. In this regard, lansoprazole,26 pyrrolopyridines,27 thiazole carboxamides,28 quinolinyloxy acetamides 29 and phenoxy alkyl benzimidazoles 30,31 have been found to target the QcrB subunit. Recently, a series of pyrazolo[1,5-a]pyridine-3-carboxamide compounds were identified as new anti-tuberculosis agents.32,33 Here, we identify the target of the lead compound, TB47, to be the menaquinol oxidation site of the mycobacterial QcrB. This shows that pyrazolopyridine carboxyamides are a novel scaffold for QcrB inhibitors. Although inhibiting QcrB is bacteriostatic, TB47 was strongly synergistic with pyrazinamide and rifampicin in mouse infection models, suggesting a promising role in combination therapies.


4

Page 5 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Results and Discussion In vitro activity of TB47 and target identification. The lead compound from the previous synthesis of pyrazolo[1,5-a]pyridine-3-carboxamides (32,33; PPCAs), TB47 (Figure 1A and Figure S1) was selected on the basis of its MIC (Table S1). TB47 was synthesized in bulk and tested against a panel of clinical M. tuberculosis isolates from China (Table 1). Approximately 56 M. tuberculosis isolates were tested, with 37 multi-drug resistant (isoniazid- and rifampicinresistant) and two extensively-drug resistant isolates included in the panel. TB47 was able to inhibit the growth of all isolates tested, with MIC values between 0.016 - 0.500 µg/mL (MIC50 = 0.016 µg/mL, MIC90 = 0.1250 µg/mL, MIC99 = 0.3625 µg/mL; where n in MICn refers to the nth percentile of MIC in the population of clinical sample MICs). It should be noted that inhibition of growth is not equitable with killing (bactericidal activity). No pattern was observed between traditional drug-susceptibility profiles and MIC, suggesting the strain-to-strain efficacy is unaffected by resistance to standard M. tuberculosis regimens and so suitable for the treatment of MDR- and XDR-TB. TB47 was hypothesized to be an inhibitor of the Mycobacterium tuberculosis respiratory complex III (QcrB; Rv2196) due to structural similarities between TB47 (Figure 1A) and the imidazopyridine amide (IPA) compound Q203.17 To test this hypothesis, we attempted to generate spontaneous resistant mutants to TB47. As Q203 is known to be bactericidal only when cytochrome bd is disrupted,25 we attempted to generate spontaneous TB47-resistant mutants in M. smegmatis harbouring a markerless deletion of cytochrome bd (ΔcydAB) (Figure S2, Supplementary Table S1). We were successful in this genetic background: the mutation frequency of TB47 resistance was 1.3 × 10-5. Six TB47-resistant isolates (MIC > 5 M) were sent for whole genome sequencing (Table S2) and one isolate harboured a SNP in the qcrB gene locus (H190Y M. smegmatis numbering; Figure 1B). The H190Y mutation restored resistance to TB47 in the Δcyd background (Table S1). The location of the point mutation is close to (but not inside) the quinone-binding cavity (Qp), which is the target of


5


Page 6 of 42

Q203 (Figure 1C). H190 is located in the cd2-loop of QcrB, which is thought to interact with the quinone-binding site.34 Our inability to isolate spontaneous mutants in wild-type isolates is likely due to the branched nature of the mycobacterial electron transport chain: inactivation of both of the mycobacterial terminal oxidases is necessary to cause mycobacterial death 25 and in this background resistance is likely to occur phenotypically through compensation by cytochrome bd. TB47 inhibits oxygen consumption dependent on QcrB. We performed oxygen consumption assays on resting cell suspensions of M. smegmatis to confirm that QcrB could indeed function in the presence of TB47 with the H190Y mutation (Figure 1D). Wild-type (mc2155) cells of M. smegmatis were able to respire in the presence of TB47 and Q203, suggested compensation by cytochrome bd (Figure 1D). In support of this, TB47 and Q203 completely inhibited respiration in the M. smegmatis ΔcydAB mutant (Figure 1D). The M. smegmatis qcrB H190Y mutation restored oxygen consumption in the ΔcydAB background, indicating that TB47 inhibits oxygen consumption dependent on QcrB in M. smegmatis. The H190Y mutant was cross-resistant to Q203, on the basis of OCR (Figure 1D), suggesting similar modes of inhibition between the two QcrB inhibitors. To gain insight into the interaction of TB47 and QcrB in both fast- and slow-growing mycobacteria, we generated homology models of the M. smegmatis and M. tuberculosis QcrB proteins and performed docking studies of TB47 in the Qp binding site (Figure 2A and B). TB47 was found to mimic the modelled binding of Q203 against the M. smegmatis QcrB (Figure 2A), by π-π interactions with the aromatic side chains of Y321 and F156. H190 is occluded from the binding site and sits on the outward-facing side of the helix (Figure 2A), suggesting that any interactions of the H190Y residue with the Qp-binding site are through indirect structural changes. The Q203-resistant spontaneous mutant is a T313A mutation.17 The equivalent residue (T308) in the M. smegmatis model is ~12 Å away from either TB47 or Q203, suggesting the binding in M. smegmatis


6

Page 7 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


may differ from M. tuberculosis. Indeed, in the M. tuberculosis model (Figure 2B), TB47 adopts a different conformation (c.f. the Q203 model in 34). This appears to be induced by a potential hydrogen bonding interaction with the amide of TB47 and glutamate residue E314 (Figure 2B). Although the exact binding modes may not be conserved, we performed oxygen consumption assays on M. bovis BCG to confirm that our prior oxygen consumption results (Figure 1D) hold true for slow-growing mycobacteria. We observed that oxygen consumption in M. bovis BCG can only by ablated by TB47 if the cytochrome bd oxidase is disrupted (Figure 2C). This effect could be complemented (Figure 2C). Taken together, these data suggest that TB47 is a bona fide inhibitor of QcrB but that the qcrB SNPs conferring resistance may differ between fast- and slow-growing mycobacteria. The H190Y point mutation exists outside of the Qp quinol oxidation site (Figure 2), but still provides resistance to inhibition of oxygen consumption (Figure 1). This residue is located in the cd2-loop 34 of QcrB, which does not form the walls of the Qp site but covers up the pocket from the pseudo-periplasmic region. The mode of resistance is therefore likely to occur through by an indirect rearrangement of the Qp site structure. Given that the basal rate of oxygen consumption was unaffected in the H190Y mutant (Figure 1), it could be suggested that this mutation is non-deleterious and that the Qp site possesses plasticity. In this case it could be expected that such mutations would already exist in clinical isolates. However, across a panel of 56 isolates, all the MIC values were < 1 μM (Table 1). This suggests that the mutation either does not currently exist in M. tuberculosis strains isolated in China, the mutation is specific to fast-growing mycobacteria or that there is some unresolved deleterious effect. Taken together, we propose that there is real therapeutic benefit to the use of QcrB inhibitions, but that the potential for resistance should be considered. Metabolic consequences of QcrB inhibition. The dependence of TB47 activity on cytochrome bd disruption (Figures 1 and 2) suggests that TB47 would be effective and bactericidal if combined with an inhibitor of the cytochrome bd


7


Page 8 of 42

oxidase. However, given its apparent potency against clinical isolates (Table 1) and conditional activity against laboratory adapted M. tuberculosis strains, we sought to understand its broader mode of action against M. tuberculosis H37Rv. To do so, we exposed M. tuberculosis H37Rv to increasing concentrations of TB47 and recovered its metabolome for analysis by LC/MS (Dataset S1). We identified a number of metabolites that exhibited a dose-dependent response (as assessed by linear regression fitting) and exhibited at least 1.5-fold change at the highest concentration tested (Figure 3A and 3B). There was no clear impact of TB47 on the three adenylate nucleotides (ATP, ADP, and AMP) or energy charge, consistent with the sub-lethal nature of experimental conditions (Figure 3C). Clear and specific effects were observed for a number of intermediates and pathways dependent on respiratory turnover/regeneration of NAD and synthesis of ATP. These included a 4-fold accumulation of the pentose phosphate pathway intermediate 6-phosphogluconate (Figure 3F), a 2-3-fold accumulation of the TCA cycle-related intermediates succinate and gamma-aminobutyric acid (GABA) (Figure 3D), and the cataplerotic TCA cycle-derived amino acids aspartate and arginine (Figure 3E). Together, these results suggest that inhibition of QcrB, while fully compensated for on the basis of OCR by cytochrome bd (Figure 1D and 2C), renders M. tuberculosis into a specific state of metabolic stress not fully compensated for by cytochrome bd activity. Our ability to isolate SNPs of both a ribose transporter and acetylornithine deacetylase (Table S2), complements the observation that 6-phosphogluconate and acetylornithine accumulates in the metabolomics analysis. This suggests that the routes of phenotypic resistance are comparable between fast- and slowgrowing mycobacteria. As a monotherapy, this analysis suggests that sole usage of cytochrome bd fails to meet the energy demand for replenishing the nucleotide pool in M. tuberculosis. A potential explanation is a lowered flux of respiration resulting in a slower clearing of reducing equivalents and accumulating substrates (succinate, phosphogluconate) at steps that produce them. Although OCR is maintained upon TB47 addition (Figure 1D, 2C), it takes more quinols per mole of oxygen to perform the Q-cycle in Qcr than it does for cytochrome bd to


8

Page 9 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


reduce an oxygen 11 and so a higher OCR is needed to maintain the same ratio of reduced:oxidized equivalents. In support of this, 6-phosphogluconate is converted to ribulose-5-phosphate through a NADP+ reduction linked step and accumulates (Figure 3D), while another prominent example is the accumulation of succinate (an FAD+ linked reducing step, Figure 3C). The growth-inhibitory mechanism of TB47 against wild-type M. tuberculosis strains may therefore depend on the inhibition of a multitude of reduced cofactor-linked reactions. Pharmacological and toxicological profiling of TB47. To further explore the potential impact of TB47 on M. tuberculosis survival in vivo, we characterized its toxicological and pharmacological parameter (Tables S3 and S4, Figure S4). TB47 has a selectivity index (bacterial MIC/human cell line IC50) of 1200 to >3330 depending on the cell line used (Table S3; THP-1, VERO, or HepG2), and a lack of activity against a panel of seven cytochrome P450 enzymes up to a concentration of 20 μM (Table S3). Patch clamp assays of hERG channel activity similarly failed to reveal any evidence of potential cardiotoxicity with an IC50 value of greater than 30 µM (Figure S5). The metabolic stability of TB47 in microsomes was high, suggesting that it might achieve good blood exposure in humans (Table S3). Notably, high plasma protein binding and poor apical to basolateral transport in CaCo-2 permeability assays would suggest poor absorption and distribution of TB47 (Table S3), however in Sprague−Dawley (SD) rats TB47 has an oral bioavailability of 94.3% with a half-life of 19.1 ± 3.2 h (Figure S4; Table S4). Only 10 mg/kg oral dosing was needed reach a similar Cmax from 2 mg/kg iv dosing in SD rats (485 ± 81.1 μg/L c.f. 589 ± 232 for iv dosing). Acute toxicity studies failed to demonstrate any measurable toxicity with single oral administration of 200, 500, 1000, and 2000 mg/kg in SD rats, and a maximum tolerated dose (MTD) of greater than 2000 mg/kg was observed (Figure S3). The lack of toxicity in both human cell lines and rat models, combined with high oral bioavailability in rats, suggest TB47 would be promising as an oral medication.


9


Page 10 of 42

TB47 synergizes with pyrazinamide and rifampicin in vivo. Given the favourable safety parameters, we progressed our TB47 analysis to mouse infection studies. When BALB/c mice were chronically infected with M. tuberculosis for 3 weeks prior to treatment (Figure 4, Table S5), we found no significant reduction in the lung CFU (Figure 4A) and only a slight reduction in the spleen CFU (Figure 4B), mirroring the reported activity of Q203. Using an acute model of M. tuberculosis H37Rv infection in BALB/c mice (in which 80% of untreated mice succumb within 4 weeks of infection; Figure 5, Table S6) however, we observed that TB47 was able to inhibit growth of M. tuberculosis H37Rv in a dose-dependent manner (Figure 5B) and reduce mortality to zero over the timeframe of the experiment (Table S6). Consistent with its lack of activity in a model of chronic infection, this activity was not bactericidal as 4 weeks of TB47 treatment was unable to reduce the lung CFU to below time-zero levels (Figure 5A and 5B). Surprisingly, TB47 exhibited a potent synergy with sub-therapeutic doses of pyrazinamide (PZA) and rifampicin (RIF) (Figure 5C), causing a 4- and 5-fold reduction in lung CFU compared to the respective PZA and RIF monotherapy. Increasing NADH:NAD+ ratios have been proposed to inhibit the formation of the active isoniazid-NAD adduct,35 while rifampicin and pyrazinamide have been found to cause an increase of the NADH/NAD+ ratio 36 and so a pre-existing perturbation of the NADH:NAD+ by TB47 could explain the synergy with rifampicin, pyrazinamide and the lack thereof with isoniazid (Figure 5). Thus, while TB47 most likely needs a cytochrome bd inhibitor to achieve maximal inhibition of M. tuberculosis respiration, its apparent synergy with current M. tuberculosis therapies reveals a potent and practical synthetic lethality with 2 existing frontline drugs specifically rendered by TB47.


10

Page 11 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conclusions: More candidate inhibitors are needed to expand the therapeutic options available for drug-resistant M tuberculosis infection. This work shows that pyrazolopyridine carboxyamides are a novel scaffold for QcrB inhibitors. The lead molecule, TB47, inhibits QcrB and operates in a similar manner as Q203. We propose that multitherapies of TB47 and rifampicin, pyranzinamide or cytochrome bd inhibitors may result in enhanced clearance of M. tuberculosis infections. Although inhibiting QcrB is bacteriostatic, TB47 may have a promising role in multi-therapies. While resistance is a real threat to inhibitors of QcrB, we advocate for its cautious application due to its considerable bactericidal potential when combined with cytochrome bd inactivation. We propose that TB47 is both practical and effective for the treatment of M. tuberculosis.


11


Page 12 of 42

Methods: Pharmacokinetic and Acute toxicity studies are described in the Supplementary Materials and Methods Synthesis of TB47 (5-methoxy-2-methyl-N-(4-(4-(4(trifluoromethoxy)phenyl)piperidin-1-yl)benzyl) pyrazolo[1,5-a]pyridine-3carboxamide): TB47 was synthesized as previously described;32,33 Figure S1). In brief, TB47 was synthesized through an EDCI-mediated amidation of primary amine A and carboxylic acid B with nine steps (refer to Figure S1 for full compound names). The key intermediate amine A was synthesized starting from tert-butyl 4-oxopiperidine-1-carboxylate SM1 and 1-bromo-4(trifluoromethoxy)benzene SM2 by condensation reaction, followed by elimination, reduction, nucleophilic and reduction reaction. The key intermediate carboxylic acid B was obtained from 4-methoxypyridine by N-amination with DNPH, followed by cycloaddition and Hydrolysis reaction. TB47 (1.01 kg) was obtained as a pale yellow solid. 1H NMR (500 MHz, DMSO-d6) δ 8.5015 (d, J = 7.5Hz, 1H), 7.8250 (t, J = 6.0 Hz, 1H), 7.4108(d, J = 8.65 Hz, 2H), 7.2942 (d, J = 8.3 Hz, 2H), 7.2486 (t, J = 8.0 Hz，1H), 7.2486 (t, J = 4 Hz, 1H), 7.2234 (s, 2H), 6.9609 (d, J = 8.6 Hz, 2H), 6.6373 (dd, J = 2.75 Hz, J = 7.5 Hz, 1H), 4.4106(d, J = 5.9 Hz, 2H), 3.8509 (s, 3H), 3.7851 (d, J = 12.4 Hz, 2H), 2.6972-2.7454 (m, 3H), 2.5262 (s, 1H), 1.8708 (d, J = 12.3 Hz, 2H), 1.7040-1.7859 (m, 2H). 13C NMR (125 MHz, DMSO-d6): δ (ppm) 163.39, 157.66, 151.41, 150.16, 146.61, 145.50, 141.63, 130.38, 129.64, 128.50, 127.99, 120.93 (q, J =254Hz, 1C), 115.90, 106.44, 104.12, 95.55, 55.60, 49.55, 41.71, 40.89, 32.55, 13.95. HRMS (ESI) calcd for C29H29F3N4O3 [M+H]+: 539.2270; found 539.2265. HPLC purity = 98.67%, Rt 13.79 min. Full details are available in the Supplementary Materials and Methods. Bacterial strains, compound testing and media composition: M. smegmatis mc2155 (wild-type) and M. smegmatis mc2155 harbouring a markerless deletion of the cydAB gene (cydAB; Fig. S2) were used as indicated. Strains were grown on Hartmans-de Bont (HdeB) 37 containing 27 mM glycerol, supplemented with 0.05% (w/v) Tween 80 at pH 7.5. Solid media was LBT with 1.5% agar.


12

Page 13 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Mycobacterium bovis BCG strains 25 were maintained in Middlebrook 7H9 broth supplied with 0.05% Tween 80 (Sigma), 0.2% glycerol (v/v) and AlbuminDextrose Saline (ADS) at 37C with no agitation. If applicable, kanamycin 20 g/ml or hygromycin 80 g/ml was added to medium to select for mutant or complemented strains. Q203 was a kind gift of Kevin Pethe (Nanyang Technological University). Minimum inhibitory concentration (MIC) values for M. smegmatis were determined by visual reduction of Alamar Blue/Resazurin of a cell pellet after 24 hours growth in HdeB medium containing 27 mM glycerol, supplemented with 0.05% (w/v) Tween 80 at pH 7.2 at 37C with agitation (200 rpm). Cells were grown in 96-well microtitre plates inoculated with a starting OD600 = 0.005 and TB47 or DMSO at various dilutions was added at T = 0 h. Resazurin (0.05% v/v final concentration) was added at 24 h and cultures were incubated for a further 2 hours to determine the MIC. To determine the MIC for M. bovis BCG Pasteur, cells were grown in Middlebrook 7H9 broth supplemented with 0.05% Tween 80, 0.2% glycerol (v/v) and ADS at 37C with no agitation. The starting OD600 was 0.05 and cells were incubated at 37C with no agitation for 7 days. Resazurin was added and cultures were left to incubate for a further 24 hours before results were visually determined. MIC values for M. tuberculosis strains were assessed by the MABA assay method.38 The MICs were defined as the lowest concentration effecting a reduction in fluorescence of ≥ 90% relative to the mean of replicate bacteria-only controls. DS, MDR- and XDR- M. tuberculosis strains for MIC testing were obtained from the Chinese Center for Disease Control and Prevention. Oxygen consumption assay: Oxygen consumption of M. smegmatis and M. bovis BCG resting cell suspensions were performed as previously described,39 with the exception that an Oroboros O2k fluorespirometer was used instead of a Rank Brothers Oxygen Electrode. In brief, 2 mL cells (OD600 = 1.0) were added to the measurement chamber, which contains a O2 sensing clark-type electrode. The suspension was stirred at 750 rpm at 37C throughout the experiment. Final concentrations of 5 mM glycerol and the amounts of compound indicated in text


13


Page 14 of 42

was added to the closed chamber. Total cell protein content was estimated using the BCA assay (Pierce) and used to express rates as nmol O2 min-1 (mg protein)1.

A two point calibration of air saturated buffer (100% O2) and buffer reduced

with a few grains of sodium dithionite (0% O2) was used to calculate nmol O2 from mV response assuming oxygen solubility of 220 nmol mL-1 at 37C. M. smegmatis was washed in phosphate-buffered saline (PBS) containing 0.05 % Tween80 prior to experiment. M. bovis BCG was harvested directly from an exponentially growing culture. Liquid chromatography – mass spectrometry (LC-MS) metabolomics: As previously reported, filter-cultured M. tuberculosis strain H37Rv was first grown 5 days in 7H10 agar media to expand biomass, and then moved to fresh 7H10 medium containing different concentrations of TB47 or vehicle control (DMSO) for a sublethal 24-hour exposure. M. tuberculosis metabolism was quenched by plunging M. tuberculosis–laden filters into extraction buffer (acetonitrile: methanol: H20=40:40:20) precooled to -40 °C on dry ice (PMID: 25779312). M. tuberculosis metabolites were then extracted by mechanical lysis with zirconia beads in Precellys tissue homogenizer under continuous cooling at or below 2 °C. Extracted M. tuberculosis metabolites were analyzed by high performance liquid chromatography-coupled mass spectrometry using an Agilent 1290 HPLC and Accurate Mass 6220 TOF or 6520 qTOF mass spectrometer, as previously described (PMID: 23576728). M. tuberculosis metabolites were identified based on curated accurate mass-retention time identifiers, and quantified using Agilent Quantitative Analysis software and Agilent Profinder software with a mass tolerance of < 0.005 Da. Linear regressions were modelled to the log2-log10 transformed data (i.e. log2(Fold Change) vs log10([TB47])) for each metabolite using R. The default F-test performed by the lm function was used to evaluate if the two variables were linearly related. DNA manipulation, whole genome sequencing and single nucleotide polymorphisms identification: All molecular biology techniques were carried out according to standard procedures.40 Restriction or DNA-modifying enzymes and other molecular biology reagents were obtained from Roche Diagnostics or


14

Page 15 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


New England Biolabs. Genomic DNA of M. smegmatis (wild-type and mutants) was extracted and purified using an UltraClean Microbial DNA Isolation kit (Mo Bio Laboratories, Inc.) following the manufacturer’s instruction. To generate a markerless ∆cydAB mutant in M. smegmatis, a two-step approach using pX33 was performed as previously described.41 Genomic DNA was used as a template to amplify (via PCR) left flanking [primer pairs LF(GGACTAGTACGACCATGGACCCAGCG ) and LR(CTCGGACGGCGGCGCGAGCCCGATCGT)] and right flanking [primer pairs RF-(CGGCGCGAGGTGCAGGGGCCGTCCGAG) and RR(GGACTAGTACGACGCTCGTCGCACCG)] DNA fragments of the cydAB operon (Fig. S2). These two PCR products were used as a template for overlap extension PCR and the product was then cloned into the SpeI site of the pX33 vector,42 resulting in pHL30, and transformed into M. smegmatis mc2155. The cydAB gene was then deleted using the two-step method for integration and excision of the plasmid as described previously.41 A successful double crossover event gives rise to a truncated (cydAB) mutant as confirmed using the primer pairs LF and RR (Fig. S2). A PCR product 2.4 kb smaller than the wild-type (WT) i.e. a 1.5 kb band was observed in putative ∆cydAB mutants (Figure S2B, lanes 1-2, 5-13). Mutants were also confirmed by whole genome sequencing (see below) after validation using PCR. Mutants were further validated using reduced (Na-dithionite) minus oxidised (ferricyanide) difference spectra performed as previously described 43 on inverted membrane vesicles (prepared as previously described 44 of the indicated strains to confirm the loss of the d-type haem absorbance at 627 nm (Fig. S2C). Based on the combined data, mutant 2 was renamed cydAB strain HLA888. To generate spontaneous TB47-resistant mutants, M. smegmatis cydAB was spread plated at various dilutions onto 7H11 plates with either glycerol or sodium pyruvate (20 mM final concentration) and containing 1 M of TB47 and grown at 37C until colonies formed (2 weeks). Mutants were colony purified, DNA extracted and subjected to whole genome sequencing (WGS) on an Illumina MiSeq using the Nextera™ XT DNA kit (Illumina, CA) as described


15


Page 16 of 42

previously.45 The cydAB (isogenic parent) was also sequenced. The resulting sequences were mapped to the genome of reference strain M. smegmatis mc2155 (GenBank accession no. NC_008596) by using the Geneious 10.0 package (Biomatters Ltd, Auckland, New Zealand) to identify SNPs. The resulting sequencing data were submitted to the NCBI Nucleotide Archive (PRJNA503260). Homology modelling and docking studies: All protein sequences were obtained from the protein UniProt databases. The sequences of QcrB for M. smegmatis (Accession code: I7FGS8) and Mycobacterium tuberculosis (Accession code: P9WP37) showed a high sequence identity with the QcrB for Rhodobacter sphaeroides (Accession code: Q02761) by PRIME (Schrodinger, LLC.). The homology models were built on the energy-based (include the ligand) by the PRIME software using the structure of QcrB for Rhodobacter sphaeroides (PDB Code: 2QJP. pdb). All other PRIME parameters were set to their default values. Next, explicit hydrogens were added to the protein and the system subjected to energy minimization using the Macromodel force-field OPLS-2005 and the Polak-Ribiere conjugate gradient algorithm. Phyre2 modeling was performed on the online portal 46 using the M. smegmatis QcrB (MSMEG_4263) amino acid sequence as the input. The homology model of QcrB for M. smegmatis was used as the reference structures. All the ligand and protein preparations were performed in Maestro (version 9.4, Schrödinger, LLC). The proteins were prepared using the Protein Preparation Wizard and the ligands (TB47 and Q203) were prepared using the LigPrep within Maestro 9.4 (Schrödinger, LLC). The hydrogens were added, bond orders were assigned, and missing side chains for some residues were added using PRIME. The added hydrogens were subjected to energy minimization until the root-mean square deviation (rmsd), relative to the starting geometry, reached 0.3 Å. The Glide docking program in Maestro 9.4 was used for docking studies. For Glide docking, the grid was defined using a 20 Å box centered on the ligand, and the important water molecules around ligand were kept. All parameters were kept as default. The designed molecules were docked


16

Page 17 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


using Glide SP mode, and the predicted binding poses of all the compounds were ranked according to their glidescores. Mouse infection studies: Chronic Erdman M. tuberculosis infection. Female Balb/c mice, aged seven to nine weeks were infected by the aerosol route on Day 0 using the Inhalation Exposure System (Glas-col Inc, Terre Haute, IN) to result in a lung bacterial load of an average of 100 colony forming units (CFU) per mouse. The M. tuberculosis Erdman strain (1.96 x 107 CFU/mL) was used for the infection. Mice were randomized to treatment groups (6 mice per group) after aerosol infection. Three mice were sacrificed day 1 post-aerosol to determine bacterial uptake. Treatments were given at 35 days after infection by oral gavage. For both 4-week and 8-week time points; mice were euthanized, spleen and left lung lobes homogenized in PBS and plated on 7H11/OADC agar plates. For day 1 samples, whole lungs were removed, homogenized in 2 ml of PBS and plated at 0 dilution. The plates were placed in a 37°C dry-air incubator for approximately 3 weeks. These experiments were approved by the Colorado State University Animal Care and Use Committee. M. tuberculosis strain H37Rv infection. For other TB47 dosing and combination therapy experiments, the following modifications were used. The 4 to 6 week old female Balb/c mice were infected with M. tuberculosis H37Rv from frozen stock by the aerosol route. Five mice were sacrificed at day 1 postinfection to determine the initial bacterial load and five mice were used per treatment group. Drugs were formulated in 0.5% carboxymethyl cellulose (CMC)Na and administered by oral gavage for 4 weeks, five times per week. The negative control was 0.5% CMC-Na. In the combination treatment groups, mice were administrated with a 2-h gap between two drugs (TB47 being administered first) to avoid potential adverse PK interactions, such as previously observed with rifampicin.47 These experiments were conducted in the ABSL-Ⅲ Laboratory at the Laboratory Animal Center of Wuhan University. The experimental program involving animal feeding and use was submitted to, and approved by, the Animal Welfare Department of Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences before the start of the experiment.


17


Page 18 of 42

Supporting information: Supplementary Figure S1. Synthetic route for TB47 production. Supplementary Figure S2. Construction and validation of an inframe markerless cydAB deletion in M. smegmatis. Supplementary Figure S3. Acute toxicity studies. Supplementary Figure S4. TB47 concentration as a function of time for TB47 administration to male Sprague−Dawley rats. Supplementary Figure S5. hERG channel inhibition. Supplementary Table S1. MIC for indicated mycobacterial strains as determined by Alamar Blue/Resazurin Assays Supplementary Table S2: Point mutations identified by whole genome sequencing of TB47-resistant M. smegmatis ∆cydAB mutants Supplementary Table S3: Toxicity profiling of TB47 Supplementary Table S4: Pharmacokinetic parameters of TB47 in Sprague−Dawley rats Supplementary Table S5. CFU counts for treatment of BALB/c mice with chronic Erdman M. tuberculosis infection. Brackets indicate mg/kg doses. See text for procedures. Supplementary Table S6. CFU counts for treatment of BALB/c mice with acute M. tuberculosis H37Rv infection. Supplementary Dataset 1: Log2(Fold Changes) for the indicated metabolites when M. tuberculosis H37Rv cells were treated with the indicated concentrations of TB47. A linear regression was fitted to the log2-log10 transformed data and the parameters are shown. Corresponding Author Information: Xiaoyun Lu: [email protected] Greg Cook: [email protected]


18

Page 19 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Acknowledgements: The authors appreciate the financial support from Guangdong Natural Science Funds (2015A030306042, 2016A030313106), the Chinese Academy of Sciences Grants (154144KYSB20150045, YJKYYQ20170036), Guangzhou Municipal Industry and Research Collaborative Innovation Program (201508020248, 201604020019), Maurice Wilkins Centre for Molecular Biodiscovery and the Marsden Fund, Royal Society, New Zealand. ZW was supported by a University of Otago Doctoral Scholarship and a Freemason Scholarship of New Zealand. TZ. received support “Science and Technology Innovation Leader of Guangdong Province (2016TX03R095)”. In addition, this work was supported by National Institutes of Health and the National Institute of Allergy and Infectious Diseases (HHSN272201000009I/HHSN27200005/Task A81). We thank Kevin Pethe for supplying M. bovis BCG cytochrome bd mutant, complementing strain and Q203. The authors have no conflict of interest to declare Abbreviations: WT, wild-type; i.p., intraperitoneally; i.v., intravenously; p.o., oral gavage; MDR, multidrug-resistant; XDR, extensively drug-resistant; TDR, totally drug-resistant; LC/MS, liquid chromatography – mass spectrometry; GABA, gammaaminobutyric acid; PBS, phosphate buffered saline; IPA, imidazopyridine amide; OCR, oxygen consumption rate; NAD, nicotinamide adenine dinucleotide (oxidized form), NADH, nicotinamide adenine dinucleotide (reduced form); NADP, nicotinamide adenine dinucleotide phosphate (oxidized form); AMP, adenosine monophosphate; ADP, adenosine diphosphate; ATP, adenosine triphosphate; CFU, colony forming units; INH, isoniazid; PZA, pyrazinamide; RIF, rifampicin; CPM, capreomycin; STR, streptomycin; KAN, kanamycin; OFX, ofloxacin; EMB, ethambutol; BDQ, Bedaquiline (SIRTURO®); DS, drug susceptible; R, resistant; S, sensitive; quinol oxidation site, Qp; MTD, maximum tolerated dose.


19


Page 20 of 42

References: [1] WHO (2018) Global Tuberculosis Report 2018. [2] Dheda, K., Gumbo, T., Gandhi, N. R., Murray, M., Theron, G., Udwadia, Z., Migliori, G. B., and Warren, R. (2014) Global control of tuberculosis: From extensively drug-resistant to untreatable tuberculosis, Lancet Respir. Med., 321-338. DOI: 10.1016/S2213-2600(14)70031-1. [3] WHO Treatment of tuberculosis: guidelines (2010) 4th ed., WHO Press, Geneva. [4] WHO Guidelines for the programmatic management of drug-resistant tuberculosis, (2008) Emergency Update 2008. [5] Jones, D. (2013) Tuberculosis success, Nat. Rev. Drug Discov. 12, 175. DOI: 10.1038/nrd3957. [6] Cohen, J. (2013) Approval of novel tb drug celebrated—with restraint, Science 339, 130-130. DOI: 10.1126/science.339.6116.130. [7] Diacon, A. H., Pym, A., Grobusch, M. P., de los Rios, J. M., Gotuzzo, E., Vasilyeva, I., Leimane, V., Andries, K., Bakare, N., De Marez, T., HaxaireTheeuwes, M., Lounis, N., Meyvisch, P., De Paepe, E., van Heeswijk, R. P., Dannemann, B., and Group, T. C. S. (2014) Multidrug-resistant tuberculosis and culture conversion with bedaquiline, N. Engl. J. Med. 371, 723-732. DOI: 10.1056/NEJMoa1313865. [8] Horsburgh, C. R., Jr., Barry, C. E., 3rd, and Lange, C. (2015) Treatment of tuberculosis, N. Engl. J. Med. 373, 2149-2160. DOI :10.1056/NEJMra1413919. [9] Andries, K., Verhasselt, P., Guillemont, J., Göhlmann, H. W. H., Neefs, J.-M., Winkler, H., Van Gestel, J., Timmerman, P., Zhu, M., Lee, E., Williams, P., de Chaffoy, D., Huitric, E., Hoffner, S., Cambau, E., Truffot-Pernot, C., Lounis, N., and Jarlier, V. (2005) A diarylquinoline drug active on the ATP synthase of Mycobacterium tuberculosis, Science 307, 223-227. DOI: 10.1126/science.1106753. [10] Preiss, L., Langer, J. D., Yildiz, Ö., Eckhardt-Strelau, L., Guillemont, J. E., Koul, A., and Meier, T. (2015) Structure of the mycobacterial ATP synthase


20

Page 21 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fo rotor ring in complex with the anti-TB drug bedaquiline, Sci. Adv. 1, 1–8 DOI: 10.1126/sciadv.1500106. [11] Hards, K., and Cook, G. M. (2018) Targeting bacterial energetics to produce new antimicrobials, Drug. Resist. Updat. 36, 1-12. DOI :10.1016/j.drup.2017.11.001. [12] Diacon, A. H., Donald, P. R., Pym, A., Grobusch, M., Patientia, R. F., Mahanyele, R., Bantubani, N., Narasimooloo, R., De Marez, T., van Heeswijk, R., Lounis, N., Meyvisch, P., Andries, K., and McNeeley, D. F. (2012) Randomized pilot trial of eight weeks of bedaquiline (TMC207) treatment for multidrug-resistant tuberculosis: Long-term outcome, tolerability, and effect on emergence of drug resistance, Antimicrob. Agents Chemother. 56, 3271-3276. DOI: 10.1128/AAC.06126-11. [13] Diacon, A. H., Pym, A., Grobusch, M., Patientia, R., Rustomjee, R., PageShipp, L., Pistorius, C., Krause, R., Bogoshi, M., Churchyard, G., Venter, A., Allen, J., Palomino, J.-C., De Marez, T., van Heeswijk, R. P. G., Lounis, N., Meyvisch, P., Verbeeck, J., Parys, W., de Beule, K., Andries, K., and McNeeley, D. F. (2009) The diarylquinoline TMC207 for multidrug-resistant tuberculosis,. N. Engl. J. Med. 360, 2397-2405. DOI: 10.1056/NEJMoa0808427. [14] Andries, K., Villellas, C., Coeck, N., Thys, K., Gevers, T., Vranckx, L., Lounis, N., de Jong, B. C., and Koul, A. (2014) Acquired resistance of Mycobacterium tuberculosis to bedaquiline, PLoS One 9, e102135. DOI: 10.1371/journal.pone.0102135. [15] Sacksteder, K. A., Protopopova, M., Barry, C. E., 3rd, Andries, K., and Nacy, C. A. (2012) Discovery and development of SQ109: A new antitubercular drug with a novel mechanism of action, Future Microbiol. 7, 823-837 DOI: 10.2217/fmb.12.56. [16] Li, K., Schurig-Briccio, L. A., Feng, X., Upadhyay, A., Pujari, V., Lechartier, B., Fontes, F. L., Yang, H., Rao, G., Zhu, W., Gulati, A., No, J. H., Cintra,


21


Page 22 of 42

G., Bogue, S., Liu, Y., Molohon, K., Orlean, P., Mitchell, D. A., FreitasJunior, L., Ren, F., Sun, H., Jiang, T., Li, Y., Guo, R.-T., Cole, S. T., Gennis, R. B., Crick, D. C., and Oldfield, E. (2014) Multitarget drug discovery for tuberculosis and other infectious diseases, J. Med. Chem. 57, 3126-3139. DOI: 10.1021/jm500131s. [17] Pethe, K., Bifani, P., Jang, J., Kang, S., Park, S., Ahn, S., Jiricek, J., Jung, J., Jeon, H. K., Cechetto, J., Christophe, T., Lee, H., Kempf, M., Jackson, M., Lenaerts, A. J., Pham, H., Jones, V., Seo, M. J., Kim, Y. M., Seo, M., Seo, J. J., Park, D., Ko, Y., Choi, I., Kim, R., Kim, S. Y., Lim, S., Yim, S. A., Nam, J., Kang, H., Kwon, H., Oh, C. T., Cho, Y., Jang, Y., Kim, J., Chua, A., Tan, B. H., Nanjundappa, M. B., Rao, S. P., Barnes, W. S., Wintjens, R., Walker, J. R., Alonso, S., Lee, S., Kim, J., Oh, S., Oh, T., Nehrbass, U., Han, S. J., No, Z., Lee, J., Brodin, P., Cho, S. N., Nam, K., and Kim, J. (2013) Discovery of Q203, a potent clinical candidate for the treatment of tuberculosis, Nat. Med. 19, 1157-1160. DOI: 10.1038/nm.3262. [18] Cook, G. M., Hards, K., Dunn, E., Heikal, A., Nakatani, Y., Greening, C., Crick, D. C., Fontes, F. L., Pethe, K., Hasenoehrl, E., and Berney, M. (2017) Oxidative phosphorylation as a target space for tuberculosis: Success, caution, and future directions, Microbiol. Spectrum 5. DOI: 10.1128/microbiolspec.TBTB2-0014-2016. [19] Cook, G. M., Hards, K., Vilchèze, C., Hartman, T., and Berney, M. (2014) Energetics of respiration and oxidative phosphorylation in Mycobacteria. In Molecular Genetics of Mycobacteria (Hatfull, G. F., Jacobs Jr., W. R., Eds.) 2nd ed., Vol. 2, pp 389–409 ASM Press: Washington, D.C., DOI: 10.1128/microbiolspec.MGM2-0015-2013. [20] Kim, M. S., Jang, J., Ab Rahman, N. B., Pethe, K., Berry, E. A., and Huang, L. S. (2015) Isolation and characterization of a hybrid respiratory supercomplex consisting of Mycobacterium tuberculosis cytochrome bcc and Mycobacterium smegmatis cytochrome aa3, J. Biol. Chem. 290, 14350-14360 DOI :10.1074/jbc.M114.624312.


22

Page 23 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


[21] Megehee, J. A., Hosler, J. P., and Lundrigan, M. D. (2006) Evidence for a cytochrome bcc–aa3 interaction in the respiratory chain of Mycobacterium smegmatis, Microbiology 152, 823-829. DOI: 10.1099/mic.0.28723-0. [22] Cramer, W. A., Hasan, S. S., and Yamashita, E. (2011) The Q cycle of cytochrome bc complexes: A structure perspective, Biochim. Biophys. Acta. 1807, 788-802. DOI: 10.1016/j.bbabio.2011.02.006. [23] Nicholls, D. G., and Ferguson, S. J. (2013) Respiratory chains. In Bioenergetics, 4th ed., pp 91–157. Academic Press: Boston, DOI 10.1016/C2010-0-64902-9. [24] Cook, G. M., Greening, C., Hards, K., and Berney, M. (2014) Energetics of pathogenic bacteria and opportunities for drug development. In Advances in Bacterial Pathogen Biology (Poole, R. K., Ed.), Vol. 65 of Advances in Microbial Physiology, pp 1–62, Elsevier DOI 10.1016/bs.ampbs.2014.08.001. [25] Kalia, N. P., Hasenoehrl, E. J., Ab Rahman, N. B., Koh, V. H., Ang, M. L. T., Sajorda, D. R., Hards, K., Gruber, G., Alonso, S., Cook, G. M., Berney, M., and Pethe, K. (2017) Exploiting the synthetic lethality between terminal respiratory oxidases to kill Mycobacterium tuberculosis and clear host infection, Proc .Natl. Acad. Sci. U.S. A 114, 7426-7431 DOI: 10.1073/pnas.1706139114. [26] Rybniker, J., Vocat, A., Sala, C., Busso, P., Pojer, F., Benjak, A., and Cole, S. T. (2015) Lansoprazole is an antituberculous prodrug targeting cytochrome bc1, Nat. Commun. 6, 7659 DOI: 10.1038/ncomms8659. [27] van der Westhuyzen, R., Winks, S., Wilson, C. R., Boyle, G. A., Gessner, R. K., Soares de Melo, C., Taylor, D., de Kock, C., Njoroge, M., Brunschwig, C., Lawrence, N., Rao, S. P., Sirgel, F., van Helden, P., Seldon, R., Moosa, A., Warner, D. F., Arista, L., Manjunatha, U. H., Smith, P. W., Street, L. J., and Chibale, K. (2015) Pyrrolo[3,4-c]pyridine-1,3(2H)-diones: A novel antimycobacterial class targeting mycobacterial respiration, J. Med. Chem. 58, 9371-9381. DOI: 10.1021/acs.jmedchem.5b01542


23


Page 24 of 42

[28] Moraski, G. C., Seeger, N., Miller, P. A., Oliver, A. G., Boshoff, H. I., Cho, S., Mulugeta, S., Anderson, J. R., Franzblau, S. G., and Miller, M. J. (2016) Arrival of imidazo[2,1-b]thiazole-5-carboxamides: Potent anti-tuberculosis agents that target QcrB, ACS Infect. Dis. 2, 393-398. DOI: 10.1021/acsinfecdis.5b00154. [29] Phummarin, N., Boshoff, H. I., Tsang, P. S., Dalton, J., Wiles, S., Barry Rd, C. E., and Copp, B. R. (2016) SAR and identification of 2-(quinolin-4yloxy)acetamides as Mycobacterium tuberculosis cytochrome bc1 inhibitors, Medchemcomm 7, 2122-2127. DOI: 10.1039/c6md00236f. [30] Chandrasekera, N. S., Berube, B. J., Shetye, G., Chettiar, S., O'Malley, T., Manning, A., Flint, L., Awasthi, D., Ioerger, T. R., Sacchettini, J., Masquelin, T., Hipskind, P. A., Odingo, J., and Parish, T. (2017) Improved phenoxyalkylbenzimidazoles with activity against Mycobacterium tuberculosis appear to target QcrB, ACS Infect. Dis. 3, 898-916. DOI: 10.1021/acsinfecdis.7b00112. [31] Berube, B. J., and Parish, T. (2017) Combinations of respiratory chain inhibitors have enhanced bactericidal activity against Mycobacterium tuberculosis, Antimicrob. Agents Chemother. 62, e01677-01617. DOI: 10.1128/AAC.01677-17. [32] Lu, X., Tang, J., Cui, S., Wan, B., Franzblauc, S. G., Zhang, T., Zhang, X., and Ding, K. (2017) Pyrazolo[1,5-a]pyridine-3-carboxamide hybrids: Design, synthesis and evaluation of anti-tubercular activity, Eur. J. Med. Chem. 125, 41-48. DOI 10.1016/j.ejmech.2016.09.030. [33] Tang, J., Wang, B., Wu, T., Wan, J., Tu, Z., Njire, M., Wan, B., Franzblauc, S. G., Zhang, T., Lu, X., and Ding, K. (2015) Design, synthesis, and biological evaluation of pyrazolo[1,5-a]pyridine-3-carboxamides as novel antitubercular agents, ACS Med. Chem. Lett. 6, 814-818. DOI: 10.1021/acsmedchemlett.5b00176. [34] Ko, Y., and Choi, I. (2016) Putative 3D structure of Qcrb from Mycobacterium tuberculosis cytochrome bc1 complex, a novel drug-target for new series


24

Page 25 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of antituberculosis agent Q203, Bull. Korean Chem. Soc. 37, 725-731. DOI: 10.1002/bkcs.10765. [35] Vilcheze, C., Weisbrod, T. R., Chen, B., Kremer, L., Hazbon, M. H., Wang, F., Alland, D., Sacchettini, J. C., and Jacobs, W. R., Jr. (2005) Altered NADH/NAD+ ratio mediates coresistance to isoniazid and ethionamide in mycobacteria, Antimicrob. Agents Chemother. 49, 708-720. DOI 10.1128/AAC.49.2.708-720.2005. [36] Bhat, S. A., Iqbal, I. K., and Kumar, A. (2016) Imaging the NADH:NAD+ homeostasis for understanding the metabolic response of mycobacterium to physiologically relevant stresses, Front. Cell. Infect. Microbiol. 6, 145. DOI 10.3389/fcimb.2016.00145. [37] Smeulders, M. J., Keer, J., Speight, R. A., and Williams, H. D. (1999) Adaptation of Mycobacterium smegmatis to stationary phase, J. Bacteriol. 181, 270-283. [38] Franzblau, S. G., Witzig, R. S., McLaughlin, J. C., Torres, P., Madico, G., Hernandez, A., Degnan, M. T., Cook, M. B., Quenzer, V. K., Ferguson, R. M., and Gilman, R. H. (1998) Rapid, low-technology MIC determination with clinical Mycobacterium tuberculosis isolates by using the microplate alamar blue assay, J. Clin.l microbiol. 36, 362-366. [39] Hards, K., Robson, J. R., Berney, M., Shaw, L., Bald, D., Koul, A., Andries, K., and Cook, G. M. (2015) Bactericidal mode of action of bedaquiline, J. Antimicrob. Chemother. 70, 2028-2037. DOI: 10.1093/jac/dkv054. [40] Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [41] Berney, M., Greening, C., Hards, K., Collins, D., and Cook, G. M. (2014) Three different [NiFe] hydrogenases confer metabolic flexibility in the obligate aerobe Mycobacterium smegmatis, Environ. Microbiol.16, 318330. DOI: 10.1111/1462-2920.12320.


25


Page 26 of 42

[42] Gebhard, S., Tran, S. L., and Cook, G. M. (2006) The Phn system of Mycobacterium smegmatis: A second high-affinity ABS-transporter for phosphate, Microbiology 152, 3453-3465. DOI 10.1099/mic.0.29201-0. [43] Cook, G. M., Cruz-Ramos, H., Moir, A. J., and Poole, R. K. (2002) A novel haem compound accumulated in Escherichia coli overexpressing the cydDC operon, encoding an ABC-type transporter required for cytochrome assembly, Arch. Microbiol. 178, 358-369. DOI 10.1007/s00203-002-04676. [44] Hards, K., McMillan, D. G. G., Schurig-Briccio, L. A., Gennis, R. B., Lill, H., Bald, D., and Cook, G. M. (2018) Ionophoric effects of the antitubercular drug bedaquiline, Proc. Natl. Acad. Sci. U.S.A. 115, 7326-7331. DOI 10.1073/pnas.1803723115. [45] Aung, H. L., Tun, T., Moradigaravand, D., Koser, C. U., Nyunt, W. W., Aung, S. T., Lwin, T., Thinn, K. K., Crump, J. A., Parkhill, J., Peacock, S. J., Cook, G. M., and Hill, P. C. (2016) Whole-genome sequencing of multidrug-resistant Mycobacterium tuberculosis isolates from myanmar, J. Glob. Antimicrob. Resist. 6, 113-117. DOI 10.1016/j.jgar.2016.04.008. [46] Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., and Sternberg, M. J. (2015) The phyre2 web portal for protein modeling, prediction and analysis, Nat. Protoc. 10, 845-858. DOI 10.1038/nprot.2015.053. [47] Ibrahim, M., Andries, K., Lounis, N., Chauffour, A., Truffot-Pernot, C., Jarlier, V., and Veziris, N. (2007) Synergistic activity of R207910 combined with pyrazinamide against murine tuberculosis, Antimicrob. Agents. Chemother. 51, 1011-1015. DOI 10.1128/AAC.00898-06.


26

Page 27 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure Legends: Figure 1: TB47 is an inhibitor of QcrB. A) Structure of TB47. B) Multiple sequence alignment of the indicated qcrB genes, compared to the M. smegmatis TB47-resistant mutant isolated in this study (H190Y). C) Schematic of the M. smegmatis QcrB Qp-binding site, based on Phyre2-homology modelling. The Qp site cavity is indicated with partial orange shading and black lines. Residues involved in Q203 or TB47 resistance (T308 is equivalent to T313 in M. tuberculosis) are indicated. D) Oxygen consumption rate (OCR) of M. smegmatis resting cell suspensions (energized with 0.2% glycerol final concentration) treated with either (DMSO; Veh), 6.25 M TB47 or 6.25 M Q203 (final concentration). Error bars represent standard deviation from a biological triplicate. Figure 2: Comparison of modelled TB47 binding modes in fast- and slowgrowing mycobacteria. Homology models of the A) M. smegmatis and B) M. tuberculosis QcrB genes were created and TB47 was docked into the Qp-binding site. In panel A) Q203 has also been docked for comparison. Panels A) and B) are viewed from the same angle. Residues predicted to have π-π interactions with TB47/Q203 are indicated in orange and the edge-to-edge distances are indicated. C) Oxygen consumption rate (OCR) of M. bovis BCG wild-type (BCG), M. bovis BCG cyd::hyg mutant and M. bovis BCG cyd::hyg mutant complemented with CydAB+ (complement) resting cell suspensions treated with either (DMSO; C = control) or 6.25 M TB47 (T = treated). Error bars represent standard deviation from a biological triplicate.

Figure 3: Metabolite profiles of M. tuberculosis treated with TB47. M. tuberculosis H37Rv was treated with the indicated concentrations of TB47 for a sub-lethal 24 hour exposure, after which metabolites were extracted and identified by LC/MS. All fold changes are relative to a vehicle control (0 M). A) For each compound, a log2-log10 linear regression was modelled (i.e. log2(Fold Change) versus log10([TB47] (M)) and compared to a null-regression by the F-


27


Page 28 of 42

statistic. A volcano plot is generated using the p-value from this analysis. B) Fold changes for all metabolites identified as responding to TB47 in a dose-dependent manner. C) Fold changes for AMP, ADP and ATP. D) Fold changes for selected metabolites in the TCA cycle or TCA-connected processes. E) Fold changes for selected amino acids. E) Fold changes for the pentose-phosphate pathway associated purines adenine and adenosine. Figure 4: TB47 treatment of BALB/c mice with chronic Erdman M. tuberculosis infection. The M. tuberculosis CFU of both A) lungs and B) spleens were determined after 4 or 8 weeks of treatment with the indicated daily doses (mg/kg) of TB47, Q203 and isoniazid (INH). The number of replicates is indicated above each bar. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (Two way ANOVA, Dunnett’s multiple comparisons test, 95% CI, all compared to vehicle for the indicated time-point). Error bars represent standard error of the mean from the indicated replicates. Figure 5: TB47 treatment of BALB/c mice with acute M. tuberculosis H37Rv infection. Mice were infected with H37Rv by aerosol. A) After 24 hours, a Day 0 measurement was performed and after 4 weeks of treatment all other measurements were performed. Carboxymethyl cellulose was the vehicle control. B) Mice were treated with the indicated daily doses of TB47. C) Mice were treated with the indicated daily doses of INH, PZA and RIF alone (control) or with 25 mg/kg TB47 (+ TB47). Error bars represent standard deviation from 5 replicate mice. The mortality rate in the vehicle was 80% by 4 weeks. No mice died under any other treatment conditions.


28

Page 29 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Minimum inhibitory concentrations of TB47 against M. tuberculosis clinical isolatesa Typeb

DS

MDR

Strain Number

FJ05349 FJ05060 XZ09033 XZ09109 XZ09119 XJ06007 XJ06014 XJ06017 XJ06029 XJ06055 XJ06090 FJ05474 XZ09033 XZ09109 XZ09119 XJ06007 XJ06014 FJ05120 FJ05189 XZ09006 XZ09011 XZ09017 XZ09021 ZG2016006 XZ09061 XZ09095 XZ09102 XZ06217 FJ05112 FJ05120 FJ05132 FJ05136 FJ05141 FJ05195 FJ07009 FJ07028 HeN05028 HeN05034 HeN05041 GZ10066

MIC (µg/mL)

INH

0.016 0.031 0.016 0.016 0.016 0.016 0.063 0.016 0.016 0.016 0.016 0.016 0.125 0.125 0.125 0.125 0.250 0.063 0.031 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.500 0.016 0.016 0.016

S S S S S S S S S S S S S S S S S R R R R R R R R R R R R R R R R R R R R R R R

Susceptibility Background of Strain RIF EMB STR CPM KAN OFX

S S S S S S S S S S S S S S S S S R R R R R R R R R R R R R R R R R R R R R R R

S S

S S

S S

S S

S S

S S

S S

S S

S S

S S


29


XDR

a

GZ10069 ZG2016012 ZG2016013 ZG2016014 ZG2016015 ZG2016016 ZG2016001 ZG2016002 ZG2016003 XZ09006 XZ09011 XZ09017 XZ09021 ZG2016006 XZ06008 FJ05195

0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.125 0.125 0.250 0.125 0.250 0.031 0.063

R R R R R R R R R R R R R R R R

R R R R R R R R R R R R R R R R

S R

Page 30 of 42

S R

S S

R R

R R

Growth medium was Middlebrook 7H12 medium (7H9 broth containing 0.1%

w/v casitone, 5.6 g/mL palmitic acid, 5 mg/mL bovine serum albumin, 4 mg/mL catalase) b DS

= Drug susceptible, MDR = Multi-drug resistant, XDR = Extensively-drug

resistant.


30

D T308 Qp site cavity

H190

Qp site

164 193 193 198 198 186

H190

250 200 150 100 50 0

mc2155

cyd

Q203

C

TB47

CH3

Veh

N N

*: * :::: :: : *:***: :::: SFWGATV-ITNLLSAIPYIGTDL VQWI SGTGLRAALSGITMGIPVIGTWM HWAL SGTGIRAALSGITMGIPVIGTWM YWAL SGLGLRAALSSITLGMPVIGTWL HWAL SGLGLRAALSSITLGMPVIGTWL HWAL SGVGLRI-MSAIIVGLPIIGTWM HWLI

Q203

H3CO

139 167 167 172 172 161

TB47

N

Human M. smeg qcrB M. smeg qcrB H190Y M. tb H37Rv qcrB M. bovis qcrB C. glutamicum qcrB

Veh

H N

B

Q203

O

OCF3

TB47

A

Veh

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


OCR (nmol O2 min-1 (mg protein)-1)

Page 31 of 42

cyd + H190Y

Figure 1: TB47 is an inhibitor of QcrB. A) Structure of TB47. B) Multiple sequence alignment of the indicated qcrB genes, compared to the M. smegmatis TB47-resistant mutant isolated in this study (H190Y). C) Schematic of the M. smegmatis QcrB Qp-binding site, based on Phyre2-homology modelling. The Qp site cavity is indicated with partial orange shading and black lines. Residues involved in Q203 or TB47 resistance (T308 is equivalent to T313 in M. tuberculosis) are indicated. D) Oxygen consumption rate (OCR) of M. smegmatis resting cell suspensions (energized with 0.2% glycerol final concentration) treated with either (DMSO; Veh), 6.25 M TB47 or 6.25 M Q203 (final concentration). Error bars represent standard deviation from a biological triplicate.


31


A H190

T308

Y321

3.8Å

Q203 TB47 3.8Å

F156

B E314

H195

TB47

3.1Å 3.5Å

Y161

T313 3.3Å

F158

C OCR relative to untreated (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 42

250 200 150 100 50 0

C

T BCG

C

T

cyd::hyg

C

T

Complement

Figure 2: Comparison of modelled TB47 binding modes in fast- and slowgrowing mycobacteria. Homology models of the A) M. smegmatis and B) M. tuberculosis QcrB genes were created and TB47 was docked into the Qp-binding site. In panel A) Q203 has also been docked for comparison. Panels A) and B) are viewed from the same angle. Residues predicted to have π-π interactions with TB47/Q203 are indicated in orange and the edge-to-edge distances are indicated. C) Oxygen consumption rate (OCR) of M. bovis BCG wild-type (BCG), M. bovis BCG cyd::hyg mutant and M. bovis BCG cyd::hyg mutant complemented with CydAB+ (complement) resting cell suspensions treated with either (DMSO; C = control) or 6.25 M TB47 (T = treated). Error bars represent standard deviation from a biological triplicate.


32

Page 33 of 42 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3: Metabolite profiles of M. tuberculosis treated with TB47. M. tuberculosis H37Rv was treated with the indicated concentrations of TB47 for a sub-lethal 24 hour exposure, after which metabolites were extracted and identified by LC/MS. All fold changes are relative to a vehicle control (0 M). A) For each compound, a log2-log10 linear regression was modelled (i.e. log2(Fold Change) versus log10([TB47] (M)) and compared to a null-regression by the Fstatistic. A volcano plot is generated using the p-value from this analysis. B) Fold changes for all metabolites identified as responding to TB47 in a dose-dependent manner. C) Fold changes for AMP, ADP and ATP. D) Fold changes for selected metabolites in the TCA cycle or TCA-connected processes. E) Fold changes for selected amino acids. E) Fold changes for the pentose-phosphate pathway associated purines adenine and adenosine.


33


A 7

4 wk p.i. 8 wk p.i.

6

6

5

5

5

7

7

***

5 6

* 6

**

5

4

****

4

5

****

Q203

INH 25

TB47

50

20

50

2

20

3 Vehicle

log10 Lung CFU

5

B 6

5

6 5

5

7

4 wk p.i. 8 wk p.i.

5

5

***

7

****

*

6

****

5

**

7

****

4 3

3

**** 1

2 50

Q203

INH 25

TB47

20

50

20

1

****

Vehicle

log10 Spleen CFU

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 42

Figure 4: TB47 treatment of BALB/c mice with chronic Erdman M. tuberculosis infection. The M. tuberculosis CFU of both A) lungs and B) spleens were determined after 4 or 8 weeks of treatment with the indicated daily doses (mg/kg) of TB47, Q203 and isoniazid (INH). The number of replicates is indicated above each bar. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 (Two way ANOVA, Dunnett’s multiple comparisons test, 95% CI, all compared to vehicle for the indicated time-point). Error bars represent standard error of the mean from the indicated replicates.


34

Page 35 of 42

B

C

+ TB47

Control

+ TB47

3.1 6.3 12.5 25 50 100 200

Vehicle

Day 0

TB47 (mg/kg)

Control

INH 25 mg/kg PZA 150 mg/kg RIF 10 mg/kg

+ TB47

10 9 8 7 6 5 4 3 2 1

Control

A

log10 Lung CFU

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5: TB47 treatment of BALB/c mice with acute M. tuberculosis H37Rv infection. Mice were infected with H37Rv by aerosol. A) After 24 hours, a Day 0 measurement was performed and after 4 weeks of treatment all other measurements were performed. Carboxymethyl cellulose was the vehicle control. B) Mice were treated with the indicated daily doses of TB47. C) Mice were treated with the indicated daily doses of INH, PZA and RIF alone (control) or with 25 mg/kg TB47 (+ TB47). Error bars represent standard deviation from 5 replicate mice. The mortality rate in the vehicle was 80% by 4 weeks. No mice died under any other treatment conditions.


35


Page 36 of 42

For Table of Contents Use Only


36

B Diseases ACS Infectious

100 50


mc2155

cyd

Q203

0 TB47

H190

150

Veh

Qp site cavity

164 193 193 198 198 186

200

Q203

T308

H190

250

TB47

D

Qp site

Veh

CH3

*: * :::: :: : *:***: :::: SFWGATV-ITNLLSAIPYIGTDLVQWI SGTGLRAALSGITMGIPVIGTWMHWAL SGTGIRAALSGITMGIPVIGTWMYWAL SGLGLRAALSSITLGMPVIGTWLHWAL SGLGLRAALSSITLGMPVIGTWLHWAL SGVGLRI-MSAIIVGLPIIGTWMHWLI

Q203

N N

N

139 167 167 172 172 161

TB47

1 H CO 2 3 3 4 5 6 C 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

H N

Human M. smeg qcrB M. smeg qcrB H190Y M. tb H37Rv qcrB M. bovis qcrB C. glutamicum qcrB

Veh

O

OCF3

OCR (nmol O2 min-1 (mg protein)-1)

A Page 37 of 42

cyd + H190Y

A


OCR relative to untreated (%)

1 2 3 4 5 6 7 8 9 10 11 B12 13 14 15 16 17 18 19 20 21 22 23 24 25 C26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Page 38 of 42 H190

T308

Y321

3.8Å

Q203 TB47 3.8Å

F156

E314

H195

TB47

3.1Å 3.5Å

Y161

T313 3.3Å

F158

250 200 150 100 50 0 ACS Paragon Plus Environment C T C T C BCG

cyd::hyg

T

Complement

1.0

PGA Aspartate

p = 0.05 p = 0.10 Succinate

0.5 0.0

−1

0

1

2

1.00

Citrate

0.75

GABA

0.50 0.25 0.00

100

0.6 0.4 0.2 0.0

AMP

−0.2

ADP

0.01

E

0.1

1

10

100

0.1

1

10

100

1

10

100

[TB47] (μM)

Arginine

1.25

Aspartate

1.00

Serine

0.75 0.50 0.25 0.00 0

[TB47] (μM)

−0.4

Fumarate

0

log2(Fold change)

Phospho−gluconate Aspartate GABA Aminoacrylate Succinate 2 Lactaldehyde Galactonate 1 GDP−fucose 0 Arginine d−Ala−d−Ala −1 Citrate Serine −2 Acetylornithine Galactinol Fumarate Adenosine Oxoisovalerate

0 0.01 0.1 1 10

log2(Fold change)

log2(Fold change)

C

Succinate

1.25

-0.25

log2(Fold Change)

B

log2(Fold change)

1.5

D


F log2(Fold change)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52

−log10(p−value)

A Page 39 of 42 2.0

2.0 1.5

0.01

[TB47] (μM)

Adenine Adenosine Phosphogluconate

1.0 0.5 0.0

ATP

0.01

0.1

1

Paragon Plus Environment 10 ACS 100 0

[TB47] (μM)

0.01

0.1

[TB47] (μM)

A


Page 40 of 42

7

4 wk p.i. 8 wk p.i.

5

6

6

5

5

5

7

7

***

5 6

* 6

**

5

4

****

4

5

****

6

5

5

7

4 wk p.i. 8 wk p.i.

5

5

***

50

Q203

7

****

*

6

****

5

**

INH 25

TB47

6

5

20

50

20

2

Vehicle

3

7

****

4 3

3

**** 1

2


TB47

Q203

INH 25

50

20

50

20

1

****

Vehicle

log10 Spleen CFU

log10 Lung CFU

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 B 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33

C


TB47 (mg/kg)

+ TB47


Control

Control

3.1 6.3 12.5 25 50 100 200

Vehicle

Day 0

1 2 3 4 5 6 7 8 9 10 11 12 13

+ TB47

INH 25 mg/kg PZA 150 mg/kg RIF 10 mg/kg

Control

B

log10 Lung CFU

10 9 8 7 6 5 4 3 2 1

+ TB47

APage 41 of 42


For Table of Contents Use Only


Page 42 of 42

Pyrazolo[1,5-a]pyridine Inhibitor of the Respiratory Cytochrome bcc

Recommend Documents