Langmuir 2007, 23, 12535-12540
12535
Quantitative Determination of Cellulose Accessibility to Cellulase Based on Adsorption of a Nonhydrolytic Fusion Protein Containing CBM and GFP with Its Applications Jiong Hong, Xinhao Ye, and Y.-H. Percival Zhang* Biological Systems Engineering Department, Virginia Tech, Blacksburg, Virginia 24061 ReceiVed August 20, 2007. In Final Form: September 18, 2007 Heterogeneous cellulose accessibility is an important substrate characteristic, but all methods for determining cellulose accessibility to the large-size cellulase molecule have some limitations. Characterization of cellulose accessibility to cellulase (CAC) is vital for better understanding of the enzymatic cellulose hydrolysis mechanism (Zhang and Lynd, Biotechnol. Bioeng. 2004, 88, 797-824; 2006, 94, 888-898). Quantitative determination of cellulose accessibility to cellulase (m2/g of cellulose) was established based on the Langmuir adsorption of the fusion protein containing a cellulose-binding module (CBM) and a green fluorescent protein (GFP). One molecule of the recombinant fusion protein occupied 21.2 cellobiose lattices on the 110 face of bacterial cellulose nanofibers. The CAC values of several cellulosic materialssregenerated amorphous cellulose (RAC), bacterial microcrystalline cellulose (BMCC), Whatman No. 1 filter paper, fibrous cellulose powder (CF1), and microcrystalline cellulose (Avicel)swere 41.9, 33.5, 9.76, 4.53, and 2.38 m2/g, respectively. The CAC value of amorphous cellulose made from Avicel was 17.6-fold larger than that of crystalline cellulosesAvicel. Avicel enzymatic hydrolysis proceeded with a transition from substrate excess to substrate limited. The declining hydrolysis rates over conversion are mainly attributed to a combination of substrate consumption and a decrease in substrate reactivity. Declining heterogeneous cellulose reactivity is significantly attributed to a loss of CAC where the easily hydrolyzed cellulose fraction is digested first.
Introduction Lignocellulose, a major component of the plant cell wall, is produced via photosynthesis. Photosynthesis fixes atmospheric CO2 to produce living carbon compounds (mainly, lignocellulose); biodegradation of lignocellulose sends gaseous CO2 and methane back to the atmosphere. Cellulose, the primary component of lignocellulose, is the most abundant polymeric carbohydrate that human beings do not fully utilize.1,2 Sustainable production of transportation biofuels (e.g., cellulosic ethanol and hydrogen) from cellulosic materials would provide benefits to the environment, the economy, and national security.1,3,4 Efficient biological conversion of lignocellulosic biomass to biofuels and biobased chemicals involves three sequential steps: lignocellulose pretreatment, enzymatic cellulose hydrolysis, and fermentation, where enzymatic cellulose hydrolysis plays a central role in producing soluble fermentable sugars from the pretreated solid cellulosic feedstock.5 Enzymatic hydrolysis of crystalline cellulose, a complicated biological process, requires that three types of enzymessendoglucanases, exo-glucanases, and β-glucosidasesswork together.2,5 Cellulose (substrate) characteristics that influence enzymatic hydrolysis rates are believed to include substrate accessibility, crystallinity, degree of polymerization (DP), particle size, pore volume, etc.2,6 * To whom correspondence should be addressed. E-mail:
[email protected]. Tel.: 540-231-7414. Fax: 540-231-3199. (1) Demain, A. L.; Newcomb, M.; Wu, J. H. D. Microbiol. Mol. Biol. ReV. 2005, 69, 124-154. (2) Zhang, Y.-H. P.; Lynd, L. R. Biotechnol. Bioeng. 2004, 88, 797-824. (3) Lynd, L. R.; Weimer, P. J.; van Zyl, W. H.; Pretorius, I. S. Microbiol. Mol. Biol. ReV. 2002, 66, 506-577. (4) Zhang, Y.-H. P.; Evans, B. R.; Mielenz, J. R.; Hopkins, R. C.; Adams, M. W. W. PLOS ONE 2007, 2, e456. (5) Zhang, Y.-H. P.; Himmel, M.; Mielenz, J. R. Biotechnol. AdV. 2006, 24, 452-481. (6) Mansfield, S. D.; Mooney, C.; Saddler, J. N. Biotechnol. Prog. 1999, 15, 804-816.
None of the methods for measuring cellulose accessibilitys nitrogen adsorption-based Brunauer-Emmett-Teller (BET), size exclusion chromatography, small-angle X-ray scattering (SAXS), microscopysare perfectly applied in the enzymatic cellulose hydrolysis process because (1) enzymatic cellulose hydrolysis occurs on the surface of hydrated solid matter in the aqueous phase (i.e., dried cellulosic samples have completely different supramolecular structures from hydrated samples);2,7 (2) cellulases are large-size molecules; and (3) cellulase is preferentially adsorbed on the 110 face of cellulose fibers that cellulase can hydrolyze.8-11 Small-size molecule adsorption methods, such as BET, water vapor sorption, alkali swelling, or the exchange of H to D atoms with D2H, could result in an overestimation of cellulose accessibility to cellulase (CAC). Cellulase-size exclusion chromatography can neither differentiate the effective cellulose surface for adsorption and hydrolysis nor account for the external surface.12 Quantitative determination of CAC is valuable for investigating complicated enzymatic cellulose hydrolysis mechanisms. Maximum cellulase adsorption capacity has been proposed to represent CAC2 and the data in the literature have been summarized and used before.2,13 However, it is relatively difficult to obtain reliable and accurate data based on adsorption of active cellulases on cellulose because cellulase could hydrolyze substrate during the adsorption measurement, especially for easily hydrolyzed cellulose,14 resulting in rapid changes in substrate characteristics.15,16 Therefore, many adsorption studies have been conducted at a (7) Fan, L. T.; Lee, Y.-H.; Beardmore, D. R. Biotechnol. Bioeng. 1981, 23, 419-424. (8) Gilkes, N. R.; Jervis, E.; Henrissat, B.; Tekant, B.; Miller, R. C., Jr.; Warren, R. A.; Kilburn, D. G. J. Biol. Chem. 1992, 267, 6743-6749. (9) Lehtio, J.; Sugiyama, J.; Gustavsson, M.; Fransson, L.; Linder, M.; Teeri, T. T. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 484-489. (10) Chanzy, H.; Henrissat, B.; Vuong, R. FEBS Lett. 1984, 172, 193-196. (11) Gilkes, N. R.; Kilburn, D. G.; Miller, R. C., Jr.; Warren, R. A.; Sugiyama, J.; Chanzy, H.; Henrissat, B. Int. J. Biol. Macromol. 1993, 15, 347-351. (12) Grethlein, H. E. Bio-Technology 1985, 3, 155-160. (13) Zhang, Y.-H. P.; Lynd, L. R. Biotechnol. Bioeng. 2006, 94, 888-898.
10.1021/la7025686 CCC: $37.00 © 2007 American Chemical Society Published on Web 11/08/2007
12536 Langmuir, Vol. 23, No. 25, 2007
decreased temperature (e.g., 4 °C) to minimize hydrolysis effects.14,17-21 But active cellulase adsorption at low temperatures could be significantly different from that at hydrolysis temperatures.17,19,22 A new method has been developed for measuring the scouring efficiencies of natural fibers based on adsorption of a fusion protein containing CBM and β-glucuronidase, but it was not used to provide quantitative data for the surface area of cellulose.23 Cellulose reactivity hydrolyzed by cellulase is an intrinsic property of the solid substrate, associated with several substrate characteristics, such as CAC and DP, but it is independent of enzyme denaturation and production inhibition. The mechanistic mathematical model13 with two substrate propertiessDP and CACtotalshas been used to elucidate a number of disparate phenomena in the literature, such as the effects of substrate characteristics and experimental conditions on the degree of endo-/ exo-glucanase synergy, but it is still unclear whether other substrate characteristics could greatly influence substrate reactivity. In this study, we developed a new quantitative determination for CAC based on the adsorption of a nonhydrolytic fusion protein containing thioredoxin, green fluorescent protein (GFP), and cellulose-binding module (CBM) at a hydrolysis temperature (50 °C). With application to Avicel hydrolysis, we investigated the effects of CAC changes on hydrolysis rate and substrate reactivity. Materials and Methods Chemicals and Strains. All chemicals were reagent grade, purchased from Sigma (St. Louis, MO) and Fisher Sci. (Pittsburgh, PA), unless otherwise noted. Microcrystalline cellulosesAvicel PH105 (20 µm) swas obtained from FMC Corp. (Philadephia, PA). Cellulase, Spezyme CP, was gifted from Genencor (Palo Alto, CA). Escherichia coli TOP10 (F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80Z∆M15, ∆lacX74, recA1, araD139 ∆(ara-leu)7697 galU galK rpsL(StrR) endA1 nupG) from Invitrogen (Carlsbad, CA) was used as a host cell for all DNA manipulations. The Invitrogen E. coli BL21 Star (DE3) [F- ompT hsdSB (rB-mB-) gal dcm rne131 (DE3)] was used for recombinant protein expression. LB medium was used for all E. coli growth with ampicillin added when necessary. Gluconacetobacter hansenii (ATCC 23769) was used to produce bacterial cellulose (BC). Genomic DNA of Clostridium thermocellum was gifted by Dr. Mielenz at ORNL. The recombinant TGC protein was produced by E. coli BL21 (pNT02). Construction of Plasmids. The fusion protein expression plasmid (pNT02) containing thioredoxin-GFP-CBM (TGC) was constructed as shown in Figure 1A. First, the green fluorescence protein (gfp) gene from pREST/EmGFP (Invitrogen) was amplified by PCR using a pair of primers (GFP-f, CACCATGGTGAGCAAGGGCGAGGAGCTG, and GFP-r, GGATCCACGCGGAACCAGTGCCTTGTACAGCTCGTCCATGCCGAG), and a DNA fragment was ligated (14) Steiner, W.; Sattler, W.; Esterbauer, H. Biotechnol. Bioeng. 1988, 32, 853-865. (15) Tanaka, M.; Nakamura, H.; Taniguchi, M.; Morita, T.; Matsuno, R.; Kamikubo, T. Appl. Microbiol. Biotechnol. 1986, 23, 263-268. (16) Fan, L. T.; Lee, Y.-H.; Beardmore, D. H. Biotechnol. Bioeng. 1980, 22, 177-199. (17) Ooshima, H.; Sakata, M.; Harano, Y. Biotechnol. Bioeng. 1983, 25, 31033114. (18) Ryu, D. D. Y.; Kim, C.; Mandels, M. Biotechnol. Bioeng. 1984, 26, 488-496. (19) Kyriacou, A.; Neufeld, R. J.; MacKenzie, C. R. Biotechnol. Bioeng. 1989, 33, 631-637. (20) Reinikainen, T.; Teleman, O.; Teeri, T. T. Proteins: Struct. Funct. Genet. 1995, 22, 392-403. (21) Medve, J.; Stahlberg, J.; Tjerneld, F. Appl. Biochem. Biotechnol. 1997, 66, 39-56. (22) Kyriacou, A.; Neufeld, R. J.; MacKenzie, C. R. Enzyme Microb. Technol. 1988, 10, 675-681. (23) Degani, O.; Gepstein, S.; Dosoretz, C. G. J. Biotechnol. 2004, 107, 265273.
Hong et al.
Figure 1. Maps of (A) the plasmid pNT02 producing a fusion protein TGC containing His-patch Thioredoxin, green fluorescence protein, and CBM; and (B) the fusion TGC protein, where the peptidespecific protease (thrombin) cleavage site was located in the linker between GFP and CBM. into the Invitrogen pET102/D-TOPO vector. In the GFP-r primer, a protease (thrombin) cleavage site was added (Figure 1B). This plasmid containing the gfp gene was designated as pNT01. Second, the Clostridium thermocellum cellulose-binding module DNA sequence in the cipA gene was amplified by PCR using a pair of primers (CBM3-fc, GATGACGAGCTCCCGGTATCAGGCAATTTGAAGGTTG, and CBM3-rc, TCATATACCGGTTCAGCCACCGGGTTCTTTACCCCATACAAG). After double digestion of Sac I and Age I, the CBM fragment was inserted into pNT01 for constructing a new plasmid pNT02. The DNA sequences of the plasmids were validated by the Virginia Bioinformatics Institute. Preparation of Recombinant Proteins. The E. coli BL21 Star (pNT02) was grown in a 1 L flask containing 200 mL Luria-Bertani medium at 37 °C. The inducer isopropyl-β-D-thiogalactopyranoside (IPTG) (0.2 mM) was added until the OD reached 0.5-0.6. After IPTG addition, the culture temperature was decreased to room temperature and the recombinant TGC protein was expressed overnight. The cell pellets after centrifugation were suspended in 5 mL of 50 mM Tris buffer (pH 8.0) and then lysed by the Fisher Scientific Sonic Dismembrator (Model 500) at a 60% maximum strength for 90 s. The cell lysate was centrifuged at 14000g for 20 min. The supernatant containing TGC was precipitated by adding solid ammonia sulfate at 50% saturated (NH4)2SO4. The precipitated TGC protein was dissolved in 1× native buffer of the Invitrogen ProBond protein purification system. The TGC protein with a His tag was purified using the Ni-NTA column. To obtain the truncated proteins TG and CBM, the purified TGC was hydrolyzed by thrombin at a ratio of 10 units/mg of TGC at room temperature overnight. The hydrolyzed solution was loaded to a Ni-NTA column. The eluate contained the truncated CBM; the bound protein of TG on the resin was eluted by 20 mM imidazole. The TGC, TG, and CBM protein solutions were dialyzed in a 50 mM sodium citric buffer (pH 6.0). Preparation of Cellulose. Regenerated amorphous cellulose (RAC), high-reactivity nonsubstitution homologous cellulose, was prepared from Avicel PH105 through cellulose slurry dissolution by concentrated phosphoric acid, as described previously.24 Bacterial cellulose (BC) was isolated from G. hansenii cultures growing on 0.5% peptone, 0.5% yeast extract, and 2% d-glucose. The bacterial microcrystalline cellulose (BMCC) was prepared from BC by sequential treatment of NaOH and HCl.8 Adsorption and CAC Calculation. Protein adsorption on cellulose was conducted in 200 µL of 2 mg/mL cellulose suspension (24) Zhang, Y. H.; Cui, J.; Lynd, L. R.; Kuang, L. R. Biomacromolecules 2006, 7, 644-648.
Determining Cellulose Accessibility to Cellulase
Langmuir, Vol. 23, No. 25, 2007 12537
solution in a 50 mM sodium citrate buffer (pH 6.0) at 50 °C. After adsorption equilibrium (>30 min) followed by centrifugation, the free protein molar concentrations of TGC and TG were measured based on fluorescence readings by the BioTek multidetection microplate reader, and the free CBM molar concentrations were measured by the UV spectrophotometer with an extinction coefficient of 35410 M-1 cm-1 at 280 nm. The mass concentrations of TGC were calibrated using the Bradford method with bovine serum albumin as the protein standard.25 For BMCC adsorption, 2 mg/mL BMCC was mixed with the protein concentrations up to 19 µmol TGC/mL, 13 µmol TG/mL, and 24 µmol CBM/mL. Protein adsorption on the solid surface can be described by the Langmuir equation Ea )
WmaxKpEf 1 + KpEf
(1)
in which Ea is adsorbed cellulase (µmol of cellulase/L or mg/L), Wmax is the maximum cellulase adsorption per liter (µmol or mg of cellulase/L), and Ef is free cellulase (µmol or mg of cellulase/L). The Wmax and Kp values in eq 1 can be calculated by a number of mathematical methods or software.26 Cellulose accessibility to cellulase (CAC, m2/g of cellulose) has been defined previously,2,13 CAC ) RAmaxNAAG2
(2)
where R is the number of cellobiose lattices occupied by cellulase, Amax is the maximum cellulase adsorption capacity (mol of cellulase/g of cellulose), Amax ) Wmax/(106 × S), S is the cellulose concentration (g of cellulose/L), NA is Avogadro’s constant (6.023 × 1023 molecules/ mol), and AG2 is the area of the cellobiose lattice in the 110 face (0.53 × 1.04 nm ) 5.512 × 10-19 m2).2 Total cellulose accessibility to cellulase in terms of m2/L is calculated as CACTotal ) CAC × S
(3)
On the other hand, the fraction of β-glucosidic bonds accessible to cellulase relative to the total number of glucosidic bonds (Fa, unitless) is defined elsewhere,2,13 Fa ) 2RAmaxMWanhydroglucose
(4)
where MWanhydroglucose ) 162 g/mol of anhydroglucose. Enzymatic Hydrolysis of Avicel and Relevant Assays. Enzymatic cellulose hydrolysis was conducted in a 1 L flask containing 400 mL of 10 g of Avicel/L in a 50 mM citrate buffer (pH. 4.8) with rotary shaking at 180 rpm and 50 °C. The enzyme loadings were 15 FPU cellulase/g of Avicel and 30 IU cellobiase/g of Avicel. The hydrolysate samples were withdrawn and stopped by mixing with 10 M NaOH at a ratio of 20 µL of alkali per mL of Avicel hydrolysate.27 After centrifugation, the soluble sugars in the supernatant were measured by the phenol-sulfuric acid method.5 The relationship between soluble sugars (g/L) vs hydrolysis time (h) was fitted by CurveExpert (Version 1.38). Hydrolysis rates at various times were calculated at the time t + 10 min minus sugar produced at the time t. After careful removal of the adsorbed cellulase on the surface of cellulose (see the description below), characteristics of the remaining cellulosic pelletsssubstrate reactivity, DP, and CACs were measured. The alkalinized solid cellulose pellets were suspended by 1.1% SDS solution and incubated at 80 °C for 15 min to further remove the adsorbed cellulase on the surface of cellulose. After centrifugation, the solid samples were suspended and washed by 75% (v/v) ethanol three times and distilled water twice. The complete removal of adsorbed cellulase from the surface of cellulose was confirmed by the Lowry Assay.28 The residual cellulose was (25) Bradford, M. M. Anal. Biochem. 1976, 72, 248-254. (26) Bothwell, M.; Walker, L. P. Biores. Technol. 1995, 53, 21-29. (27) Zhang, Y.-H. P.; Lynd, L. R. Biomacromolecules 2005, 6, 1510-1515. (28) Lowry, O.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J. J. Biol. Chem. 1951, 193, 265-275.
Figure 2. Photos of the TGC solution (A), a mixture of TGC and BMCC after adsorption followed by precipitation (B), and the bacterial microcrystalline cellulose suspension solution (C) under UV excitation. suspended to produce 10 g/L concentration by water or the adsorption buffer or the hydrolysis buffer. The concentration of reducing sugar ends in solid cellulose was determined by the modified BCA method, as described previously.27 The concentration of total glucose equivalent in solid cellulose was measured by the phenol-sulfuric acid method.27 Degree of Polymerization (DP) Determination. The numberaverage DP of cellulose was calculated by the ratio of glucosyl monomer concentration (determined by the phenol-sulfuric acid method) divided by the reducing-end concentration (determined by the modified BCA method).27 Substrate Reactivity Assay. Substrate reactivity was determined at the conditions (10 g of cellulose/L in citrate buffer (pH 4.8), enzyme loadings of 15 FPU cellulase/g of cellulose and 30 IU cellobiase/g of cellulose) at a temperature of 50 °C. Initial hydrolysis rates (within 10 min) based on the released total soluble sugars (glucose equivalent) were used to represent substrate reactivity. Electrophoresis. SDS-PAGE was carried out in 12% Tris-HCl Gel.
Results Protein Purification and Adsorption. Surface area is an important characteristic for heterogeneous materials. The existing surface area measurement means for cellulose are not suitable for quantitative determination of cellulose accessibility to cellulase, a large-size molecule that preferentially adsorbs on the 110 face of cellulose. Here we proposed to produce a recombinant nonhydrolytic protein containing GFP and CBM. The recombinant protein expression plasmid (pNT02) was constructed based on the T7 promoter-based vector for producing the fusion protein containing thioredoxin, GFP, and CBM, called TGC (in Figure 1B). The TGC protein has a molecular weight of 62 kD, which is similar to that of Trichoderma reesei endo-glucanase I.2 Large amounts of the recombinant protein were produced by the E. coli BL21 Star strain after IPTG was added. The harvested cells were lysed by sonification, and then soluble TGC protein was purified through its His tag by Ni-NTA resin. GFP is a convenient powerful tool for in vivo and in vitro applications. The GFP-containing TGC protein shows a strong green color and a very strong fluorescence under UV excitation (Figure 2A). No fluorescence was observed from BMCC (Figure 2C). When TGC was mixed with BMCC, TGC was adsorbed on the surface of cellulose through CBM. After centrifugation, the BMCC with the adsorbed TGC shows a strong fluorescence (Figure 2B), suggesting that TGC can specifically bind on cellulose. The TGC protein with its strong fluorescence signal is convenient for high-sensitivity measurement. The CBM binding on the surface of cellulose was highly specific; no such binding was observed on the control substratesstarch (data not shown).
12538 Langmuir, Vol. 23, No. 25, 2007
Hong et al. Table 1. Determination of the r Values for TGC, CBM, and TG Based on Adsorption on the Standard SubstratesBMCCa Amax protein
mg/g
µmol/g
R
TGC CBM TG
295 ( 13 121 ( 12 0
4.76 ( 0.21 6.94 ( 0.69 0
21.2 ( 1.0 14.6 ( 1.4
a Adsorption was conducted at 2 mg of BMCC/mL in a 50 mM citrate buffer with different protein concentrations at 50 °C.
Figure 3. Adsorption of purified TGC, TG, and CBM proteins on 2 mg/mL bacterial microcrystalline cellulose at 50 °C. The dot curves were drawn by Langmuir equations based on the parameter setting in Table 1.
Figure 5. Profile of substrate reactivity, CAC, and DP as a function of substrate conversion.
Figure 4. Profile of Avicel (10 g/L) enzymatic hydrolysis at an enzyme loading of 15 FPU + 30 IU β-glucosidase per gram of cellulose in a 50 mM sodium citrate buffer (pH 4.8) at 50 °C. (A) Changes of cellulose conversion, reducing ends, and CAC of solid residual cellulose. (B) Changes in hydrolysis rate, enzyme denaturation, and cellulase/(AmaxS), i.e., E/S.
Determination of Cellulose Accessibility to Cellulase. The fusion TGC protein can be cleaved to two truncated proteinss TG protein and CBMsby treatment with a peptide-specific proteasesthrombin. The SDS-PAGE results show that the purified TGC and two truncated proteins have molecular weights of 62, 45, and 17 kD, respectively, which are consistent with their amino acid sequences (data not shown). The adsorption curves of three proteins on BMCC are presented in Figure 3. TGC and CBM were adsorbed on cellulose, while TG did not adsorb on BMCC because it had no cellulose-binding module. The adsorption data of TGC and CBM matched well with the Langmuir equations (Figure 3). The maximum protein adsorption capacities (Amax) were 295 ( 13 mg of TGC/g of BMCC and 4.75 ( 0.21 µmol of TGC/g of BMCC, as well as 121 ( 12 mg of CBM/g of BMCC and 6.94 ( 0.69 µmol of CBM/g of BMCC, respectively (Table 1).
Cellulose-binding module or cellulase, much larger than the cellobiose lattice, occupies a number of cellobiose lattices. The nanoribbons of BMCC have a cross section with a dimension of 40 × 15 nm. The edges of ribbons (15 nm) are the 110 face where cellulases adsorb and hydrolyze.2,8,9 According to BMCC’s geometric shape and its specific density of crystalline cellulose (1.5 g/cm3),2 the area of the 110 face of BMCC is approximately 101 µmol of cellobiose lattice or 33.53 m2/g of BMCC, respectively. The R value of the TGC protein, the number of cellobiose lattices occupied by the adsorbed TGC, was calculated to be 21.2 by a ratio of the 101 µmol of cellobiose lattice/g of BMCC to 4.76 µmol of TGC/g of BMCC. The small-size CBM protein had a slightly smaller R value of 14.6 (Table 1), which was in agreement with the geometric structure of CBM (∼3 × 4 nm).29 The CAC values of a number of cellulosic materials were determined for the first time according to eq 2. They are 2.38 m2/g of Avicel, 4.53 m2/g of cellulose CF1, 9.76 m2/g of Whatman No. 1 filter paper, 33.53 m2/g of BMCC, and 41.91 m2/g of RAC (Table 2). Avicel (microcrystalline cellulose), which was made from wood pulp by removing the amorphous fraction through strong acid hydrolysis, has the lowest CAC. In contrast, RAC, made from regeneration of cellulose-solvent-dissolved Avicel, has the highest CAC. Some cellulosic materials (such as CF1 and filter paper) have modest CAC values because they may be regarded as a mixture of crystalline and amorphous cellulose. Enzymatic Hydrolysis of Avicel. Heterogeneous cellulose (Avicel) hydrolysis mediated by the fungal Trichoderma cellulase was conducted with an enzyme loading of 15 FPU + 30 IU β-glucosidase/g of Avicel at 50 °C (Figure 4A). Cellulose conversion rapidly rose to 31% after the first 4 h and then slowed. Total CAC decreased drastically from 23.92 to 13.13 m2/L at hour 4 to 1.48 m2/L at hour 72, while reducing ends of solid cellulose decreased from 231.4 to 161.7 µM at hour 4 to 27.3 µM at hour 72. Figure 4B presents a very drastic decline in hydrolysis rate with time, especially after the first several hours, (29) Bayer, E. A.; Chanzy, H.; Lamed, R.; Shoham, Y. Curr. Opin. Struct. Biol. 1998, 8, 548-557.
Determining Cellulose Accessibility to Cellulase
Langmuir, Vol. 23, No. 25, 2007 12539
Table 2. Maximum Protein Adsorption Capacity, CAC, and Fraction of β-Glucosidic Bond Accessible to Cellulase (Fa) for Various Cellulosic Materials Determined Based on the Nonhydrolytic TGC Protein Adsorption CAC
Fa
cellulose
mg/g
Amax µmol/g
(m2/g)
(unitless)
Avicel cellulose CF1 filter paper BMCC RAC
21.0 ( 0.85 39.9 ( 1.3 86.2 ( 2.8 295 ( 13 369 ( 19
0.338 ( 0.014 0.644 ( 0.021 1.39 ( 0.045 4.76 ( 0.21 5.97 ( 0.31
2.38 ( 0.096 4.53 ( 0.15 9.76 ( 0.32 33.5 ( 1.5 41.9 ( 2.2
0.00232 ( 0.00011 0.00442 ( 0.00021 0.00954 ( 0.00045 0.0327 ( 0.0016 0.0410 ( 0.0020
co-incident with a sharp rise in cellulase/(AmaxS) from 0.41 to 1.15 at hour 12, a transition from substrate excess to substrate limited. Declining hydrolysis rates over conversion have been attributed to a number of factors, such as enzyme denaturation, enzyme inhibition, changes in substrate characteristics, and so on. At the same time, enzyme denaturation was minor (
