Quantitative Profiling Identifies Potential Regulatory Proteins Involved

Jan 11, 2016 - First gene-edited babies born, scientist claimsFirst gene-edited babies born, scientist claims. When the powerful and simple-to-use ...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/jpr

Quantitative Profiling Identifies Potential Regulatory Proteins Involved in Development from Dauer Stage to L4 Stage in Caenorhabditis elegans Sunhee Kim,†,⊥,¶ Hyoung-Joo Lee,‡,#,¶ Jeong-Hoon Hahm,‡,⊥ Seul-Ki Jeong,‡ Don-Ha Park,‡ William S. Hancock,§ and Young-Ki Paik*,†,‡,∥ †

Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul, Korea Yonsei Proteome Research Center, Yonsei University, Seoul, Korea § Department of Chemical Biology, Northeastern University, Boston, Massachusetts 02115, United States, ∥ Department of Integrated Omics for Biomedical Science, Graduate School, Yonsei University, Seoul, Korea ‡

S Supporting Information *

ABSTRACT: When Caenorhabditis elegans encounters unfavorable growth conditions, it enters the dauer stage, an alternative L3 developmental period. A dauer larva resumes larval development to the normal L4 stage by uncharacterized postdauer reprogramming (PDR) when growth conditions become more favorable. During this transition period, certain heterochronic genes involved in controlling the proper sequence of developmental events are known to act, with their mutations suppressing the Muv (multivulva) phenotype in C. elegans. To identify the specific proteins in which the Muv phenotype is highly suppressed, quantitative proteomic analysis with iTRAQ labeling of samples obtained from worms at L1 + 30 h (for continuous development [CD]) and dauer recovery +3 h (for postdauer development [PD]) was carried out to detect changes in protein abundance in the CD and PD states of both N2 and lin-28(n719). Of the 1661 unique proteins identified with a < 1% false discovery rate at the peptide level, we selected 58 proteins exhibiting ≥2-fold up-regulation or ≥2-fold down-regulation in the PD state and analyzed the Gene Ontology terms. RNAi assays against 15 selected up-regulated genes showed that seven genes were predicted to be involved in higher Muv phenotype (p < 0.05) in lin-28(n791), which is not seen in N2. Specifically, two genes, K08H10.1 and W05H9.1, displayed not only the highest rate (%) of Muv phenotype in the RNAi assay but also the dauer-specific mRNA expression, indicating that these genes may be required for PDR, leading to the very early onset of dauer recovery. Thus, our proteomic approach identifies and quantitates the regulatory proteins potentially involved in PDR in C. elegans, which safeguards the overall lifecycle in response to environmental changes. KEYWORDS: C. elegans, continuous development, dauer stage, heterochronic mutants, postdauer development reprogramming, proteomics

■

INTRODUCTION The C. elegans lifecycle comprises multiple stages: egg → L1 → L2 → L3 → L4 and adult. When C. elegans encounters unfavorable growth conditions, it enters the dauer stage, an alternative L3 developmental period.1 Dauer larvae have a specific body shape (i.e., a closed mouth and high level of fat storage in the body) that allows them to survive longer under harsh environmental conditions.2 A dauer larva resumes larval development to the normal L4 stage by uncharacterized postdauer development reprogramming (PDR) when growth conditions become more favorable.3 In the PDR process, certain heterochronic genes are known to act in C. elegans.4−7 These heterochronic genes are generally involved in controlling the relative timing of stage-specific events in development.8−10 © XXXX American Chemical Society

Mutations in these heterochronic genes, which include lin-4, lin14, lin-28, and lin-29, cause the skipping of stages and the precocious or retarded development of cell lineages in hypodermal and vulval cells.8−10 Dauer larvae are known to arrest development at the L2 molt, at which the lateral hypodermal and vulval cell lineages cease.7 During dauer recovery to the L4 stage, certain heterochronic developmental defects are phenotypically suppressed in hypodermal cells.5 For example, lin-14 and lin-28 null mutations do not affect the stage-specific events during postdauer development (PD), although they do affect it during Received: September 18, 2015

A

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research continuous development (CD).7 The precocious vulva development of the lin-14 and lin-28 mutants lead to a deficiency in egg laying (i.e., Muv phenotype) during CD; however, the Muv phenotype is corrected by PD, a period of return to the normal lifecycle (L4). Hence, these mutants have restored egg-laying ability, which suggests that the dauer larvae of lin-14 and lin-28 mutants are capable of reprogramming vulval cells during dauer recovery.6 There have been several attempts to determine the differences between the CD and PD states (or nondauer versus dauer states) using different methods (e.g., DNA microarray and SAGE) under various conditions.11,12 These studies revealed specific patterns of gene expression during CD and PD. A recent study using chromatin immunoprecipitation also showed genome-wide levels of specific histone tail modifications to be notably altered in PD animals;13 however, the methods used in the previous works suffer several limitations in identifying the key proteins involved in PDR. For instance, although DNA microarray technology shows the patterns of change in mRNA levels, additional protein profiling work is usually needed because mRNA levels do not always correlate with protein levels.14,15 In this regard, we reasoned that proteomic analysis of heterochronic mutants would provide complementary information to genomic data, leading to identification of the proteins potentially involved in PDR in C. elegans. We used quantitative proteomic analysis to identify these specific proteins in the lin-28(n719) strain, a heterochronic mutant, as this worm strain was deemed most suitable for revealing changes in the expression of the genes and proteins involved in PDR. Here we provide snapshot evidence, indicating that some of the proteins identified as being differentially expressed in CD and PD may be involved in the transition from the dauer to L4 stage in C. elegans.

■

Normaski images and GFP expression analysis. The distance between the DTCs and body length was measured with Axiovision software (version 4.7.2). Protein Preparation for Proteomic Analysis

The C. elegans samples collected at a specific developmental stage from the NGM plates were homogenized in lysis buffer (7 M urea, 2 M thiourea, 4% CHAPS, 10 mM Tris, 5 mM magnesium acetate, and one complete proteinase inhibitor cocktail tablet (Roche, Switzerland)). The cell lysates were sonicated on ice for 1 min with 2 s pulses every 2 s and then sat for 30 min at room temperature (RT) with repeated stirring on the vortex. Insoluble cellular debris was removed by centrifugation at 98 235g for 60 min at 4 °C. The protein concentrations were determined with a Bradford assay kit (BioRad, Hercules, CA) using bovine serum albumin as the standard. iTRAQ Labeling

The samples (CD and PD) were reduced, alkylated, and subjected to tryptic digestion, as previously described.17 Each 100 μg sample was labeled with iTRAQ reagents, in accordance with the manufacturer’s protocol (ABSCIEX, Foster City, CA). For biological replications, two replicates for PD and CD were labeled with different iTRAQ reagents (114: PD, 115: CD, 116: PD, 117: CD), respectively. LC−MS/MS Analysis of iTRAQ-Labeled Peptides

Nano-HPLC analysis was performed using an Easy n-LC (Thermo Fisher Scientific, San Jose, CA), as previously described.17 The capillary column (150 × 0.75 mm, Phoenix S&T, Chester, PA) was packed with 5 μm, 100 Å pore size Magic C18 stationary phase resin (Michrom BioResources, Auburn, CA). The mobile phases for LC separation were 0.1% formic acid in deionized water (A) and 0.1% formic acid in acetonitrile (B). The chromatography gradient was designed for a linear increase from 0 to 5% B in 5 min, 5 to 25% B in 100 min, 25 to 45% B in 10 min, and 45 to 60% B in 10 min. LTQOrbitrap mass spectrometry (Thermo Fisher) was used for either identification or quantification of peptides. The Xcalibur (version 2.1, Thermofisher) was used to generate peak lists. Orbitrap full MS scans were acquired from m/z 350 to 1500 with 15 000 resolution (at m/z 400) using an automatic gain control (AGC) value of 2 × 105. The six most intense ions were first fragmented by high-energy collisional dissociation (HCD) for quantitation and then fragmented again by collision-induced dissociation (CID) for identification. For HCD, the AGC was set to 1 × 105 (isolation width of 2 m/z units) with a resolution of 7500 using Orbitrap. For CID, the AGC was set to 1 × 104 (isolation width of 2 m/z units) using LTQ. Single charged ion was excluded for MS/MS fragmentation. The dynamic exclusion time for precursor ion m/z values was 30 s. Collision energies of 45 and 35% were set for HCD and CID, respectively. Internal calibration was performed using the background polysiloxane ion signal at m/z 445.120025 as the calibrant.

EXPERIMENTAL PROCEDURES

Strains

The C. elegans strains used in this study were N2 Bristol (wildtype), lin-28(n719), and lin-29(n333) obtained from the Caenorhabditis Genetics Center (Minneapolis, MN). The handling and maintenance of these strains were as previously described.16 Dauer and Postdauer Animals

Dauer animals bearing heterochronic mutations and N2 were obtained as previously described with minor modifications.12 lin-28(n719), lin-29(n333), and N2 were grown on nematode growth medium (NGM) plates for 15 days at 20 °C. Cultivation period for 15 days at 20 °C is sufficient to induce dauer formation in heterochronic mutants and wild type. After 15 days, the plates were washed with distilled water (DW) and treated with 1% sodium dodecyl sulfate (SDS) for 1 h to retain SDS-resistant dauer animals. The dauer worms were washed three times with DW and recovered on NGM plates seeded with E. coli (OP50) at 20 °C. Measurement of Distal Tip Cell and Body Length

Database Search for Identification and Quantification of iTRAQ-Labeled Peptides

To determine the size of the germline that tends to change with developmental timing, we microinjected lag-2 promoter::green fluorescent protein (GFP) plasmid (PJK590 from Addgene (Cambridge, MA)), which is expressed in distal tip cells (DTCs), was microinjected into the lin-28(n719) mutants. A Zeiss Axioscope equipped with an AxiCam (HRc) was used for

ProteomeDiscoverer software (version 1.2, Thermo Fisher Scientific) with SEQEUST search engine was used for protein identification and quantification. The peptides were identified using the C. elegans protein sequence database (Swiss-Prot; release date: April 2012, total 3339 sequences) without inclusion of any contaminants. The database search criteria B

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research were as previously described.18 They are, taxonomy of C. elegans, carboxyamidomethylated (+57) at cysteine residues for fixed modifications, oxidized at methionine (+16) residues for variable modifications, two maximum allowed missed cleavage, 10 ppm MS tolerance, a 0.8-Da CID, and 20 mmu HCD MS/ MS tolerance. Only peptides resulting from trypsin digests were considered. For those iTRAQ-labeled peptides, 4-plex iTRAQ modification was added at peptide N termini (+144.102 Da) and at lysines (++144.102 Da) for fixed modification. Less than 1% false discovery rate (FDR) was used for acceptance for peptide assignment. Quantification was carried out by calculating the relative ratio acquired from iTRAQ reporter groups (115/114 for replication #1 and 117/116 for replication #2). To eliminate any masking of changes in expression arising from peptide-sharing between proteins, we calculated the protein ratio using only the ratio of peptides unique to each protein. All quantitative results were normalized using protein medians (minimum protein count: 20). If all quant channels were not present, the quant values were rejected. To ensure more reliable data, we selected proteins that had a ratio of duplicates (116/114) with ≤1 ± 0.1.

mutants.5 Heterochronic mutants lin-28(n719) are unable to lay eggs due to the precocious development of the vulval cell lineages during CD, but the phenotype is suppressed during PD.5 To screen the heterochronic gene mutants to detect suppression of the Muv phenotype during PD, we obtained dauer larvae of lin-28(n719) and lin-29(n333) 15 days after starvation at 20 °C and then let them recover from the dauer stage. We then tested both lin-28(n719) and lin-29(n333) for their suppression rate of the Muv phenotype during PD. Only ∼15% of the PD adults exhibited the vulva-defective phenotype in lin-28(n719), a 5-fold higher suppression rate than another heterochronic mutant, that is, lin-29 (Figure 1A). Thus, we used lin-28(n719) throughout the work. The Muv phenotype of lin-28(n719) was highly suppressed by development through the dauer stage (Figure 1B,C). Phenotypic suppression of lin28(n719) was observed only in PD not in L1 arrest (data not shown). This result suggests the presence of certain PDR signals (Figure 1D), which may cause phenotypic suppression

RNAi Feeding Experiment

RNAi plates were prepared by supplementing the NGM plates with 100 μg/mL ampicillin and 1 mM IPTG. E. coli for RNAi (from RNAi feeding library: Fire collection) were grown overnight at 37 °C in a lysogeny broth (LB) medium supplemented with 100 μg/mL ampicillin and 12.5 μg/mL tetracycline. The next day, the cultures were diluted (1:50) in LB containing 100 μg/mL ampicillin and grown at 37 °C until an OD600 of 0.7, with 1 mM IPTG added. About 200 μL of the bacterial suspension was seeded onto the 60 mm plates. The seeded plates were then dried at RT for 3 days and stored at 4 °C until use. Dauer animals recovered on the RNAi plates during PD and the suppression of the Muv phenotype were observed under a dissecting light microscope (Olympus, SZ). Real-Time Quantitative Reverse-Transcription Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated from the CD-L3, CD-L4, dauer, PD + 3 h, and PD-L4 stages in the lin-28(n719) mutants and wild type using RNeasy spin columns (Qiagen, Valencia, CA) and then treated with DNase I (Takara Bio, Otsu, Japan) as described by the manufacturer. The cDNA was synthesized with a Transcriptor First Strand cDNA Synthesis Kit (Roche) and quantified with a Nanodrop (ND-1000). qRT-PCR reactions were performed on an MJ Research Chromo4 Detector using the QuantiTect SYBR Green PCR kit (Qiagen), as described by the manufacturer. Error bars represent standard deviation of at least three replicates. β-actin (oligonucleotide sequences are Forward; 5′-AAGTCATCACCGTCGGAAAC, Reverse; 5′-TTCCTGGGTACATGGTGGTT) was used as an internal control. Primer sequences: K08H10.1 (Forward; 5′TCTCTGCTGCCGGAGACTAT, Reverse; 5′- GTGAGCGTTGTCTCCAGTGA), W05H9.1 (Forward; 5′-TCTCAGTTGCACTGCTGCTT, Reverse; 5′-TCCCGGTATTTGTCTCTTGC).

■

Figure 1. Postdauer development suppression of Muv phenotype present in lin-28(n719). (A) Suppression of the Muv phenotype during the course of PDR in lin-28(n719) and lin-29(n333) mutants. 120 worms for each condition were grown in either the continuous development (CD: red) or postdauer development (PD: blue) state, and the number of animals exhibiting the Muv phenotype was recorded. The error bar depicts ± standard error (S.E.) of mean. (B) Adult lin-28(n719) mutant animals maintained in the CD state displayed Muv and protruding vulva phenotypes (arrow). There were no eggs in the mixed culture plate in the CD condition (right). (C) Adult lin-28(n719) mutant animals in the PD state exhibited the normal vulva phenotype. In contrast with the CD animals, there were many eggs in the mixed culture plate of the PD animals (right). (D) Summary of proposed PDR model for phenotypic suppression in lin28(n719) mutant during the post dauer development.

RESULTS AND DISCUSSION

Muv Phenotype Is Highly Suppressed during Dauer Stage in lin-28 Mutants

Phenotypic suppression of developmental progression through the dauer stage is one of the unique features of heterochronic C

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research only in the transition period from the dauer to L4 stage in C. elegans. Quantitative Analysis of Proteins Expressed in lin-28(n719) Mutants Maintained in CD and PD States

It is well known that certain groups of genes are differentially expressed as a worm enters or exits the dauer phase (i.e., PD).12,19,20 To identify those proteins that are differentially expressed in lin-28 mutants during the PD transition period, we performed quantitative proteomic analysis to detect changes in protein abundance between the CD and PD states in C. elegans. To ensure that the CD and PD worms were at the same larval stage prior to protein extraction, we measured the germline size and body length of the lin-28(n719) animals in the two states. The shape and location of the two gonad arms were determined by the migratory path of a DTC at the leading edge of each arm and lag-2 expression.21 We found that worms at L1 + 30 h (CD) and PD + 3 h (PD) were in the same larval stage (Supplemental Figure S1). To prepare protein extracts in the CD state, we incubated synchronized L1 larvae of the lin28(n719) mutants at 20 °C for 30 h. To prepare those protein extracts in the PD state, we collected dauer larvae of the lin28(n719) mutants (Figure 2A) and then let them recover by sitting on NGM plates at 20 °C for 3 h. We analyzed the protein samples obtained from these worms using an LTQOrbitrap to identify and quantify the proteins that showed changes in abundance under the two growth conditions (CD versus PD), as depicted in Figure 2B. For quantitative analysis of the duplicate samples, proteins from the PD and CD conditions were labeled 114 or 116 (PD) and 115 or 117 (CD), respectively, and mixed to a 1:1:1:1 ratio. The mixture was fractionated by strong cationic exchange chromatography to reduce the complexity. Each fraction was subjected to highresolution LC−MS/MS to identify and quantify the iTRAQlabeled peptides. The six most intense ions were first fragmented by HCD for quantitation and then fragmented again by CID for identification. As a result, 1661 unique proteins were identified (Supplemental Table S1) with 2-fold up-regulation (28 proteins, Table 1) or >2fold down-regulation (30 proteins, Table 2) in the PD state (Supplemental Table S1). We also compared our proteomic results (Table 1) with previously published global transcriptomic data in which differentially expressed genes during dauer recovery were presented by global genomic microarray analysis.12 They grouped dauer-specific genes as “dauerenriched (540 genes), transient (195 genes), early (538 genes), climbing (386 genes), and late (325 genes)”. When we made cross-comparison between our proteome data (Table

Figure 2. Scheme of proteomic analysis and data validation. Dauers of lin-28(n719) obtained from 15 days of starvation. Two sample sets (L1 + 30 h [CD] and PD + 3 h [PD]) were analyzed using the proteomic technique. (A) Overall sample preparation scheme. (B) iTRAQ labelbased quantitative analysis of two different larvae grown under different conditions (CD versus PD) with duplicate runs. The protein samples obtained from each condition were labeled with iTRAQ reagents (114: PD, 115: CD, 116: PD, 117: CD) and analyzed with an LTQ-Orbitrap (see Experimental Procedures). (C) Scatter plot of the iTRAQ ratio for duplicate analysis of PD status (116/114). (D) Scatter plot of iTRAQ ratios (log2 scale) of PD and CD groups generated in duplicate runs. The two groups were labeled with 114 or 116 (PD) and 115 or 117 (CD) and mixed to a 1:1:1:1 ratio for duplicate analysis. The mixture was fractionated by strong cationic exchange chromatography to maximize the number of identified proteins. Each fraction was subjected to high-resolution LC−MS/MS.

1) and the microarray data, only five genes (i.e., B0334.1, K08H10.2, C55F2.1b, ZK1248.16, and F25H8.5a) showed in “dauer-specific genes”. Moreover, 15 genes (F21C10.9, C01G6.6, ZK6.11, C01F1.3, F32H2.5, C49F5.1, F54D11.1, K12H4.7, T18H9.2, T25C12.3, C06A8.1, R07H5.8, K02F2.2, F59B8.2, K10C2.1), whose expression was decreased in PD, were grouped as “dauer-specific genes” in the microarray results.12 This discrepancy might be due to one of two reasons: (1) They are specific to lin-28 mutant or (2) there are D

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research

Table 1. List of the Post-Dauer Development Specific Proteins That Were Up-Regulated (> 2-fold) Compared with Those in Continuous-Development State sequence name

coverage

PSMsa

peptidesb

MWc

calcd pId

scoree

R05A10.1 F15E11.14 ZK1058.9b F45D11.16 K08H10.1 T23E7.2 Y43F8B.1d F59B1.2 Y19D10B.7 F53A9.10 B0334.1 ZK637.13 D2030.5 ZC155.1 K08H10.2 F43D9.4 D1014.3 F25H8.5a C55F2.1b ZK1248.16 C32D5.8a T14G12.3 actin W05H9.1 T08G11.1b F09F7.2 T25F10.6a ZK721.2

22.41 33.12 15.63 23.15 22.51 22.27 46.27 14.29 43.71 23.13 23.02 23.90 28.40 35.71 11.69 41.51 14.58 27.05 21.38 39.17 37.86 25.37 63.20 27.54 2.29 78.43 54.19 17.77

14 17 3 37 27 29 53 4 14 27 8 9 8 37 9 10 3 37 10 25 3 6 307 18 6 103 60 21

7 4 3 11 13 13 27 3 5 10 4 4 4 12 6 4 3 12 8 12 3 5 20 10 6 15 15 6

45.1 17.4 26.7 58.5 77.0 95.3 78.6 17.7 17.2 48.7 15.2 18.5 17.5 35.7 59.4 17.8 33.1 79.5 64.8 35.4 15.7 24.4 41.6 47.4 356.3 17.1 44.3 27.5

8.62 6.52 9.74 5.66 5.02 4.53 9.03 6.87 6.80 4.88 8.15 7.99 8.73 6.58 4.74 8.09 5.49 6.20 6.62 7.97 5.38 9.72 5.48 5.76 6.34 4.70 5.39 5.53

55.09 107.19 19.61 203.63 116.56 121.25 280.25 25.04 69.60 178.11 22.40 36.40 44.65 186.50 40.11 49.07 16.64 214.00 52.50 131.68 31.45 32.86 1574.46 89.45 40.72 525.50 304.79 129.86

fold changef 2.2 2.0 1.9 1.9 1.7 1.5 1.5 1.4 1.4 1.4 1.3 1.3 1.3 1.3 1.3 1.3 1.2 1.2 1.1 1.2 1.1 1.1 1.1 1.1 1.1 1.0 1.0 1.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.10 0.02 0.04 0.19 0.10 0.10 0.11 0.14 0.00 0.00 0.34 0.10 0.04 0.09 0.13 0.18 0.00 0.05 0.28 0.10 0.17 0.18 0.02 0.35 0.18 0.06 3.37 0.10

a

PSMs: Total number of identified peptide sequences including those redundant ones. bPeptides: number of peptide sequences that are unique to a protein group. cMW: molecular weight of protein. dCalcd pI: theoretical Isoelectric point of protein. eScore: total score of the protein representing the sum of the scores of the individual peptides. fFold change: up-regulated fold (log2).

the up- or down-regulated proteins in the PD state are involved in larval development and growth regulation; however, we believe that the group of up-regulated proteins detected only in the PD state is involved in chromatin assembly/disassembly, nucleosome assembly, protein−DNA complex assembly, and DNA packaging (Figure 3B). Our data also indicate that chromatin-associated and DNA-assembly-related proteins may be required to ensure the modulation of large gene expression changes during the course of PDR (Figure 3B). Given that the differentially expressed genes involved in chromatin and DNA assembly are quite active in the PD state, it seems plausible to propose that worms in that state may be ready to move back to normal lifecycle L4.

differences in analytical methods (genomic microarray vs quantitative proteomics). Global transcriptomic analyses often result in different data expression data depend on what platforms were used. For example, the microarray data from ref 12 share only 14% overlaps in “dauer-enriched genes” with that of the serial analysis of gene expression (SAGE) data.11 Biological Implications of Protein Expression Patterns in PD State

To determine whether specific biological processes were affected during the course of PDR, we analyzed the Gene Ontology (GO) terms for each differentially expressed protein exhibiting >2-fold changes (in either down- or up-regulation) in the PD state. The affected proteins were found to be linked to various biological processes. Some of them are known to be involved in cofactor binding (p value = 2.18 × 10−4), coenzyme binding (p value = 4.91 × 10−04), oxidation/reduction (p value = 0.018194), the organic acid biosynthetic process (p value =0.023156), the carboxylic acid biosynthetic process (p value = 0.023156), the methionine metabolic process (p value = 0.028242), cell redox homeostasis (p value = 0.028628), and the aspartate family amino acid metabolic process (p value = 0.044031) (Figure 3A). We also evaluated the differences in function between the up- and down-regulated proteins. The highest difference values were observed in the proteins involved in embryonic development, growth regulation, and larval development, which were either highly decreased or increased in the PD state (Figure 3B). These results suggest that some of

Regulation of PD Suppression Effect in lin-28(n719)

To examine whether the identified PD-specific proteins are also associated with the PD suppression of the lin-28(n719) mutant, we performed an RNAi feeding assay against 15 selected genes (available in RNAi library) that exhibited greater than 2-fold up-regulation in the PD state. Of these 15 RNAi-treated worms, 7 worms displayed the higher Muv phenotype (p < 0.05) than control (L4440) when >3 vulvas per single worm were counted in the PD state of the lin-28(n719) mutant (Figure 4A). We also confirmed that the knock-down of these seven genes did not induce the Muv phenotype in the CD and PD of the wildtype strain (data not shown). This result suggests that the seven genes are likely involved in the vulva development of lin28(n719) during PDR. From these seven genes, we chose the E

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research

Table 2. List of the Post-Dauer Development Specific Proteins That Were Down-Regulated (> 2-fold) Compared with Those in Continuous Development State sequence name

coverage

PSMsa

peptidesb

MWc

calcd pId

scoree

F21C10.9 C01G6.6 ZK6.11 K02A4.1 C01F1.3 F32H2.5 C49F5.1 F54D11.1 Y73B6BL.6 Y57A10A.23 Y54E10A.10 K12H4.7 T18H9.2 T25C12.3 F21F8.7 F55H2.6 C55B7.4 C06A8.1 W02A2.1 R07H5.8 F53F4.10 K02F2.2 F53A3.3 K08F11.3 F59B8.2 B0403.4 K10C2.1 Y53F4B.29 F54F11.2 K10D2.6

10.73 7.04 13.25 12.29 6.18 8.57 28.04 22.65 29.84 16.13 13.13 11.84 13.05 1.62 16.45 4.01 15.93 8.26 7.98 35.38 25.94 47.60 34.62 7.69 36.89 19.55 2.20 18.18 2.27 8.31

7 5 6 5 3 27 29 19 13 6 3 7 5 4 9 4 13 5 5 22 7 117 21 5 30 10 5 5 4 5

3 4 5 4 3 18 10 9 7 4 3 4 4 3 4 4 5 3 3 10 5 18 4 3 12 6 4 3 3 4

36.3 76.7 42.4 47.3 71.0 289.0 43.5 49.7 33.4 21.4 33.4 52.4 46.6 230.7 41.4 139.9 47.1 73.1 43.4 37.4 26.2 47.5 14.7 44.0 45.9 47.6 256.2 23.2 177.9 75.1

5.94 5.75 8.79 7.04 6.12 6.08 6.48 5.92 8.77 8.54 9.75 6.40 5.19 4.97 5.99 6.13 6.85 5.40 7.21 5.99 7.02 6.25 10.41 5.75 6.48 6.16 5.82 5.98 5.32 5.78

25.69 25.20 34.87 29.27 24.10 168.55 169.05 80.88 53.44 29.52 9.367 37.27 16.91 24.94 44.82 37.24 90.55 37.72 27.97 96.88 37.93 747.77 139.10 37.75 161.77 83.82 27.88 35.78 29.63 16.97

fold changef −3.1 −2.5 −2.2 −1.9 −1.8 −1.8 −1.7 −1.6 −1.4 −1.5 −1.5 −1.3 −1.4 −1.3 −1.3 −1.3 −1.2 −1.2 −1.1 −1.1 −1.1 −1.1 −1.0 −1.1 −1.1 −1.0 −1.1 −1.0 −1.0 −1.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.51 0.38 0.24 0.08 0.00 0.20 0.03 0.10 0.18 0.27 0.27 0.03 0.02 0.16 0.04 0.08 0.11 0.06 0.07 0.22 0.18 0.01 0.02 0.04 0.06 0.05 0.01 0.42 0.08 0.05

a

PSMs: total number of identified peptide sequences including those redundant ones. bPeptides: number of peptide sequences that are unique to a protein group. cMW: molecular weight of protein. dCalcd pI: isoelectric point of protein. eScore: total score of the protein representing the sum of the scores of the individual peptides. fFold Change: down-regulated fold (log).

two (i.e., K08H10.1 and W05H9.1) that exhibited the highest rate (%) of Muv phenotype occurrence in the RNAi assay (Figure 4A) and performed RNAi feeding at 3, 6, 9, and 12 h of PD. Interestingly, both genes exhibited the Muv phenotype as soon as 3 h after RNAi feeding (Supplemental Table S2), indicating that they may be required for early PD onset. Expression of the mRNAs of K08H10.1 and W05H10.1 began increasing at the dauer stage, and then gradually decreased in PD (Figure 4B). Furthermore, the expression of two genes (K08H10.1 and W05H9.1) displayed a dauer-specific pattern both in lin-28(n719) and wild type (Figure 4B and Supplemental Figure S2). RNAi knock down of K08H10.1 and W05H9.1 genes during dauer recovery affects vulva development only in lin-28 mutant, not in wild type. This suggests that function of K08H10.1 and W05H9.1 in PDR is specifically required for the lin-28 specified vulva cell lineage or these genes play another role in PDR, which we were not able to observe in N2 wild type. To check if the expression pattern of the identified proteins during PDR was closely related to their ability to suppress the Muv phenotype in lin-28(n719), we analyzed transcription levels of those genes after PDR process (PD-L4 stage). We were not able to find any relevance between these genes’ ability to suppress Muv phenotype as well as transcripts levels in PD of lin-28(n719) and CD of wild type at the L4 stage (Supplemental Figure S2). This result suggests

that protein regulation and functions during PDR process seems important for the phenotype suppression of lin28(n719). It would be of particular interest to determine the exact function of K08H10.1 (or plant Late Embryogenesis Abundant (LEA)-related [LEA-1]). lea-1 is predicted to be one of the SKN-1 downstream target genes.22 SKN-1 is an ortholog of human Nrf2, which regulates multiple stress response genes. The dysfunction of SKN-1 leads to reduced resistance to oxidative stress.23−25 The RNAi-mediated knock-down of lea-1 has been shown to exhibit an extended life span under normal conditions, suggesting that LEA-1 promotes aging without stress;22 however, because LEA-1 is known to act as a defense protein against dehydration stress in dauer larvae of C. elegans, it may be more important to up-regulate desiccation-resistant genes such as lea-1 for longer survival under harsh conditions.26,27 It is also thought that LEA-1 may act as a molecular chaperon, suggesting that LEA-1 proteins may play some important functional role other than desiccation resistance.27 In this study, LEA-1 was highly expressed throughout the PD state and was also shown to regulate suppression of the Muv phenotype of lin-28(n719), suggesting its potential role in PDR. It would also be interesting to elucidate the developmental and molecular functions of the identified proteins, including LEA-1, during PDR. F

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research

Figure 3. GO clustering of proteins according to their different levels of expression (down- or up-regulated) in the PD versus CD state. (A) Distribution of proteins linked to various biological processes. (B) Expression pattern of proteins that are either up- or down-regulated (cutoff at 1.5fold) in different biological processes. The highlighted parts are the most notable proteins in a few representative biological processes (e.g., embryonic development, postembryonic development, larval development, growth rate, etc.).

■

CONCLUSIONS The proteomic analysis of the genes involved in PDR provides molecular insight into the fine modulation of the developmental process throughout the C. elegans lifecycle. We identified PDR from the phenotypic suppression of heterochronic mutants, which we were not able to observe in wildtype animals. The results obtained from the quantitative proteomic profiling of the PD stage of lin-28(n719) mutants, in which many of the differentially expressed proteins were found to be involved in dauer recovery process (e.g., chromatin assembly or disassembly, nucleosome assembly, etc.), are consistent with those in a previous report.13 In that report by Hall et al. (2010),13 genome-wide levels of specific histone tail modifications were found increased in postdauer animals. The

proteomic analysis of PD also provides several clues about the identity of the specific genes and proteins that may be involved in PDR. Thus, the proteomic approach adopted in this research opens up a new way to investigate developmental reprogramming in C. elegans, a process that safeguards the overall lifecycle developmental process in response to environmental signals or nutritional states. LIN-28 not only is important for regulation of development in heterochronic pathway but also interacts with many other genes.28−30 The proteins identified in this study were found to regulate vulval development of lin28(n719) through dauer diapause. Molecular and genetic studies on these proteins would reveal the mechanisms underlying LIN-28 signaling pathway or genetic interactions. G

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research

Figure 4. RNAi feeding assay for lin-28 in PD state. (A) RNAi feeding was performed for 15 selected genes that had exhibited greater than 2-fold upregulation in the PD state. RNAi knock-down of seven genes revealed the Muv phenotype (purple bars, p < 0.05). Two genes, K08H10.1 and W05H9.1, showed a higher percentage of the Muv phenotype (K08H10.1:40.3 ± 5.2, W05H9.1:32.6 ± 10.1) compared with the controls. (B) mRNA level of K08H10.1 (red) and W05H9.1 (blue) in lin-28 mutants grown in both the CD (L3) and PD states (dauer, PD + 3 h). All data were normalized to those obtained from CD-L3. Significance was determined using a two tailed, unpaired t test. * (p < 0.05), ** (p < 0.01), *** (p < 0.001).

■

Notes

ASSOCIATED CONTENT

S Supporting Information *

The authors declare no competing financial interest.

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jproteome.5b00884. Supplemental Table S2: Suppression of the expression of those genes causing the Muv phenotype by RNAi feeding in lin-28 mutant during the postdauer development stage. Supplemental Figure S1: Measurement of the distance between DTCs and body size. Supplemental Figure S2: Relative expression of 15 genes in CD and PD of N2 and lin-28 mutant. (PDF) Supplemental Table S1: Information of total proteins quantified by iTRAQ labeling in lin-28 mutant CD and PD. (XLSX)

ACKNOWLEDGMENTS This work was supported in part by a grant from the National Research Foundation, Ministry of Science, ICT and Future Planning, Korea 2011-0028112 (to Y.-K. P.)

■

■ ■

REFERENCES

(1) Golden, J. W.; Riddle, D. L. The Caenorhabditis elegans dauer larva - developmental effects of pheromone, food, and temperature. Dev. Biol. 1984, 102, 368−378. (2) Golden, J. W.; Riddle, D. L. A pheromone influences larval development in the nematode Caenorhabditis elegans. Science 1982, 218, 578−580. (3) Kim, S.; Paik, Y. K. Developmental and reproductive consequences of prolonged non-aging dauer in Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 2008, 368, 588−592. (4) Chalfie, M.; Horvitz, H. R.; Sulston, J. E. Mutations that lead to reiterations in the cell lineages of C. elegans. Cell 1981, 24, 59−69. (5) Ambros, V.; Horvitz, H. R. Heterochronic mutants of the nematode Caenorhabditis elegans. Science 1984, 226, 409−416. (6) Liu, Z. C.; Ambros, V. Heterochronic genes control the stagespecific initiation and expression of the dauer larva developmental program in Caenorhabditis elegans. Genes Dev. 1989, 3, 2039−2049. (7) Euling, S.; Ambros, V. Heterochronic genes control cell cycle progress and developmental competence of C. elegans vulva precursor cells. Cell 1996, 84, 667−676. (8) Ambros, V. In C. elegans II; Cold Spring Harbor Laboratory Press, 1997. (9) Liu, Z. C.; Ambros, V. Alternative temporal control-systems for hypodermal cell-differentiation in Caenorhabditis elegans. Nature 1991, 350, 162−165. (10) Euling, S.; Ambros, V. Reversal of cell fate determination in Caenorhabditis elegans vulval development. Development 1996, 122, 2507−2515.

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Tel. +82 2 2123 4242. Present Addresses ⊥

S.K. and J.-H.H.: Center for Plant Aging Research, Institute for Basic Science (IBS), Building E4 Rm 620, Daegu Gyeongbuk Institute of Science and Technology (DGIST), 50-1 Sang-Ri, Hyeonpung-Myeon, Dalseong-Gun, Daegu, 711873, Korea. # H.-J.L.: Department of Biochemistry, University of Vanderbilt, 9264 MRB3 BioScience Bldg., 465 21st Avenue South, Nashville, TN 37232-8575, USA. Author Contributions ¶

These authors equally contributed to this work. H

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX

Article

Journal of Proteome Research (11) Jones, S. J.; Riddle, D. L.; Pouzyrev, A. T.; Velculescu, V. E.; Hillier, L.; Eddy, S. R.; Stricklin, S. L.; Baillie, D. L.; Waterston, R.; Marra, M. A. Changes in gene expression associated with developmental arrest and longevity in Caenorhabditis elegans. Genome Res. 2001, 11, 1346−1352. (12) Wang, J.; Kim, S. K. Global analysis of dauer gene expression in Caenorhabditis elegans. Development 2003, 130, 1621−1634. (13) Hall, S. E.; Beverly, M.; Russ, C.; Nusbaum, C.; Sengupta, P. A cellular memory of developmental history generates phenotypic diversity in C. elegans. Curr. Biol. 2010, 20, 149−155. (14) Gygi, S. P.; Rochon, Y.; Franza, B. R.; Aebersold, R. Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 1999, 19, 1720−1730. (15) Peng, J. M.; Elias, J. E.; Thoreen, C. C.; Licklider, L. J.; Gygi, S. P. Evaluation of multidimensional chromatography coupled with tandem mass spectrometry (LC/LC-MS/MS) for large-scale protein analysis: The yeast proteome. J. Proteome Res. 2003, 2, 43−50. (16) Brenner, S. The genetics of Caenorhabditis elegans. Genetics 1974, 77, 71−94. (17) Lee, H. J.; Jeong, S. K.; Na, K.; Lee, M. J.; Lee, S. H.; Lim, J. S.; Cha, H. J.; Cho, J. Y.; Kwon, J. Y.; Kim, H.; Song, S. Y.; Yoo, J. S.; Park, Y. M.; Kim, H.; Hancock, W. S.; Paik, Y. K. Comprehensive genome-wide proteomic analysis of human placental tissue for the Chromosome-Centric Human Proteome Project. J. Proteome Res. 2013, 12, 2458−2466. (18) Lee, H. J.; Na, K.; Choi, E. Y.; Kim, K. S.; Kim, H.; Paik, Y. K. Simple method for quantitative analysis of N-linked glycoproteins in hepatocellular carcinoma specimens. J. Proteome Res. 2010, 9, 308− 318. (19) Dalley, B. K.; Golomb, M. Gene-expression in the Caenorhabditis elegans dauer larva - developmental regulation of hsp90 and other genes. Dev. Biol. 1992, 151, 80−90. (20) Jeong, P. Y.; Kwon, M. S.; Joo, H. J.; Paik, Y. K. Molecular timecourse and the metabolic basis of entry into dauer in Caenorhabditis elegans. PLoS One 2009, 4, e4162. (21) Henderson, S. T.; Gao, D.; Lambie, E. J.; Kimble, J. LAG-2 may encode a signaling ligand for the glp-1 and lin-12 receptors of C. elegans. Development 1994, 120, 2913−2924. (22) Oliveira, R. P.; Abate, J. P.; Dilks, K.; Landis, J.; Ashraf, J.; Murphy, C. T.; Blackwell, T. K. Condition-adapted stress and longevity gene regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell 2009, 8, 524−541. (23) An, J. H.; Blackwell, T. K. SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes Dev. 2003, 17, 1882−1893. (24) An, J. H.; Vranas, K.; Lucke, M.; Inoue, H.; Hisamoto, N.; Matsumoto, K.; Blackwell, T. K. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 16275−16280. (25) Inoue, H.; Hisamoto, N.; An, J. H.; Oliveira, R. P.; Nishida, E.; Blackwell, T. K.; Matsumoto, K. The C. elegans p38 MAPK pathway regulates nuclear localization of the transcription factor SKN-1 in oxidative stress response. Genes Dev. 2005, 19, 2278−2283. (26) Gal, T. Z.; Glazer, I.; Koltai, H. An LEA group 3 family member is involved in survival of C. elegans during exposure to stress. FEBS Lett. 2004, 577, 21−26. (27) Hand, S. C.; Menze, M. A.; Toner, M.; Boswell, L.; Moore, D. LEA proteins during water stress: not just for plants anymore. Annu. Rev. Physiol. 2011, 73, 115−134. (28) Ambros, V. A hierarchy of regulatory genes controls a larva-toadult developmental switch in C. elegans. Cell 1989, 57, 49−57. (29) Moss, E. G.; Lee, R. C.; Ambros, V. The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 1997, 88, 637−646. (30) Stefani, G.; Chen, X.; Zhao, H.; Slack, F. J. A novel mechanism of LIN-28 regulation of let-7 microRNA expression revealed by in vivo HITS-CLIP in C. elegans. RNA 2015, 21, 985−996.

I

DOI: 10.1021/acs.jproteome.5b00884 J. Proteome Res. XXXX, XXX, XXX−XXX