Reconstitution of an Ultradian Oscillator in ... - ACS Publications

Subscriber access provided by University of Groningen

Article

Reconstitution of an ultradian oscillator in mammalian cells by a synthetic biology approach Marco Santorelli, Daniela Perna, Akihiro Isomura, Immacolata Garzilli, Francesco Annunziata, Lorena Postiglione, Barbara Tumaini, Ryoichiro Kageyama, and Diego di Bernardo ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00083 • Publication Date (Web): 04 May 2018 Downloaded from http://pubs.acs.org on May 6, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Reconstitution of an ultradian oscillator in mammalian cells by a synthetic biology approach. Marco Santorelli1, Daniela Perna1#, Akihiro Isomura2#, Immacolata Garzilli1, Francesco Annunziata1,3, Lorena Postiglione1, Barbara Tumaini1, Ryoichiro Kageyama2, Diego di Bernardo1,4,* 1

Telethon Institute of Genetics and Medicine (TIGEM), 80078 Pozzuoli, Italy. 2 Institute for Frontier Life and Medical Sciences, Kyoto University, Kyoto 606-8507, Japan. 3Present address: Leibniz Institute on Aging - Fritz Lipmann Institute (FLI), Beutenbergstrasse 11, 07745 Jena, Germany. 4 Department of Chemical, Materials and Industrial Production Engineering, University of Naples Federico II, 80125 Naples, Italy. ABSTRACT The Notch effector gene Hes1 is an ultradian clock exhibiting cyclic gene expression in several progenitor cells, with a period of a few hours. Because of the complexity of studying Hes1 in the endogenous setting, and the difficulty of imaging these fast oscillations in vivo, the mechanism driving oscillations has never been proven. Here, we applied a “build it to understand it” synthetic biology approach to construct simplified ‘hybrid’ versions of the Hes1 ultradian oscillator combining synthetic and natural parts. We successfully constructed a simplified synthetic version of the Hes1 promoter matching the endogenous regulation logic. By mathematical modelling and single-cell real-time imaging, we were able to demonstrate that Hes1 is indeed able to generate stable oscillations by a delayed negative feedback loop. Moreover, we proved that introns in Hes1 contribute to the transcriptional delay but may not be strictly necessary for oscillations to occur. We also developed a novel reporter of endogenous Hes1 oscillations able to amplify the bioluminescence signal five-fold. Our results have implications also for other ultradian oscillators. KEYWORDS oscillations, Hes1, delayed negative feedback, single cell, synthetic promoter

Cells are dynamical systems that can replicate and self-organise to give rise to complex tissues and ultimately whole organisms. Molecular oscillators, defined as genes cyclically expressed over time, are essential to ensure the correct temporal sequence of biomolecular events within cells and to coordinate behaviour among cells for proper spatial patterning1,2. Signalling pathways can encode information dynamically by regulating the activity of Transcription Factors, in terms of periodic changes in protein level or protein localization respectively. The Hairy and Enhancer of Split transcription factors (TF) Hes1 and Hes7 are ultradian oscillators, i.e. periodically expressed with a period less than 24 hour. Hes1 is mainly involved in cell fate decision and exhibits oscillations in several progenitor cells, while Hes7 is a master regulator of vertebrate segmentation3–6. It has been proposed that the mechanism driving Hes1 and Hes7 cell autonomous oscillations is a Delayed Negative Feedback Loop2,3,7. According to this model, when Notch receptor is activated by direct contact with its ligand (i.e. Dll1) exposed on the membrane of neighbouring cells, the Notch Intracellular Domain (NICD) is released from the plasma membrane and translocates to the nucleus, where it drives expression of Hes1. The protein then accumulates, with a delay caused by intron splicing and protein translation, homodimerises and represses its 1 ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

own transcription by binding several N-Boxes present on its own promoter8. Hes1 is then rapidly degraded, hence its promoter is de-repressed and another Hes1 expression cycle can start. The same model is thought to apply to Hes74,9. Mathematical and experimental evidence suggests that oscillators based on delayed negative feedback loops give rise to irregular oscillations in terms of period and amplitude, resulting in a low percentage of oscillating cells10–13. The current understanding of ultradian oscillators has been built by collecting together a plethora of in vitro and in vivo observations made in part on Hes1 and in part on Hes7. Experimental evidence has indeed shown that instability of Hes1 mRNA is essential for its cyclic expression in progenitor cells2, while instability of Hes7 protein is necessary for the somite segmentation clock14. The role of transcriptional delay in the negative feedback has been investigated only for Hes7 by generating mutant mice lacking all, or part of the Hes7 introns, thus speeding up Hes7 transcription and splicing6. In these mice, Hes7 oscillations were either not visible, when all the introns were deleted, or dampened with a shorter period, when two out of three introns were deleted (Takashima et al., 2011; Harima et al., 2013). Cell–cell communication via Notch-Delta pathway and the crosstalk with other pathways (i.e. FGF and Yap) are crucial for the onset of stable Hes1 and Hes7 oscillations both in vitro and in vivo1,15–17. Indeed, the endogenous 2.5 Kb Hes1 promoter in mouse has been previously characterised and shown to contain binding sites for several transcription factors including, but not limited to, Hes1 itself and Notch IntraCellular Domain (NICD)18. Because of the complexity of disentangling the individual components contributing to the genesis of oscillations in the endogenous setting, here we applied a “build it to understand it” synthetic biology approach19–21 to build simplified ‘hybrid’ versions of the Hes1 ultradian oscillator with both synthetic and natural parts. A synthetic promoter was engineered to prevent interactions with endogenous TFs and to be highly responsive to both an artificial TF (tetracycline-controlled transactivator tTA) and Hes1 itself. By mathematical modelling and single-cell real-time imaging, we were able to demonstrate that Hes1 is indeed able to generate stable oscillations by negative feedback, albeit in a low percentage of cells. Moreover, we demonstrated that introns in Hes1 are not necessary for oscillations to occur, but their deletion mainly affects the overall level of expression of Hes1, in qualitative agreement with a simple mathematical model of the Goodwin oscillator11.

RESULTS AND DISCUSSION Design and characterization of a synthetic Hes1 promoter with AND logic The Notch Intracellular Domain binds the endogenous 2.5 Kb Hes1 promoter in mouse and it is able to activate downstream gene expression only when Hes1 itself is not bound to the promoter22,23. Hence, the response of the endogenous Hes1 promoter to NICD and Hes1 can be abstracted with the Boolean expression: NICD AND NOT(Hes1), as shown in Figure 1A. We engineered a synthetic promoter implementing the same Boolean expression as in Figure 1A but replacing NICD with the artificial transcription factor tTA (tetracycline Trans-Activator). Since there is no easy way to predict a priori the outcome of the synthetic promoter just on the basis of its sequence, we generated three synthetic promoters (Sp1, Sp2 and Sp3 in Fig. 1 B) characterized by three different internal architectures. The promoters contain seven identical Tet operator sequences (TetO), which can be bound by tTA, together with seven identical N-Box motifs, the consensus binding site recognised by Hes1, upstream the CMV minimal promoter. Ideally, as shown in Fig. 1C, in the absence of doxycycline (or its analogue tetracycline) and of Hes1, tTA binds the TetO elements inducing the expression of the downstream gene, thus mimicking the role of NICD. Conversely, either tetracycline treatment or Hes1 prevent gene expression. We cloned 2 ACS Paragon Plus Environment

Page 2 of 18

Page 3 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


each of the synthetic promoters upstream of a reporter protein, as shown in Fig.1C. The reporter sequence consists of the coding sequence of a fast degrading reporter protein consisting of eGFP fused to Ubiquitin (UbV76eGFP)24,25 followed by the mouse Hes1 3’ Untranslated Region (UTR), which confers mRNA destabilization3. We estimated the reporter protein half-life to be 22 min and reporter mRNA half-life to be 18 min, as shown in Figure S1, and thus comparable to those of Hes1 and hence fast enough to track Hes1 protein dynamics3–6. We transfected each one of the three constructs in a mammalian cell-line stably expressing tTA and quantified, by cytofluorimetry, the mean fluorescence of the cell population in the presence and in the absence of Doxycycline (1µg/ml), and following transfection either with Hes1, or an unspecific bacterial transcription factor (LacI), as negative control. LacI is a transcriptional repressor, but it is does not bind the synthetic promoters nor it is known to affect the expression of any mammalian gene. As reported in Figure 1D, Sp1 and Sp3 were strongly activated by tTA in the absence of doxycycline, when compared to Sp2. The three promoters were all strongly repressed following Hes1 transfection, although weak and unspecific repression by LacI was also observed. This unspecific effect was likely caused by the extra metabolic burden associated with LacI protein production from the transfected plasmid. Indeed both Hes1 and LacI are expressed from a strong CMV promoter and transfected in cells, so that each cell will receive more than one copy of the plasmid, thus increasing the use of cellular resources for protein production. As Sp3 showed the best combination of activation by tTA and repression by Hes1, we chose to further characterize this promoter. We thus performed a dose-response curve by co-transfecting the Sp3 upstream of UbV76eGFP reporter (Fig. 2A) with increasing amounts of either Hes1, or LacI as negative control. Promoter activity was evaluated by measuring both reporter mRNA and protein levels, as shown in Fig. 2C. Reporter expression from Sp3 shows a decreasing dose response curve both at the protein and mRNA levels (Fig. 2C), indicating strong repression by Hes1. Some reduction in expression was observed also at high concentration of the negative control transcription factor LacI (Fig. 2C). We then compared the Sp3 promoter with the well-characterised mouse 2.5Kb endogenous Hes1 promoter by performing the same dose-response experiment as done for Sp3. In this case, the mRNA dose-response curve shows a steep decrease, as reported in Fig.2D, albeit expression from the endogenous Hes1 promoter is about 5-fold weaker in comparison to Sp3 (Fig.2D versus Fig.2C). A small decrease in reporter expression is visible at the highest concentration of LacI, albeit less prominent than in the case of the Sp3, probably caused by cellular burden. Indeed, the expression of the reporter protein from synthetic promoter (Fig. 2C) is about 5-fold higher than the one from the endogeneous promoter (Fig. 2D), thus probably excarberating the burden effect in the former. All together our data confirm that the synthetic promoter Sp3 well approximates the desired logic function in Figure 1A and hence it can be used both to monitor endogenous Hes1 oscillations, as well as, for the construction of the Hes1 synthetic oscillator.

Single cell monitoring of endogenous Hes1 oscillations with the synthetic Sp3 promoter. Periodic gene expression of the Hes1 transcription factor has been monitored in mouse progenitor cells thanks to pioneering studies involving the 2.5 Kb Hes1 promoter fragment upstream of a destabilized ubiquitin-fused nuclear luciferase (Ub-NLS-Luc) flanked by the mouse Hes1 5’ UTR and 3’ UTR15,26. Luciferase allows longer exposure times with no photo-toxicity and hence a better signal-to-noise ratio compared to fluorescence-based reporters. In order to validate the ability of the synthetic promotor in tracking endogenous Hes1 oscillations, we thus generated a Tet-Off cell line with genomic integration of the Sp3 promoter upstream of the luciferase reporter (Figure 2E). We performed single-cell bioluminescence imaging of cells following removal of tetracycline. Bioluminescence was measured with a highly sensitive cooled charge-coupled device camera, as 3 ACS Paragon Plus Environment


previously described15,26. In the case of the Sp3 promoter, we monitored a total of 273 cells. For the majority of these cells, a bioluminescence signal could be detected (83%). Cells exhibited either one (36%) or more pulses of expression (6%) with an average period of 4.0 hours (Fig. 2G and Methods). The remaining cells showed a persistent increase in expression followed by a plateau (41%). For comparison, we also generated a cell line with genomic integration of a previously described reporter consisting of the endogenous mouse 2.5Kb Hes1 promoter upstream of luciferase15. As shown in Figure 2F, we monitored 128 cells, but bioluminescence could be detected only in 13% of cells. Expression was steady in 4% of cells. One pulse (4%) or more (5%) of pulses of expression could be detected in the remaining cells, as shown in Fig. 2H, with an average period of 3.8 hours, hence very similar to the one estimated using the synthetic promoter, and in agreement with previous findings 15. On the contrary, the average amplitude of oscillations observed with the endogenous Hes1 promoter was only 31% of the synthetic promoter (Fig. 2G, H and Fig. S3A). Hence, the synthetic promoter can be used in the place of the 2.5 Kb endogenous Hes1 promoter-based reporter system to follow Hes1 dynamics. Indeed, Hes1 is usually expressed at very low levels and consequently oscillations are difficult to detect. The synthetic reporter system overcomes this problem by amplifying the signal thanks to the artificial transactivator (tTA).

Construction, characterization and modelling of the Synthetic Hes1 Oscillator (SHO). The synthetic Hes1 promoter (Sp3) was used as the building block for the construction of a synthetic ultradian Hes1 oscillator (SHO). In particular, we generated a cell-line derived from TetOFF cells stably expressing tTA, in which we genomically integrated two constructs as shown in Fig. 3A: (1) the Sp3 promoter upstream of the mouse Hes1 genomic sequence including 5’ UTR, exons and introns, followed by an Intra-Ribosomal-Entry-Sequence, UbV76eGFP and the mouse Hes1 3’UTR, and (2) the same reporter construct as in Fig. 2E, consisting of the Sp3 promoter upstream of the Ub-NLS-Luc flanked by 5’ and 3’ UTR of the mouse Hes1 gene. In principle, in these cells, Sp3 is activated by tTA driving the expression of the Luciferase reporter protein and Hes1 itself. After a certain delay, caused by the intron splicing, mRNA maturation and protein translation15, Hes1 binds Sp3 itself thus repressing its own expression and that of the reporter, thus causing a full cycle of expression to occur. Once Hes1 is repressed, tTA is able to reactivate transcription from the Sp3 promoter and a new cycle can start. To demonstrate that SHO cells can indeed exhibit periodic oscillations in gene expression, we performed bioluminescence imaging of these cells (Figure 3B). We analysed a total of 419 cells and we could detect a bioluminescence signal in 43% of cells. Of the bioluminescent cells, 18% exhibited at least two cycles of reporter expression with an average period of 4.3 hours (Methods), as shown in Figure 3B. The remaining cells either showed a single pulse of expression (36% of bioluminescent cells) or expression reached a plateau (46% of bioluminescent cells). It may be possible that the periodic oscillations observed in the bioluminescence signals emitted by cells bearing the SHO are driven by cyclic expression of the endogenous Chinese Hamster Hes1 protein expressed by these cells (Figure 2G,H) rather than by the exogenous mouse Hes1 protein expressed by the synthetic circuit. This possibility is unlikely since expression from the endogenous Hes1 promoter is much weaker than from the Sp3 promoter (Figure 2C,D). Mathematical modelling predicts that decreasing the delay in the negative feedback of the synthetic oscillator will reduce the amplitude of the oscillations, or abolish them completely, and shorten the period of oscillations (Figure 4 A-D and Methods). Indeed, these effects have been demonstrated both in vitro, for a synthetic gene circuit (Swinburne, et al., 2008) and in vivo 4 ACS Paragon Plus Environment

Page 4 of 18

Page 5 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Harima, et al., 2013; Takashima et al., 2011) in a mouse model lacking all of, or part of, Hes7 introns. To prove that oscillations observed in cells bearing the SHO are generated by the synthetic circuit itself and not driven by the endogenous Hes1, we built an intron-less version of the synthetic Hes1 oscillator (iSHO), lacking all the three Hes1 introns, as shown in Figure 3C. We then performed bioluminescence imaging of Tet-Off cells with genomic integration of both the iSHO and the luciferase reporter by monitoring a total of 194 cells. We could detect a bioluminescence signal in 32% of cells. A single pulse of expression was observed in 48% of bioluminescence cells, whereas plateau expression was found in 36% of cells. Persistent oscillations were present in 16% of the bioluminescent cells (Figure 3D), but with a strikingly reduced amplitude, which, on average, was equal to 36% of the one observed in cells bearing the SHO with the full Hes1 genomic sequence (Figure 3B,D and Figure S3B). Moreover, the average period of oscillations was 3.6 hours, hence 16% shorter that the 4.3 hours period in SHO cells (Methods). These results are in agreement with the mathematical model and thus demonstrate that the synthetic oscillator is indeed able to autonomously generate oscillations. Had oscillations been driven by the endogenous Hes1, then no major difference between the iSHO and SHO should have been observed, neither in amplitude nor in period. An additional proof would be to knock-out the endogenous Hes1 by CRISPR/Cas9, however we were not able to obtain any positive clones (data not shown). Our results also indicate that the delay caused by introns is not essential for oscillations per-se, which persist despite having a much lower amplitude. In this respect, Hes1 behaves differently from Hes7 where deletion of the three introns causes a total loss of oscillations6 and only partial intron deletion exhibits smaller and faster oscillations in vivo (Harima, et al., 2013). This difference may be caused by the intronic portion of the mouse Hes7 gene (1843 bp out of 2807bp) being almost double than the intronic portion of the mouse Hes1 gene (989 bp out of 2440bp). Hence, the delay conferred by the introns in Hes7 could be larger than in Hes1, leading to a stronger reduction of the total delay following intron removal. It may also be possible that Hes7 expression does oscillate but oscillations become undetectable. Indeed Hes7 expression in Hes7 intronless mice is on average 34% of the wild type6. In this respect, the reduction in expression levels caused by intron loss is similar between Hes1 and Hes7. Last but not least, because a low amount of Hes1 can efficiently repress the natural Hes1 promoter but not the synthetic promoter Sp3 (Fig. 2C,D), it follows that it may take longer to repress the Sp3 promoter than the natural Hes1 promoter. This slower repression may add an extra delay, which could abrogate the necessity of introns in the synthetic delayed negative feedback. From real time live cell imaging experiments, we established that the synthetic oscillator is able to generate pulsatile Hes1 gene expression and that oscillations dynamics resembles those of the endogenous one. Moreover, we found that the mutant introns-less form of the oscillator (iSHO) maintains its ability to generate oscillations but with a smaller amplitude and to lesser extent also with a shorter period. These experimental observations were confirmed by both mathematical modelling and bifurcation analysis, indicating that in presence of a delay, sustained oscillations are generated, but as the delay becomes shorter, oscillations persist but with a lower amplitude and period (Figure 4). However, differently from the in-vivo models, the oscillations we found were variable both in terms of amplitude and period, confirming what was already known in the literature that cell-cell communication has a pivotal role in the stabilization of the Hes1 oscillations15. Our results collected together demonstrate that a delayed negative feedback loop involving only Hes1 self-repression is indeed the driving mechanism of the Hes1 clock and that intronic delay is not essential to get sustained oscillations in Hes1 expression, but only for the generation of larger 5 ACS Paragon Plus Environment


amplitudes. However, this mechanism represents just the core of a more complex clock in which other “gears” such as cell-cell communication must be involved in order for stable oscillations to occur in the majority of the cells in a synchronised manner. Indeed, the synthetic Hes1 oscillator could be coupled to the recently developed synthetic Notch system28 to better understand and recapitulate the role of Notch-Delta signalling in synchronisation of oscillations across cells. Our results together with novel synthetic reporter have implications for other ultradian oscillators, and for synthetic biology approaches to build and monitor genetic clocks.

METHODS Cell culture CHO AA8 Tet-Off® Cell Line (Clontech) was derived from Chinese Hamster Ovary cells carrying a stable genomic integration of the gene encoding for the tetracycline Trans-Activator (tTa) stably expressed by CMV promoter. The CHO AA8 Tet-Off® Cell Line was maintained at 37° C in a 5% CO2 humidified incubator and cultured in 90% Eagle Minimum Essential Medium (alpha modification), supplemented with 10% Tet System Approved Fetal Bovine Serum (FBS) (Euroclone), 1% L-glutammine (Euroclone) and 1% antibiotic/anti-mycotic solution (GIBCO BRL). Molecular cloning The synthesis of the three Hes1 synthetic promoters Sp1, Sp2 and Sp3 was performed by GeneArtTM (ThermoFisher Scientific) in the pMK-RQ backbone. From these plasmids, promoters cassettes containing N-boxes, Tet Operators and CMV minimal promoter were amplified by PCR and the resulting amplicons were inserted into the Zero Blunt® TOPO® PCR Cloning backbone (Invitrogen). The cloned plasmids were transformed by One ShotTM TOP10 Chemically Competent E. coli (Thermofisher Scientific) competent cells. Resulting plasmids were digested by using NotI (NEB) and the fluorescent reporter UbV76eGFP13 with 3’UTR of Hes1 was inserted by In-Fusion® HD Cloning kit (Takara Clontech), in order to obtain the plasmid reported in figure 1C. The cloning reaction were transformed by StellarTM Competent Cells (Takara Clontech). The SHO and iSHO constructs were obtained by In-fusion cloning kit using as backbone the plasmid containing Sp3UbV76eGFP-3’UTR genetic cassette, digested with EcoRV and BglII. Each genetic module needed to obtain SHO and ISHO was amplified by PCR using the right In-fusion tailed primers and inserted downstream Sp3. The genomic sequence of Hes1 (gHes1) spanning from 5’UTR to Stop codon was amplified from mouse kidney and subcloned into the Zero Blunt® TOPO® PCR Cloning. Then, gHes1 was re-amplified by PCR with the right tailed primers for the In-fusion reaction. The construct containing Hes1 gene without introns was obtained in the same way by amplifying the cDNA of Hes1. SHO and iSHO plasmids were transformed using One ShotTM Stbl3TM Chemically Competent E. coli (Thermofisher Scientific). The luminescent reporter used to follow the gene expression dynamics was obtained by using standard cloning methods: the Sp3 plus the 5’UTR of Hes1 was amplified by PCR using tailed primer containing SalI and NcoI restriction sites. The amplicon was digested and inserted by DNA Ligation Kit, Mighty Mix (Takara Clontech) in a vector based on the Tol2 transposon system and containing the Ubiquitin-NLSluciferase plus the 3’UTR of Hes1. The resulting plasmid was transformed in DH5α E. coli chemically competent cells. All PCR reactions were performed by using the Phusion® High-Fidelity DNA Polymerase (NEB) and the sequences were confirmed by Sanger-sequencing by Eurofinsgenomics. Cytofluorimetry and Real-time PCR of transfected cells. 6 ACS Paragon Plus Environment

Page 6 of 18

Page 7 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cells were co-transfected with synthetic promoter and Hes1, LacI or empty plasmid (Table S3) using TransIT-LT1 reagent (Mirus) according to the manufacturer protocol with 1 µg of plasmid DNA in 12-well plate. 24 hours after transfection either in the presence or absence of 1 µg/ml of doxycycline, cells were harvested and re-suspended in 1 ml of PBS solution and they were analysed with a BD Accuri™ C6 Plus (Becton Dickinson) by using the FITC bandpass Filter (488 nm excitation, 525 emission). A total of 20,000 events were recorded and the fluorescence level was calculated as the average of the mean fluorescence of three independent experiments. The threshold used to identify the positive fluorescent cells was set using the fluorescence level of CHO tet-off cell line transfected with the empty vector pCDNA3.1 For the samples indicated by white bars in figure 1D, doxycycline was added just before transfection to the cell culture media at a concentration of 1µg/ml and it was maintained for all the experiment duration. Total RNA extraction was carried out by using Rneasy kit (Quiagen) and the plasmid DNA was removed by enzymatic digestion by using RNase-Free DNase Set (Quiagen) according to the manufacturer's instructions. Then, 350 ng of total RNA was reverse-transcribed into cDNA using QuantiTect Reverse Transcription Kit (Quiagen) with random hexamers oligos primers. The realtime PCR reactions were prepared with SYBR Green PCR Master MIX Kit (Roche), 2 µl of cDNA and the gene specific pair of primers, listed below: •

eGFP fw: ACGACGGCAACTACAAGACC, eGFP Rev: GTCCTCCTTGAAGTCATGC;

•

Hes1 fw: CCCTGCAAGTTGGGCAGCCA, Hes1 Rev: GATGACCGGGCCGCTGTG ;

•

GAPDH Fw: ACCCAGAAGACTGTGGATGG, GGATGCAGGGATGATGTTCT

GAPDH

Rev:

The rt-PCR was performed by Light Cycler 480 (Applied Biosystem).

Stable cell line production. CHO AA8 Tet-Off cells were transfected with Lipofectamine® LTX & PLUS™ with 1 µg of plasmid DNA in 12-well plate according to the manufacturer’s instructions. Selection was performed for three weeks by four iterative cycle of sorting of green fluorescent cells and their successive expansion. On the other hand, the plasmid containing the luminescent reporter was stably integrated by the Tol2 transposon vector system 29 and after one week of hygromycin selection, the mCherry-eGFP double positive cell were selected. Then cells were sorted by using a BD FACS Aria III Cell Sorting System (Becton Dickinson). Real time bioluminescence imaging. 90,000 cells were plated into 35-mm glass-based dishes (ø12-mm glass, IWAKI 3911-035) with 2 ml of alpha-mem complete medium in presence of tetracycline (100 ng/ml) and of D-luciferin solution (100 mM) for 24 hours. Tetracycline was preferred in these experiments in place of doxycycline for its shorter half-life in cell-culture medium, hence allowing a faster activation of the synthetic promoter and reducing the overall duration of the experiments. Just before to start the time lapse experiment the tetracycline was washed by changing medium, whereas the D-luciferin was maintained. Image acquisition was performed by collecting luminescence from the sample by an Olympus microscope with X20 or X40 UPlanApo objective and detected by a cooled CCD camera (iKon-M 934, Andor). The signal-to-noise ratio was increased by 2 x 2 binning and 270 s (4.5 min) exposure time. Images were acquired at 300 s (5 min) intervals. During the experiment 7 ACS Paragon Plus Environment


the temperature was held constant at 37 °C, and the CO2 concentration was set to 5% of the total air volume injected into the incubation chamber. Image processing and time series analysis Images processing was performed by the image analysis software ImageJ. Cosmic ray-induced background noise was removed, and luminescence intensity was measured automatically for each time point and at a single cell level. The single-cell segmentation and tracking was performed by analysing the red fluorescence of the cells which all expressed a nuclear constitutive mCherry. The period analysis was performed by MatLab® (MathworksMatlab R2016b) and local maxima in the time series dataset were found by using findpeaks function. The period of oscillations, if present, was quantified by first computing the auto-correlation of the signal and then finding the peaks of the autocorrelation signal, from which the period was estimated. For each cell, we also monitored cell divisions which cause spurious oscillations in the bioluminescence signal unrelated to Hes1 cyclic expression, we therefore removed from further analysis cells undergoing cell cycle12. Mathematical Modelling. In order to obtain a phenomenological model of the Synthetic Hes1 Oscillator and its intronless version, we considered an ODE model of three equations: the model follows the structure of a Goodwin model with nonlinear degradation term 11,30,31; the delay is not explicit, but three equations are considered in order to simulate the different steps of transcription (Eq. 1), mRNA maturation and splicing (Eq.2) and protein translation (Eq.3). The model is valid for both circuits and it is possible to switch from one to another by changing one parameter ( ). In particular, it has the form: = − + Eq. 1

= −

Eq. 2

= − , + Eq. 3

where the variables , , represent respectively the Hes1 immature mRNA, the spliced Hes1 mRNA, and the Hes1 protein. In brief, Eq. (1) has a nonlinear production term represented by the

Hill function and a linear degradation term − . Parameter T represents the action of

Tetracycline: it is T=0 when Tetracycline is present and T=1 after its removal. Equation (2) has a linear mRNA production term depending on and a linear degradation term (respectively and − ), where is the splicing rate and represents the fraction of mRNA that is degraded. The parameter effectively determines the time constant of , as this is a linear differential equation, and thus it lumps up the time it takes for the mRNA to be spliced and to mature, and hence its value can be used to model the splicing speed. Eq. (3) has a linear production term depending on whose parameter is the protein production rate. Eq. (3) also

contains a nonlinear Hill degradation term − . This nonlinear degradation term is

8 ACS Paragon Plus Environment

Page 8 of 18

Page 9 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


necessary to generate oscillations without an explicit delay 30. Parameters used for simulations are reported in Table (1). The parameter is a key parameter for switching from the SHO to iSHO behavior. The smaller , the slower the mRNA splicing dynamics ( ), leading to an overall increase in the delay in the negative feedback. By using time series simulations and bifurcation analysis (Figure 4), we showed that, varying parameter , large amplitude oscillations (small values of ), or faster and smaller oscillations (larger values of ) can be generated, thus confirming the experimental data. All the simulations have been performed using MATLAB R2015b. ASSOCIATED CONTENT Supporting Information The Supporting Information includes tables with the plasmids and parameters for model fitting as well as supplementary figures that support the results shown in the main text.

AUTHOR INFORMATION Corresponding Authors *E-mail: [email protected] ORCID Diego di Bernardo: 0000-0002-1911-7407 Author Contributions DdB conceived the idea and supervised the research. MS conceived, designed and performed the experiments. DP, FA, BT and LP helped with molecular biology experiments. AI under the supervision of RK helped performing bioluminescence experiments and their analysis. IG performed the mathematical modelling and bifurcation analysis. # DP and AI contributed equally to this work. Notes The authors declare no competing financial interest.

FUNDING SOURCE Marco Santorelli was supported by an EMBO Short Term Fellowship (ASTF 442 – 2016) to spend 3 months in Prof. Kageyama lab. This work was partly funded by a Human Frontier Science Program Grant to DdB (RGP0020/2011) and by Fondazione Telethon.

ACKNOWLEDGMENTS We thank Hiromi Shimojo, Yuki Maeda and Akari Takagi from RK lab and Gennaro Gambardella and Giansimone Perrino from DdB lab for their technical and scientific support.




Page 10 of 18

Page 11 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1)

Hubaud, A.; Regev, I.; Mahadevan, L.; Pourquié, O. Excitable Dynamics and YapDependent Mechanical Cues Drive the Segmentation Clock. Cell 2017, 171 (3), 668– 682.e11.

(2)

Isomura, A.; Kageyama, R. Ultradian Oscillations and Pulses: Coordinating Cellular Responses and Cell Fate Decisions. Development 2014, 141 (19), 3627–3636.

(3)

Hirata, H. Oscillatory Expression of the bHLH Factor Hes1 Regulated by a Negative Feedback Loop. Science (80-. ). 2002, 298 (5594), 840–843.

(4)

Kageyama, R.; Ohtsuka, T.; Kobayashi, T. The Hes Gene Family: Repressors and Oscillators That Orchestrate Embryogenesis. Development 2007, 134 (7), 1243–1251.

(5)

Ohtsuka, T.; Ishibashi, M.; Gradwohl, G.; Nakanishi, S.; Kageyama, R. Hes1 and Hes5 as Notch Effectors in Mammalian Neuronal Differentiation. 1999, 18 (8), 2196–2207.

(6)

Takashima, Y.; Ohtsuka, T.; González, A.; Miyachi, H.; Kageyama, R. Intronic Delay Is Essential for Oscillatory Expression in the Segmentation Clock. Proc. Natl. Acad. Sci. U. S. A. 2011, 108 (8), 3300–3305.

(7)

Bessho, Y.; Hirata, H.; Masamizu, Y.; Kageyama, R. Periodic Repression by the bHLH Factor Hes7 Is an Essential Mechanism for the Somite Segmentation Clock. Genes Dev. 2003, 17 (12), 1451–1456.

(8)

Takebayashi, K.; Saaai, Y.; Sakai, Y.; Watanabe, T.; Nakanishi, S.; Kageyama, R. Structure, Chromosomal Locus, and Promoter Analysis of the Gene Encoding the Mouse Helix-LoopHelix Factor HES-1: Negative Autoregulation through the Multiple N Box Elements. J. Biol. Chem. 1994, 269 (7), 5150–5156.

(9)

Kobayashi, T.; Kageyama, R. Hes1 Oscillations Contribute to Heterogeneous Differentiation Responses in Embryonic Stem Cells. 2011, No. Icm, 219–228.

(10)

Goodwin, B. C. Oscillatory Behavior in Enzymatic Control Processes. Adv. Enzyme Regul. 1965, 3, 425–428.

(11)

Purcell, O.; Savery, N. J.; Grierson, C. S.; di Bernardo, M. A Comparative Analysis of Synthetic Genetic Oscillators. J. R. Soc. Interface 2010, 7 (52), 1503–1524.

(12)

Swinburne, I. a; Miguez, D. G.; Landgraf, D.; Silver, P. a. Intron Length Increases Oscillatory Periods of Gene Expression in Animal Cells Email Alerting Service Intron Length Increases Oscillatory Periods of Gene Expression in Animal Cells. Genes Dev. 2008, 2342–2346.

(13)

Tigges, M.; Marquez-Lago, T. T.; Stelling, J.; Fussenegger, M. A Tunable Synthetic Mammalian Oscillator. Nature 2009, 457 (7227), 309–312.

(14)

Hirata, H.; Bessho, Y.; Kokubu, H.; Masamizu, Y.; Yamada, S.; Lewis, J.; Kageyama, R. Instability of Hes7 Protein Is Crucial for the Somite Segmentation Clock. Nat. Genet. 2004, 36 (7), 750–754.

(15)

Masamizu, Y.; Ohtsuka, T.; Takashima, Y.; Nagahara, H.; Takenaka, Y.; Yoshikawa, K.; Okamura, H.; Kageyama, R. Real-Time Imaging of the Somite Segmentation Clock: Revelation of Unstable Oscillators in the Individual Presomitic Mesoderm Cells. Proc Natl Acad Sci U S A 2006, 103 (5), 1313–1318.

(16)

Shimojo, H.; Kageyama, R. Oscillatory Control of Delta-like1 in Somitogenesis and Neurogenesis : A Unified Model for Different Oscillatory Dynamics. Semin. Cell Dev. Biol. 2016, 49, 76–82.

(17)

Nakayama, K.; Satoh, T. FGF Induces Oscillations of Hes1 Expression and Ras / ERK Activation. 18 (8), 332–334. 11 ACS Paragon Plus Environment


(18)

Lemke, U.; Krones-Herzig, A.; Diaz, M. B.; Narvekar, P.; Ziegler, A.; Vegiopoulos, A.; Cato, A. C. B.; Bohl, S.; Klingmüller, U.; Screaton, R. A.; et al. The Glucocorticoid Receptor Controls Hepatic Dyslipidemia through Hes1. Cell Metab. 2008, 8 (3), 212–223.

(19)

Slusarczyk, A. L.; Weiss, R. Understanding Signaling Dynamics through Synthesis. Sci. Signal. 2012, 5 (220), pe16.

(20)

Oudenaarden, S. M. and A. van. Synthetic Biology: Understanding Biological Design from Synthetic Circuits. Nat. Rev. Genet. 2009, 10 (12), 859–871.

(21)

Davies, J. Using Synthetic Biology to Explore Principles of Development. 2017, 1146–1158.

(22)

Jarriault, S.; Brou, C.; Logeat, F.; Schroeter, E. H.; Kopan, R.; Israel, A. Signalling Downstream of Activated Mammalian Notch. Nature. 1995, pp 355–358.

(23)

Types, M. C. The bHLH Gene Hes1 Regulates Differentiation of Multiple Cell Types. 2000, 10 (I), 1–7.

(24)

Stricker, J.; Cookson, S.; Bennett, M. R.; Mather, W. H.; Tsimring, L. S.; Hasty, J. A Fast , Robust and Tunable Synthetic Gene Oscillator. 2008, 456 (November).

(25)

Salomons, F. A.; Lisette, G. G.; Dantumal, N. P. Fluorescent Reporters for the UbiquitinProteasome System. Essays Biochem. 2005, No. 41, 113–128.

(26)

Isomura, A.; Ogushi, F.; Kori, H.; Kageyama, R. Optogenetic Perturbation and Bioluminescence Imaging to Analyze Cell-to-Cell Transfer of Oscillatory Information. Genes Dev. 2017, 31 (5), 524–535.

(27)

Harima, Y.; Takashima, Y.; Ueda, Y.; Ohtsuka, T.; Kageyama, R. Accelerating the Tempo of the Segmentation Clock by Reducing the Number of Introns in the Hes7 Gene. Cell Rep. 2013, 3 (1), 1–7.

(28)

Morsut, L.; Roybal, K. T.; Xiong, X.; Gordley, R. M.; Coyle, S. M.; Thomson, M.; Lim, W. A. Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors. Cell 2016, 164 (4), 780–791.

(29)

Kawakami, K. Tol2 : A Versatile Gene Transfer Vector in Vertebrates. 2007, 8 (Suppl 1), 1– 10.

(30)

Bliss, R. D.; Painter, P. R.; Marr, A. G. Role of Feedback Inhibition in Stabilizing the Classical Operon. J. Theor. Biol. 1982, 97 (2), 177–193.

(31)

Goodwin B.C. Temporal Organization in Cells. In Academic Press; 1965; Vol. 27, pp 497– 500.


Page 12 of 18

Page 13 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Synthetic promoters’ architecture, validation and quantitative characterization (A)

Boolean logic representation of the endogenous Hes1 promoter in response to NICD and Hes1.

(B)

Schematic representation of the three synthetic promoters (Sp1, Sp2, Sp3) and their internal architecture: the blue boxes are the Tet operators (TetO) recognized by the tetracycline TransActivator (tTA), the gray boxes are the DNA binding site recognized by HES1 (N-box), the white arrow is the CMV minimal promoter.

(C)

Experimental design to evaluate the response of the three Hes1 synthetic promoters to tTA and HES1. The gene expression read out is monitored thanks to a destabilized fluorescent reporter (UbV76eGFP)

(D)

Barplot of gene expression (mean fluorescence) from three synthetic promoters transfected in Chinese Hamster Ovary cells constitutively expressing the tTA trans-activator (CHO AA8 TetOff®). Plotted data are mean values of three independent biological replicates. Error bars represent one standard deviation. White bars represent basal transcription activity of each promoter obtained by measuring fluorescence of cells transfected for 24 hrs with the indicated synthetic promoter in the presence of doxycycline (1µg/ml), which inactivates the constitutively expressed tTA. Blue bars represent the maximal transcriptional activity of cells transfected for 24 hrs with the indicated synthetic promoter, in the absence of doxycycline. Gray bars represent the maximal repression level in cells transfected for 24 hrs with the indicated synthetic promoter and 170 ng of plasmid expressing Hes1 under the CMV promoter in absence of doxycycline. Black bars are negative controls representing the repression level in cells transfected for 24 hrs with the indicated synthetic promoter and 170 ng of plasmid expressing the non-specific Lac-I under the CMV promoter in absence of doxycycline.




Page 14 of 18

Page 15 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Comparative analysis between the Hes1 Synthetic Promoter 3 (Sp3) and the Hes1 Natural promoter (pHes1) (A,B)

Schematic representation of the Hes1 reporter constructs. The destabilized fluorescent (UbV76eGFP) with 3’UTR of Hes1 gene was cloned under the control of: (A) the Hes1 Synthetic promoter 3 (Sp3) and (B) the endogenous 2,5Kb mouse Hes1 promoter.

(C,D)

Dose response curve of Sp3 (C) and of the natural Hes1 promoter (D) in CHO AA8 TetOff® in presence of increasing amount of transfected plasmid expressing either Hes1 or Lac-I (negative control) under the CMV promoter. Upper panels: Mean Fluorescence (yaxis) was quantified 24 hrs following transfection by cytofluorimetry. Nanograms of transfected plasmid (x-axis) containing either Hes1 or Lac-I under the CMV promoter were quantified by spectrophotometry (NanoDrop ThermoFisher). Lower panels: the relative expression of Hes1 (x-axis) and UbV76eGFP (y-axis) against the Gapdh house-keeping gene were quantified by real-time quantitative PCR and expressed in 2-∆CTunits, according to standard practice. Plotted data are the mean values of three independent biological replicates. Error bars represent standard deviations.

(E,F)

Schematic representation of the destabilized luminescent reporters (Ub-NLS-Luc) with 5’UTR and 3’UTR of Hes1 gene under the control of: (E) the Hes1 Synthetic promoter 3 (Sp3) (F) the natural Hes1 promoter.

(G,H)

Single cell analysis of luminescent signal in CHO AA8 Tet-Off® cells stably expressing the reporter gene from: (G) the Hes1 Synthetic promoter 3 (Sp3) (n=273) and (H) the Natural Hes1 promoter (n=128). Single cell quantification (left side) of the bioluminescence images (right side) of two single cells for each promoter are shown. Cells were grown in presence of tetracycline (100 ng/ml) and of D-luciferin solution (100 mM) for 24 hours. Tetracycline was washed out at the beginning of the experiment. The exposure time to detect bioluminescence was 270 s and images were acquired at 300 s intervals.



Figure 3. Single cell analysis of the of the bioluminescence time lapse imaging of the Synthetic Hes1 Oscillator and its mutant form. (A,C)

Schematic representation of the two synthetic oscillators. (A) SHO: the Synthetic Hes1 Oscillator harboring the full mouse Hes1 genomic sequence (introns and exons) downstream of the Sp3 . (C) iSHO: the mutant form of the oscillator lacking Hes1 introns and retaining only the coding sequence. Each cell line contains a reporter gene, expressing the destabilized luminescent reporter (Ub-NLS-Luc) with 5’UTR and 3’UTR of Hes1 gene, under the control of Sp3.

(B,D)

Single cell analysis of luminescent signal in CHO AA8 Tet-Off® cells stable expressing the: (B) Synthetic Hes1 Oscillator (SHO) (n= 419) and (D) the intronless Synthetic Hes1 Oscillator (iSHO) (n= 194). Single cell quantification (left side) of the bioluminescence images (right side) of two single cells for each oscillator are shown. Cells were grown in presence of tetracycline (100 ng/ml) and of D-luciferin solution (100 mM) for 24 hours. Tetracycline was washed out at the beginning of the experiment. The exposure time to detect bioluminescence was 270 s and images were acquired at 300 s intervals.


Page 16 of 18

Page 17 of 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Mathematical simulation and bifurcation analysis of a Goodwin oscillator model of the Synthetic Hes1 oscillator. (A)

Bifurcation analysis of the splicing speed ( ) on the x-axis versus the amount of HES1 protein ( ) on the y-axis for the nonlinear ordinary differential equation model in Eqs. (13) in the Methods. Bifurcation points are indicated: HB represent an Hopf Bifurcation point, the red line represents stable equilibria, the black line represents unstable equilibria, green dots represent the stable limit cycle, blue dots represent the unstable limit cycle.

(B) Changes in period and amplitude of HES1 protein oscillations when varying the splicing speed ( ). (C)

Mathematical simulation of the HES1 protein from the model in Eqs (1-3) with a splicing speed = 0.01 corresponding to the blue dots in panel B.

(D)

Mathematical simulation of the HES1 protein from the model in Eqs. (1-3) with a faster splicing rate = 0.035 corresponding to the red dots in panel B.



For Table of Contents Use Only - Reconstitution of an ultradian oscillator in mammalian cells by a synthetic biology approach - Santorelli et al. 82x44mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 18 of 18

Reconstitution of an Ultradian Oscillator in ... - ACS Publications

Recommend Documents