Red Light Triggered Fluorogenic Reaction with ... - ACS Publications

Jun 13, 2019 - We suggested the solution of the problem which includes a combination of a cleavable (9-alkoxyanthracene) moiety with a two-electron ...
0 downloads 0 Views 2MB Size
Download PDF
Article Cite This: Bioconjugate Chem. 2019, 30, 2023−2031

pubs.acs.org/bc

Red Light Triggered Fluorogenic Reaction with Picomolar Sensitivity Toward Nucleic Acids Oleksii Zozulia,†,# Tobias Bachmann,† and Andriy Mokhir*,† †

Friedrich-Alexander University Erlangen-Nürnberg (FAU), Department of Chemistry and Pharmacy, Organic Chemistry Chair II, Nikolaus-Fiebiger-Strasse 10, 91058 Erlangen, Germany

Downloaded via BUFFALO STATE on July 18, 2019 at 04:22:30 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

S Supporting Information *

ABSTRACT: We have previously reported on a red light triggered, singlet oxygen-mediated fluorogenic reaction that is templated in a highly sequence specific fashion by nucleic acids (S. Dutta, A. Fulop, A. Mokhir, Bioconjgate Chem. 2013, 24 (9), 1533−1542). Up to the present date, it has remained a single templated reaction responsive to nontoxic >650 nm light. However, it is operative only in the presence of relatively high (>2 nM) concentrations of templates that dramatically limit its applicability in nucleic acid detection. In the current work, we established that an inefficient intermolecular electron transfer involved in reduction of the 1,4-endoperoxide intermediate, formed in the rate-limiting reaction step, is responsible for inhibition of the reaction at low reagent concentrations. We suggested the solution of the problem which includes a combination of a cleavable (9-alkoxyanthracene) moiety with a twoelectron donating fragment in one molecule. This approach enables the efficient intramolecular electron transfer to the endoperoxide intermediate in the critical reaction step. Due to the intramolecular character of the latter process, it is practically independent of concentration of the reagents. The reaction based on the improved cleavable moiety was found to be >200-fold more sensitive than the previously reported one. It is fast, sequence specific, and compatible with live cells. Accounting for short reactions times (600 nm light.32−45 We have confirmed that this chemistry is compatible with live cells34,40 and used it to design “caged” siRNAs,34 miRNAs,32 and antisense agents44,45 as well as to develop methods of detection of nucleic acids in cell free settings35,46 and in cells.40 In one of our best systems (Scheme 1),35 a substrate L-F consisting of an 1 O2-sensitive 9,10-dialkoxyanthracene moiety (L) covalently

INTRODUCTION Photocleavable chemical moieties are used to design deactivated (“caged”) compounds including drugs, ions, biomolecules, fluorophores, and others.1−3 These compounds can be activated at the desired time and location by light that allows accurate temporal and spatial control and monitoring of biochemical processes in live cells. The majority of known photocleavable fragments are responsive to either UV or short wavelength (600 nm light sensitive groups have been recently introduced including derivatives of cyanines,7−9 phthalocyanines,10 BODIPY dyes,11 vitamin B12 analogues,12−14 and other dyes.15 The long-wavelength light is especially well suited for cellular applications due to its negligible toxicity.4−6 A higher level of spatial control can be achieved for “caged” compounds, which are activated only in the presence of a specific biomolecule (template), e.g., in photochemical templated reactions.16,17 The most common templates are nucleic acids (NAs = single stranded RNAs (ssRNAs)18 or double stranded DNAs (dsDNAs)19,20) as well as proteins/ receptors with closely positioned binding sites for two different ligands.21,22 Four types of visible light - responsive NAtemplated reactions have been reported up to the present date. In particular, Winssinger and co-workers have developed reduction of either arylazides23−25 or N-alkylpyridinium26,27 substrates in the presence of a Ru(phen)(bpy)2 complex and a reducing agent such as ascorbate salts upon irradiation with 455 © 2019 American Chemical Society

Received: April 25, 2019 Revised: June 13, 2019 Published: June 13, 2019 2023

DOI: 10.1021/acs.bioconjchem.9b00299 Bioconjugate Chem. 2019, 30, 2023−2031

Article

Bioconjugate Chemistry Scheme 1. A: Red Light Triggered, NA-Templated Reaction Reported Elsewhere;35a B: Mechanism of 1O2-Mediated Cleavage of Linker Lb

Scheme 2. Structures of the Substratesa and Photocatalystsb as Well as Sequences of ONs and a Nucleic Acid Template NA. Inset A: Structures of Dye-Containing Moieties TTMR/ FAM and Sequences of ONs and an NA Template

TC − ternary complex: F-L∼ON1/ON2∼P/NA where P = a photosensitizer (In(pyropheophorbide-a)chloride), F = a fluorescent dye (either TTMR or FAM, Scheme 2); the color intensity of the F dye in this scheme corresponds to the level of its fluorescence: strongly fluorescent (red •) that corresponds to free fluorophores obtained as products of the reaction; intermediately fluorescent (pink •) that corresponds to fluorophores in single stranded substrates F-L-ON1 (a partial quenching is observed due to proximity of aromatic linker L and nucleobases of ON1), weakly fluorescent (pale pink •) that corresponds to fluorophores in the TC (the additional quenching occurs due to proximity of photosensitizer P). bIntermediates, whose formation was not experimentally confirmed, are given in square brackets.

F−L∼ON, F−L2S∼ON, and F−LCH∼ON, where F = TTMR or FAM and deoxyoligonucleotides ON = ON1 or ON1a. bON2∼P, ON2a∼P.

a

a

dialkoxyanthracene L. 1O2 does not diffuse far away from the site of its generation due to its short lifetime47,48 and, therefore, is not toxic.34,35 Unfortunately, reactions of the latter type are fully inhibited at concentrations of the NA-templates below 2 nM.35 The reasons for this are not obvious, since intermediate TC’s, which usually consist of >15-mer ONs and >30-mer templates, are stable even at 95% purity. A corresponding 2-isomer could be isolated at ∼75% purity with the 3-isomer as an impurity. By using 1H NMR spectroscopy we observed that both isomers react with photochemically generated 1O2 with similar efficiency (Figure S16). Therefore, we decided to continue the synthesis with the mixture of 5a and 5b. These compounds were successfully converted to the mixture of phosphoramidites 7a and 7b in several standard steps (Scheme 3 and SI). Synthesis of DNA Conjugates. Synthetic protocols for preparation of the conjugates F-L2S∼ON and F-LCH∼ON, where F = TTMR or FAM and ON = ON1 or ON1a, as well as their characterization data are provided in the Supporting Information (SI). Catalysts ON∼P, where ON = ON2 or ON2a, were prepared as described previously.35 The new conjugates were identified by MALDI-TOF mass spectrometry and their purity was confirmed by analytical HPLC to be over 90% (Figures S17−S42). Kinetics of Templated Reactions. In agreement with our expectations, we observed that rates of NA-templated photochemical reactions with both substrates TTMR-L2S∼ON1 and TTMR-LCH∼ON1 catalyzed by ON2∼P were practically independent from the external reducing agent GSH (Figure 2A,C). Importantly, substrate conversions exceeded 80%. The same was the case for the reaction with substrate TTMR-L2S∼ON1 (Figure 2A), whereas the templated reaction with substrate FAM-L2S∼ON1 was stalled at 3-fold higher than that of the background reaction, is 10 pM (Figure S50). We suppose that the calculated sensitivity cannot be achieved due to decreasing the concentration of the ternary complex TTMR-LCH-ON1/ON2P/T1 at [T1] < 10 pM leading to inhibition of the templated reaction. Next, we confirmed that this templated reaction with shorter substrate (12-mer)/quencher (10-mer) and catalyst (11-mer)/ quencher (10-mer) duplexes is highly sequence specific. In particular, it is sensitive to even single nucleotide mismatches in nucleic acid templates as shown in Figure 3D. Compatibility of the Developed Reaction with Live Cells. To test whether the reported reaction is suitable for detection of nucleic acids in live cells, we prepared 2′-OMe RNA analogues of the substrate FAM-LCH∼ON1 and the catalyst ON2∼P as described in the SI (Figure S43 - S48). Analogously to ONs, 2′-OMe RNAs bind to complementary NA strongly and sequence specifically. However, in contrast to ONs, 2′-OMe RNAs are more resistant to intracellular nucleases and, therefore, are more applicable for cellular assays. Since fluorescent dyes (especially FAM) are known to be efficiently transported out of the cells, we included two additional 2′-OMeuridine nucleotides at the 5′-terminus of the substrate to obtain UU∼FAM-LCH∼2′-OMe RNA1. The product released from this substrate in the templated reaction was expected to remain in cells due to its overall negative charge. Furthermore, we selected the FAM-derivative over the TTMR-one, due to purely technical reasons: the flow cytometer available to our group has the excitation source (λmax = 488 nm), which is better suitable for the excitation of the FAM dye. We confirmed that in cell free settings the 2′-OMe RNA-based substrate and the catalyst behave similarly to their ON analogues under the conditions of the photochemical templated reaction (Figure 4B). Next, we explored the compatibility of this reaction with live cells. In

Figure 3. Improvement the signal-to-noise ratio of the templated reaction. A: Monitoring the release of TTMR dye upon irradiation of the mixture of TTMR-LCH-ON1 (100 nM), ON3∼Q (1 equiv), ON2-P (1 equiv), and Q-ON4 (1 equiv) with red light either in the presence (+NA) or in the absence (-NA) of a fully matched template NA (1 equiv). The reaction was conducted either in the absence (black colored traces) or in the presence of GSH (red colored traces). B: Same as A, except that TTMR-LCH-ON1 was replaced with FAM-LCH-ON1 and the release of FAM dye was monitored. C: Same as A, except that an NA concentration was varied between 0 and 100 pM as shown on the plot. D: Monitoring the release of FAM dye upon irradiation of the mixture of FAM-LCH-ON1a (100 nM), ON3a∼Q (1 equiv), ON2a-P (1 equiv), and Q-ON4a (1 equiv) with red light in the presence of either fully matched template (NA, labeled 5 on the plot) or templates containing single mutations at the 16th position (counting from the 3′terminus): A16→G16 (4), A16→C16 (3), A16→T16 (2) or in the absence of any template (1). Other conditions are provided in caption to Figure 1.

Q∼ON4, where Q is a quencher moiety based on a 1,4-diamino9,10-anthraquinone chromophore. In preliminary studies, we confirmed that Q is an efficient quencher of both photocatalyst P and reporter dyes F (F = FAM and TTMR, Figure S42) and is stable under the conditions of the photochemical templated reaction. In agreement with these data, we observed that the fluorescence of mixtures of F-LCH∼ON1/ON3∼Q (F = FAM and TTMR) and ON2∼P/Q∼ON4 was substantially reduced with respect to the single stranded counterparts (Figure 3A,B). Since ON3 and ON4 were selected to be 15-mer sequences, whereas ON1 and ON2 are 21-mers, we expected that ON3∼Q and Q∼ON4 will be displaced in the presence of the NA (42mer) leading to formation of the TC. Indeed, we observed that the NA addition to mixtures of F-LCH∼ON1/ON3∼Q (F = FAM and TTMR) and ON2∼P/Q∼ON4 leads to a slight fluorescence increase that confirms the latter expectations (Figure 3A,B). This effect is saturated after 30 min of incubation indicating that the replacement of quencher∼oligonucleotides 2027

DOI: 10.1021/acs.bioconjchem.9b00299 Bioconjugate Chem. 2019, 30, 2023−2031

Bioconjugate Chemistry

■

Article

CONCLUSIONS

In summary, we confirmed that the inhibition of the previously reported red light triggered fluorogenic templated reaction at concentrations of the reagents below 2 nM is caused by inefficient reduction of the endoperoxide intermediate in ratelimiting reactions of electron transfer from external reductants. We suggested the solution of this problem and confirmed experimentally its validity. Our solution includes combining in one substrate a 1O2-sensitive anthracene-based linker with electron-donating moieties able to deliver 2 electrons. In this case, the intramolecular electron transfer to the endoperoxide intermediate occurs during the templated reaction, which is a much more efficient and quick process than the alternative intermolecular electron transfer from external reductants. The templated reactions based on these improved substrates exhibited exceptionally high sensitivity in detection of nucleic acids (detection limit of 10 pM using conventional fluorescence spectrophotometers, which corresponds to >200-fold improvement over previously reported reaction35), excellent sequence specificity (it is sensitive to single nucleotide mismatches in nucleic acid templates), and was found to be compatible with live cells. The latter performance could be achieved in less than 30 min reaction time. If we account for short reactions times, nontoxic trigger (red light), excellent sensitivity, and sequence specificity, this is currently the best reported photochemical templated reaction compatible with live cells.

Figure 4. A: Structure of a substrate 5′-UU-FAM-LCH∼2′-OMe RNA1 (2′-OMe RNA1 sequence: 3′-ACCGUGGGUCGUGUUACUUCU) used for the red light triggered NA-templated reaction in live HeLa cells. 2′-OMe RNA2∼P was used as a catalystan analogue of ON2∼P (Scheme 2); 2′-OMe RNA2 sequence: 3′-AGUUCUAGUAACGAGGAGGAC. Scrambled catalyst: 2′-OMe RNA(scr)∼P (2′-OMe RNA sequence: GGAUUAAUGAGUAGCUUAGAA). B: Monitoring FAM release in the mixture of UU∼FAM-LCH∼2′-OMe RNA1 (100 nM) and 2′-OMe RNA2∼P (1 equiv) in the presence of NA (+NA) or without it (-NA). The mixtures were exposed to red light. Other conditions are indicated in caption to Figure 1. C: Mean fluorescence of human cervical carcinoma HeLa cells (expressed in arbitrary units = a.u.). The cells were loaded either with reagents 5′-UU-FAM-LCH∼2′OMe RNA1 and RNA2∼P (complementary to the β-actin mRNA; indicated “match” on the plot) or with 5′-UU-FAM-LCH∼2′-OMe RNA1 and 2′-OMe RNA(scr)∼P (the latter conjugate is not complementary to the β-actin mRNA; indicated “scr” on the plot) or without any 2′-OMe RNA (indicated “cells” on the plot). The cells loaded in this way were either kept in the dark (patterned bars) or irradiated with red light (LED array, λ = 650 nm, 0.29 W) for 60 min (solid bars).

■

MATERIALS AND METHODS Commercially available chemicals of the best quality were obtained from Aldrich/Sigma/Fluka (Germany) and used without additional purification. Standard phosphoramidites and solid supports for DNA and 2′-OMe RNA solid phase synthesis were obtained from Aldrich (Germany), 5′-DMTdA(Bz) synthesis columns (1000 Å, 1 μmol scale) from Biosearch Technologies (USA), and universal SynBase CPG from Link Technologies, UK. Oligonucleotides and 2′-OMe RNAs were synthesized using K&A H-8 DNA/RNA synthesizer. 1 H and 13C NMR spectra were measured on a Bruker Avance 300. MALDI-TOF mass spectra were recorded on a Shimadzu Axima mass spectrometer. The matrix mixture (2:1 v/v) was prepared from 2′,4′,6′-trihydroxyacetophenone (THAP, 0.3 M solution in acetonitrile) and diammonium citrate (0.1 M in water). Samples for mass spectrometry were prepared by the dried droplet method using a 1:2 probe/matrix ratio. Mass accuracy with external calibration was 0.1% of the peak mass, which is ±9.0 at m/z 9000. HPLC was performed at 22 °C on a Shimadzu liquid chromatograph equipped with UV−visible (diode array) and fluorescence detectors and a Macherey− Nagel Nucleosil C18 250 × 4.6 mm column. Gradients of solution B (CH3CN) in solution A (0.1 M aqueous (NEt3H)(OAc)) were applied to purify conjugates. UV/vis spectra of DNA and 2′-OMe RNA conjugates were measured on a Lambda Bio+ UV/vis spectrophotometer (PerkinElmer) by using microcuvettes with a sample volume of 100 μL (BRAND GmbH, Germany). Fluorescence spectra were acquired on a Varian Cary Eclipse fluorescence spectrophotometer and on the Horiba FluoroMax 4 spectrometer using fluorescence cuvettes (Hellma GmbH, Germany) with a sample volume of 1 mL. Irradiation experiments were performed with a LED Array 672 (λ = 650 nm) from Cetoni GmbH (Germany). Protocols for synthesis of building blocks (previously unknown phosphoramidites 3, 7a/7b, and other known

particular, first, we loaded human cervical cancer cells HeLa with either a mixture of UU∼FAM-LCH∼2′-OMe RNA1, 2′-OMe RNA2∼P, and Lipofectamine 3000 as a transfection agent (indicated “match” on the plot in Figure 4C) or a mixture of UU∼FAM-LCH∼2′-OMe RNA1, 2′-OMe RNA(scr)∼P, and Lipofectamine 3000 (indicated “scr”) or only Lipofectamine 3000 (indicated “cells”). Reagents in the “match” mixture were complementary to the part of a β-actin mRNA sequence and were expected to form the TC in cells (Scheme 1). In contrast, the sequence of 2′-OMe RNA(scr)∼P in the “scr” mixture was not complementary to the template and formation of the TC was not possible in this case. After an incubation time of 4 h, the cells were thoroughly washed, followed by their irradiation with red light (LED) for 60 min. Finally, fluorescence of the cells corresponding to the FAM dye was quantified by flow cytometry. We were pleased to observe that the “match” mixture generated the strongest, red-light-induced increase of the FAM-fluorescence, whereas no increase was obtained for the cells loaded with the mismatched probes or cells loaded only with the transfection agent (Figure 4C). 2028

DOI: 10.1021/acs.bioconjchem.9b00299 Bioconjugate Chem. 2019, 30, 2023−2031

Article

Bioconjugate Chemistry

assembled by standard solid phase synthesis to obtain the desired protected conjugated bound to the solid support. Synthesis of 5′- and 3′-Modified 2′-OMe RNA Conjugates. Terminally modified 2′-OMe RNA conjugates were prepared similarly to analogous DNA conjugates except that universal SynBaseTM CPG from Link Technologies (UK) was applied in place of CPGs for DNA synthesis (s11, Scheme S5) and DNA phosphoramidites were replaced with the corresponding commercially available 2′-OMe RNA phosphoramidites. The coupling times of the latter building blocks were extended to 15 min. Cleavage from the Solid Support and Deprotection of Modified DNAs and 2′-OMe RNAs. After the synthesis of protected and CPG-bound DNA and 2′-OMe RNA conjugates (as described above), they were deprotected, cleaved from the solid support, and purified by HPLC. The deprotection and cleavage were conducted usually by treatment of the prepared conjugates with aqueous ammonia solution (27%, v/v) at 55 °C for 2 h. For TTMR- and Q-containing conjugates, the ammonia solution was replaced with a mixture of tert-butylamine/water/ methanol (1/2/1, v/v/v) and the reaction was conducted at 60 °C for 16 h. After the deprotection and cleavage, the CPG was removed and the remaining solution was diluted with water (1/ 10), lyophilized, redissolved in water, and the resulting solutions were purified by HPLC using the following gradients of solution B (CH3CN) in solution A (0.1 M aqueous (NEt3H)(OAc)): gradient 1 − for 2 min 0% solution B, in 32 min from 0 to 40% solution B; gradient 2 − in 32 min from 0 to 45% solution B, for 10 min 90% solution B, in 10 min from 90 to 0% solution B; gradient 3 − from 0 to 1 min 20% solution B, in 32 min from 20 to 70% solution B, for 10 min 90% solution B, in 10 min from 90 to 0% solution B. After the purification, identification of new DNAs and 2′-OMe RNAs was performed by MALDI-TOF mass spectrometry and finally the purity of the obtained conjugates was confirmed with analytical HPLC (Figures S17−S48). Characterization Data for New Conjugates. FAM-LON1. Yield: 38%, HPLC (Nucleosil C18 column; gradient 1) Rt = 21.5 min; MALDI-TOF MS, negative mode, calculated for C252H305N72O145P22 ([M-H]−): 7344, found m/z 7348. TTMR-L-ON1. Yield: 75%, HPLC (Nucleosil C18 column; gradient 2) Rt = 26.0 min; MALDI-TOF MS, negative mode, calculated for C268H328N77O148P22 ([M-H]−): 7677, found m/z 7678. FAM-L2S-ON1. Yield: 30%, HPLC (Nucleosil C18 column; gradient 2) Rt = 24.8 min; MALDI-TOF MS, negative mode, calculated for C258H317N72O145P22S2 ([M-H]−): 7492, found m/ z 7499. TTMR-L2S-ON1. Yield: 72%, HPLC (Nucleosil C18 column; gradient 1) Rt = 21.2 min; MALDI-TOF MS, negative mode, calculated for C274H340N77O148P22S2 ([M-H]−): 7826, found m/ z 7825. FAM-LCH-ON1. Yield: 64%, HPLC (Nucleosil C18 column; gradient 1) Rt = 22.8 min; MALDI-TOF MS, negative mode, calculated for C252H305N72O144P22 ([M-H]−): 7328, found m/z 7333. TTMR-LCH-ON1. Yield: 23%, HPLC (Nucleosil C18 column; gradient 1) Rt = 25.8 min; MALDI-TOF MS, negative mode, calculated for C258H328N77O147P22 ([M-H]−): 7661, found m/z 7663. FAM-LCH-ON1a. Yield: 40%, HPLC (Nucleosil C18 column; gradient 1) Rt = 28.2 min; MALDI-TOF MS, negative mode, calculated for C164H195N37O89P13 ([M-H]−): 4511, found m/z 4513.

reagents) used for preparation of substrates and catalysts for the templated reaction are provided in the Supporting Information (SI, pages S2−S18). Synthesis of Terminally Modified DNAs and 2′-OMe RNAs. DNAs were prepared by the standard solid phase synthesis using commercially available DNA monomer phosphoramidites (dA-Bz, dC-Bz, dG-dmf, dT; Aldrich, Germany) and controlled pore glass (CPG) solid supports, which carry one of the protected nucleosides according to the manufacturer’s recommendations (Scheme S5). In all cases, ∼30−33 mg of CPG containing on its surface ∼1 μmol of a protected nucleoside was used as a starting material. 2′-OMe RNA analogues were prepared similarly, except that universal SynBaseTM CPG (Link Technologies, UK) was used as a solid support and 2′-OMe RNA phosphoramidites (2′-OMe-Bz-A, 2′-OMe-Bz-C, 2′-OMe-dmf-G, 2′-OMe-U; Link Technologies, UK) were used as building blocks. Introduction of 5′-Terminal Modifiers to DNAs. First, a CPG-bound DNA strand s12 was prepared by using solid phase synthesis starting from solid support s11 (Scheme S5). Next, a corresponding phosphoramidite (3, 7a/7b (Scheme 3), s7 or s9 (Scheme S3)) was dissolved in anhydrous CH3CN (final concentration 0.15 M volume 0.2 mL). Just before coupling the solution of 4,5-dicyanoimidazole (DCI, 0.1 mL of 0.25 M solution in CH3CN) was added and the resulting mixture was added to the corresponding CPG-bound DNA strand s12. After 15 min, the solution was removed from the CPG and the latter one was washed with CH3CN, treated with CAP A (acetic anhydride, 10% in THF) and CAP B (THF/N-methylimidazole: 84/16, v/v) mixture 1/1 (v/v) for 3 min, and finally treated with the oxidizer solution (iodine in pyridine/water/THF, 0.41/ 9.05/90.54, v/v/v, 0.02 M) for 1 min. Next, the CPG was washed with CH3CN and dried in vacuum (0.05 mbar). For the modifiers containing a DMT-groups, the latter was removed by using CCl3CO2H in CH2Cl2, 3%, v/v (deblocking solution), and the resulting modified CPG was used for the coupling of a fluorophore. The latter was done by using corresponding commercially available phosphoramidites (both from Link Technologies, UK): TAMRA-dT-CE for coupling TTMR or 5′Fluorescein-CE for coupling FAM. The conjugation procedure was similar to the one for the coupling of linkers, except that after coupling of TAMRA-dT-CE and oxidizing of the obtained product the 5′-DMT protecting group was removed by using the deblocking solution. Introduction of 3′-Terminal Modifiers to DNAs. 3′-AminoModifier C7 CPG s13 (Link Technologies, UK) was used in place of the standard CPGs (Scheme S6). The fluorenylmethyloxycarbonyl (Fmoc)-protected amino group on this solid support was first deprotected by the treatment with 1,8diazabicyclo[5.4.0]undec-7-ene (DBU) in dimethylformamide (2%, v/v, 2 mL, 3 times, each time for 45 min). Then, the CPG was washed with N,N-dimethylformamide (DMF, 2 × 2 mL), CH3CN (2 mL), and dried in vacuo (0.05 mbar). Separately, a mixture containing a corresponding carboxylic acid (either InP, 100 μmol or s8, 100 μmol), activator O-(benzotriazol-1-yl)N,N,N′,N′-tetramethyluronium hexafluorophosphate (HBTU; 34 mg, 90 mmol) and 1-hydroxy-1H-benzotriazole (HOBT; 14 mg, 100 mmol) was dissolved in DMF (1 mL), and N,Ndiisopropylethylamine (DIPEA; 38 μL, 220 mmol) was added, followed by the addition of deprotected and dried CPG s13. The slurry obtained was vortexed for 4 h, and then the CPG was filtered, washed with DMF (3 × 1 mL), CH3CN (1 mL), and dried in vacuo (0.05 mbar). Next, DNA sequences were 2029

DOI: 10.1021/acs.bioconjchem.9b00299 Bioconjugate Chem. 2019, 30, 2023−2031

Bioconjugate Chemistry

■

ON2∼P. Yield: 22%, HPLC (Nucleosil C4 column; gradient 3) Rt = 22.8 min; MALDI-TOF MS, negative mode, calculated for C247H302InN92O127P21 ([M−Cl-H]−): 7357, found m/z 7363. ON2a∼P. Yield: 25%, HPLC (Nucleosil C4 column; gradient 3) Rt = 20.45 min; MALDI-TOF MS, negative mode, calculated for C149H182InN46O70P11 ([M−Cl-H]−): 4193, found m/z 4192. ON3∼Q. Yield: 68%, HPLC (Nucleosil C18 column; gradient 1) Rt = 21.75 min; MALDI-TOF MS, negative mode, calculated for C174H217N68O90P15 ([M-H]−): 5164, found m/z 5165. ON3a∼Q. Yield: 35%, HPLC (Nucleosil C18 column; gradient 1) Rt = 25.9 min; MALDI-TOF MS, negative mode, calculated for C115H138N39O62P10 ([M-H]−): 3655, found m/z 3655. Q∼ON4. Yield: 55%, HPLC (Nucleosil C4 column; gradient 1) Rt = 16.8 min; MALDI-TOF MS, negative mode, calculated for C163H200N54O94P15 ([M-H]−): 4884, found m/z 4884. Q∼ON4a. Yield: 35%, HPLC (Nucleosil C18 column; gradient 1) Rt = 25.3 min; MALDI-TOF MS, negative mode, calculated for C115H138N39O62P10 ([M-H]−): 3368, found m/z 3368. 5′-UU-FAM-LCH∼2′-OMe RNA1. Yield: 8%, HPLC (Nucleosil C18 column; gradient 1) Rt = 19.2 min; MALDI-TOF MS, negative mode, calculated for C286H359N76O182P24 ([M-H]−): m/z 8517, found 8524. 2′-OMe RNA2∼P. Yield: 11%, HPLC (Nucleosil C18 column; gradient 3) Rt = 22.9 min; MALDI-TOF MS, negative mode, calculated for C264H336N92O148P21In ([M-Cl-H]−): m/z 7931, found 7938. 2′-OMe RNA(scr)∼P. Yield: 14%, HPLC (Nucleosil C18 column; gradient 3) Rt = 23.0 min; MALDI-TOF MS, negative mode, calculated for C264H334N90O149P21In ([M-Cl-H]−): m/z 7917, found 7915. Other experimental details are provided in the Supporting Information (SI).

■

ACKNOWLEDGMENTS

This project was supported by the German Research Council (DFG, grant MO 1418/8−1 for AM) and partially supported by Emerging Field Initiative of Friedrich-Alexander-University of Erlangen-Nuremberg (grant 3_Nat_01, “Chemistry in live cells” for AM). We thank Friedrich-Alexander-University (FAU) Erlangen-Nürnberg for the general support of this project.

■

ABBREVIATIONS AQ, 9,10-anthraquinone; bpy, 2,2′-bipyridine; CPG, controlled pore glass; DBU, 1,8-diazabicyclo[5.4.0]undec-7-ene; DCI, 4,5dicyanoimidazole; DIPEA, N,N-diisopropylethylamine; DMAP, 4-(dimethylamino)pyridine; DMF, N,N-dimethylformamide; DMT, 4,4′-dimethoxytrityl; DNA, DNA; dsDNA, double stranded DNA; FAM, fluorescein; HBTU, O-(benzotriazol-1yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate; HOBT, 1-hydroxy-1H-benzotriazole; HPLC, high performance liquid chromatography; GSH, glutathione; MALDI-TOF MS, matrix assisted laser desorption time-of-flight mass spectrometry; miRNA, micro RNA; NA, nucleic acid; ON, oligonucleotide; phen, phenanthroline; RNA, ribonucleic acid; siRNA, small interfering RNA; ssDNA, single stranded DNA; ssRNA, single stranded RNA; THAP, 2′,4′,6′-trihydroxyacetophenone; THF, tetrahydrofuran; TMR, N,N,N′,N′-tetramethylrhodamine

■

REFERENCES

(1) Klan, P., Solomek, T., Bochet, C. G., Blanc, A., Givens, R., Rubina, M., Popik, V., Kostikov, A., and Wirz, J. (2013) Photoremovable protecting groups in chemistry and biology: reaction mechanisms and efficacy. Chem. Rev. 113, 119−191. (2) Ai, X., Mu, J., and Xing, B. (2016) Recent Advances of LightMediated Theranostics. Theranostics 6, 2439−2457. (3) Ankenbruck, N., Courtney, T., Naro, Y., and Deiters, A. (2018) Optochemical Control of Biological Processes in Cells and Animals. Angew. Chem., Int. Ed. 57, 2768−2798. (4) Meunier, J.-R., Sarasin, A., and Marrot, L. (2002) Photogenotoxicity of Mammalian Cells: A Review of the Different Assays for In Vitro Testing. Photochem. Photobiol. 75, 437−447. (5) Khodjakov, A., and Rieder, C. L. (2006) Imaging the division process in living tissue culture cells. Methods 38, 2−16. (6) Manders, E. M. M., Kimura, H., and Cook, P. R. (1999) Direct Imaging of DNA in Living Cells Reveals the Dynamics of Chromosome Formation. J. Cell Biol. 144, 813−822. (7) Gorka, A. P., Yamamoto, T., Zhu, J., and Schnermann, M. J. (2018) Cyanine Photocages Enable Spatial Control of Inducible CreMediated Recombination. ChemBioChem 19, 1239−1243. (8) Nani, R. R., Gorka, A. P., Nagaya, T., Yamamoto, T., Ivanic, J., Kobayashi, H., and Schnermann, M. J. (2017) In Vivo Activation of Duocarmycin-Antibody Conjugates by Near-Infrared Light. ACS Cent. Sci. 3, 329−337. (9) Gorka, A. P., Nani, R. R., Zhu, J., Mackem, S., and Schnermann, M. J. (2014) A near-IR uncaging strategy based on cyanine photochemistry. J. Am. Chem. Soc. 136, 14153−14159. (10) Anderson, E. D., Gorka, A. P., and Schnermann, M. J. (2016) Near-infrared uncaging or photosensitizing dictated by oxygen tension. Nat. Commun. 7, 13378. (11) Peterson, J. A., Wijesooriya, C., Gehrmann, E. J., Mahoney, K. M., Goswami, P. P., Albright, T. R., Syed, A., Dutton, A. S., Smith, E. A., and Winter, A. H. (2018) Family of BODIPY Photocages Cleaved by Single Photons of Visible/Near-Infrared Light. J. Am. Chem. Soc. 140, 7343− 7346. (12) Shell, T. A., Shell, J. R., Rodgers, Z. L., and Lawrence, D. S. (2014) Tunable visible and near-IR photoactivation of light-responsive compounds by using fluorophores as light-capturing antennas. Angew. Chem., Int. Ed. 53, 875−878.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.bioconjchem.9b00299. Details of synthesis and characterization of new compounds reported in this paper as well as description of other experimental protocols and details (PDF)

■

Article

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Andriy Mokhir: 0000-0002-9079-5569 Present Address #

Department of Chemistry, Syracuse University, 111 College Place, Syracuse, NY 13244, USA Author Contributions

The manuscript was written through contributions of all authors. AM planed and OZ, TB performed the experiments. AM provided the first draft and finalized the manuscript. All authors have given approval to the final version of the manuscript. Notes

The authors declare no competing financial interest. 2030

DOI: 10.1021/acs.bioconjchem.9b00299 Bioconjugate Chem. 2019, 30, 2023−2031

Article

Bioconjugate Chemistry (13) Smith, W. J., Oien, N. P., Hughes, R. M., Marvin, C. M., Rodgers, Z. L., Lee, J., and Lawrence, D. S. (2014) Cell-Mediated Assembly of Phototherapeutics. Angew. Chem., Int. Ed. 53, 10945−10948. (14) Shell, T. A., and Lawrence, D. S. (2015) Vitamin B12: a tunable, long wavelength, light-responsive platform for launching therapeutic agents. Acc. Chem. Res. 48, 2866−2874. (15) Wang, X., and Kalow, J. A. (2018) Rapid Aqueous Photouncaging by Red Light. Org. Lett. 20, 1716−1719. (16) Gorska, K., and Winssinger, N. (2013) Reactions templated by nucleic acids: more ways to translate oligonucleotide-based instructions into emerging function. Angew. Chem., Int. Ed. 52, 6820−6843. (17) Shibata, A., Abe, H., and Ito, Y. (2012) Oligonucleotidetemplated reactions for sensing nucleic acids. Molecules 17, 2446−2463. (18) Silverman, A. P., and Kool, E. T. (2006) Detecting RNA and DNA with templated chemical reactions. Chem. Rev. 106, 3775−3789. (19) Kim, K. T., Chang, D., and Winssinger, N. (2018) DoubleStranded RNA-Specific Templated Reaction with Triplex Forming PNA. Helv. Chim. Acta 101, No. e1700295. (20) Boll, I., Jentzsch, E., Kramer, R., and Mokhir, A. (2006) Metal complex catalysis on a double stranded DNA template. Chem. Commun. 32, 3447−3449. (21) Sadhu, K. K., Eierhoff, T., Romer, W., and Winssinger, N. (2012) Photoreductive uncaging of fluorophore in response to protein oligomers by templated reaction in vitro and in cellulo. J. Am. Chem. Soc. 134, 20013−20016. (22) Saarbach, J., Lindberg, E., Folliet, S., Georgeon, S., Hantschel, O., and Winssinger, N. (2017) Kinase-templated abiotic reaction. Chem. Sci. 8, 5119−5125. (23) Holtzer, L., Oleinich, I., Anzola, M., Lindberg, E., Sadhu, K. K., Gonzalez-Gaitan, M., and Winssinger, N. (2016) Nucleic Acid Templated Chemical Reaction in a Live Vertebrate. ACS Cent. Sci. 2, 394−400. (24) Sadhu, K. K., and Winssinger, N. (2013) Detection of miRNA in live cells by using templated RuII-catalyzed unmasking of a fluorophore. Chem. - Eur. J. 19, 8182−8189. (25) Rothlingshofer, M., Gorska, K., and Winssinger, N. (2012) Nucleic acid templated uncaging of fluorophores using Ru-catalyzed photoreduction with visible light. Org. Lett. 14, 482−485. (26) Chang, D., Kim, K. T., Lindberg, E., and Winssinger, N. (2018) Accelerating Turnover Frequency in Nucleic Acid Templated Reactions. Bioconjugate Chem. 29, 158−163. (27) Chang, D., Lindberg, E., and Winssinger, N. (2017) Critical Analysis of Rate Constants and Turnover Frequency in Nucleic AcidTemplated Reactions: Reaching Terminal Velocity. J. Am. Chem. Soc. 139, 1444−1447. (28) Anzola, M., and Winssinger, N. (2019) Turn on of a ruthenium(II) photocatalyst by DNA-templated ligation. Chem. - Eur. J. 25, 334−342. (29) Röthlingshöfer, M., Gorska, K., and Winssinger, N. (2011) Nucleic acid-templated energy transfer leading to a photorelease reaction and its application to a system displaying a nonlinear response. J. Am. Chem. Soc. 133, 18110−18113. (30) Bates, M., Blosser, T. R., and Zhuang, X. (2005) Short-range spectroscopic ruler based on a single-molecule optical switch. Phys. Rev. Lett. 94, 108101. (31) Bates, M., Huang, B., Dempsey, G. T., and Zhuang, X. (2007) Multicolor super-resolution imaging with photo-switchable fluorescent probes. Science 317, 1749−1753. (32) Meyer, A., Schikora, M., Starkuviene, V., and Mokhir, A. (2016) Red light activated “caged” reagents for microRNA research. Photochem. Photobiol. Sci. 15, 1120−1123. (33) Meyer, A., Schikora, M., and Mokhir, A. (2015) Red lightcontrolled polymerase chain reaction. Chem. Commun. 51, 13324− 13326. (34) Meyer, A., and Mokhir, A. (2014) RNA interference controlled by light of variable wavelength. Angew. Chem., Int. Ed. 53, 12840− 12843.

(35) Dutta, S., Fulop, A., and Mokhir, A. (2013) Fluorogenic, catalytic, photochemical reaction for amplified detection of nucleic acids. Bioconjugate Chem. 24, 1533−1542. (36) Konig, S. G., and Mokhir, A. (2013) ‘Caged’ peptide nucleic acids activated by red light in a singlet oxygen mediated process. Bioorg. Med. Chem. Lett. 23, 6544−6548. (37) Dutta, S., Flottmann, B., Heilemann, M., and Mokhir, A. (2012) Hybridization and reaction-based fluorogenic nucleic acid probes. Chem. Commun. 48, 9664−9666. (38) Arian, D., Kovbasyuk, L., and Mokhir, A. (2011) 1,9Dialkoxyanthracene as a (1)O2-sensitive linker. J. Am. Chem. Soc. 133, 3972−3980. (39) Arian, D., Kovbasyuk, L., and Mokhir, A. (2011) Control of the photocatalytic activity of bimetallic complexes of pyropheophorbide-a by nucleic acids. Inorg. Chem. 50, 12010−12017. (40) Arian, D., Clo, E., Gothelf, K. V., and Mokhir, A. (2010) A nucleic acid dependent chemical photocatalysis in live human cells. Chem. Eur. J. 16, 288−295. (41) Fulop, A., Peng, X., Greenberg, M. M., and Mokhir, A. (2010) A nucleic acid-directed, red light-induced chemical reaction. Chem. Commun. 46, 5659−5661. (42) Voigt, N. V., Torring, T., Rotaru, A., Jacobsen, M. F., Ravnsbaek, J. B., Subramani, R., Mamdouh, W., Kjems, J., Mokhir, A., Besenbacher, F., et al. (2010) Single-molecule chemical reactions on DNA origami. Nat. Nanotechnol. 5, 200−203. (43) Helmig, S., Rotaru, A., Arian, D., Kovbasyuk, L., Arnbjerg, J., Ogilby, P. R., Kjems, J., Mokhir, A., Besenbacher, F., and Gothelf, K. V. (2010) Single molecule atomic force microscopy studies of photosensitized singlet oxygen behavior on a DNA origami template. ACS Nano 4, 7475−7480. (44) Rotaru, A., Kovacs, J., and Mokhir, A. (2008) Red light-activated phosphorothioate oligodeoxyribonucleotides. Bioorg. Med. Chem. Lett. 18, 4336−4338. (45) Rotaru, A., and Mokhir, A. (2007) Nucleic acid binders activated by light of selectable wavelength. Angew. Chem., Int. Ed. 46, 6180−6183. (46) Schikora, M., Dutta, S., and Mokhir, A. (2014) Nucleic acidspecific photoactivation of oligodeoxyribonucleotides labeled with deuterated dihydro-N,N,N’,N’-tetramethylrhodamine using green light. Histochem. Cell Biol. 142, 103−111. (47) da Silva, E. F., Pedersen, B. W., Breitenbach, T., Toftegaard, R., Kuimova, M. K., Arnaut, L. G., and Ogilby, P. R. (2012) Irradiation- and sensitizer-dependent changes in the lifetime of intracellular singlet oxygen produced in a photosensitized process. J. Phys. Chem. B 116, 445−461. (48) Schweitzer, C., and Schmidt, R. (2003) Physical mechanisms of generation and deactivation of singlet oxygen. Chem. Rev. 103, 1685− 1757.

2031

DOI: 10.1021/acs.bioconjchem.9b00299 Bioconjugate Chem. 2019, 30, 2023−2031