Regulation of the Oligomeric Status of CCR3 with Binding Ligands

Subscriber access provided by Gothenburg University Library

Article

Regulation of oligomeric status of CCR3 with binding ligands revealed by single-molecule fluorescence imaging Yanzhuo Song, Baosheng Ge, Jun Lao, Zhencai Wang, Bin Yang, Xiaojuan Wang, Hua He, Jiqiang Li, and Fang Huang Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b00676 • Publication Date (Web): 10 Oct 2017 Downloaded from http://pubs.acs.org on October 11, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Regulation of oligomeric status of CCR3 with binding ligands revealed by single-molecule fluorescence imaging Yanzhuo Song, Baosheng Ge*, Jun Lao, Zhencai Wang, Bin Yang, Xiaojuan Wang, Hua He, Jiqiang Li, Fang Huang*

State Key Laboratory of Heavy Oil Processing and Center for Bioengineering and Biotechnology, China University of Petroleum (East China), Qingdao 266580, P. R. China

*

To whom correspondence may be addressed:

BG: [email protected]; Tel: 0086-532-86981135, FAX: 0086-532-86981135 FH: [email protected] Tel: 0086-532-86981560, FAX: 0086-532-86981560

1

ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract The relation between oligomeric status and functions of chemokine receptor CCR3 is still controversial. We use total internal reflection fluorescence microscopy at the single-molecule level to visualize the oligomeric status of CCR3 and its regulation on the membrane of stably transfected T-RExTM293 cells. It is found that the population of the dimers and oligomers of CCR3 can be modulated by the binding of ligands. Natural agonists can induce an increase of dimers and oligomers at high concentration, whereas antagonists do not show significant influence on the oligomeric status. Moreover monomeric CCR3 exhibits stronger chemotactic response in migration assay of CCR3 stably transfected cells. Together these data support the notion that CCR3 exists as mixture of monomers and dimers under nearly physiological conditions and the monomeric CCR3 receptor is the minimal functional unit in cellular signaling transduction. To the best of our knowledge, these results constitute the first report of oligomeric status of CCR3 and its regulation.

Keywords: G protein-coupled receptor, living cells, membrane protein, singlemolecule imaging, oligomeric status

2


Page 2 of 25

Page 3 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

1. Introduction G protein-coupled receptors (GPCRs) constitute the largest family of human membrane proteins for a diverse range of ligands.1 GPCRs appear to be involved in the fine regulation of the cellular signaling and represent major targets of more than half of the most widely marketed drugs.2 Investigations increasingly suggest that GPCRs function either as homodimers, heterodimers or higher-order oligomers, which might have important physiological and pharmacological consequences.3, 4 The oligomerization of the GPCRs is closely relevant to the early stage of cellular signaling. Therefore the temporal dynamics of the interaction between monomers, dimers and higher-order oligomers of GPCRs, the regulation of binding ligands on the status of the receptors, and their pathophysiological roles in cellular signaling are of particular interest.5, 6 Among the various subclasses of GPCRs, it is now well accepted that family C GPCRs form constitutive homo-dimers.7 While the Class A subfamily is representative of the largest subgroup of GPCRs, it is not clear whether Class A GPCRs exist to be functional as monomers or oligomers.8 Several studies have demonstrated that Class A GPCRs are able to interact with heterotrimeric G proteins in their monomeric form.9, 10, 11 However, a large number of studies have suggested that class A GPCRs are able to form dimeric or oligomeric complexes12, 13 and the formation of such complexes can affect many aspects of GPCR functions, including receptor-G protein coupling efficiency and function selectivity.14,

15

More detailed

studies are therefore highly demanded to elucidate how Class A GPCRs function at the molecular level. Chemokine receptors belong to Class A GPCRs and are mainly characterized for their roles in chemotaxis of multiple blood cells.16 Chemokine activation of chemokine receptors can regulate a variety of physiological actions, including leukocyte

trafficking,

proliferation,

differentiation,

and

tumor

metastasis.17

Chemokine receptors are involved in several pathologies including cancer, HIV and inflammation responses, and therefore have been considered to be promising drug 3


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 25

targets for inflammatory and immunological diseases.18 Chemokine receptors, such as CCR519 and CXCR4,20 have been proved to exist as dimers or higher-order oligomers on cell surfaces and most structures of chemokine receptors have been found as homodimers. The oligomerization of chemokine receptors has been thought to play important roles in various aspects of their biology and regulate their pharmacological and signaling properties.21 Similar to all chemokine receptors, CCR3 is a cell-surface GPCR belonging to the subfamily of Class A, rhodopsin-like receptors.22 It is expressed on the surface of different types of leukocytes, such as eosinophils,23 a subset of Th2 lymphocytes,24 basophils,25 and mast cells.18 CCR3 is promiscuous in its response to the binding of chemokines with different potency and efficacy, such as Eotaxin-1/CCL11, Eotaxin-2/CCL24 and Eotaxin-3/CCL26.26 The CCR3 receptor antagonists have been shown to have potential therapeutic effects in allergic disorders.27 As a result, CCR3 serves as an important target in the development of therapeutic agents for inflammatory diseases. However, studies on the oligomerization of CCR3 are very limited. It is not yet clear whether CCR3 exist and function as monomer or dimer, and how they function at the molecular level. Single-molecule photobleaching has emerged as a powerful approach to extract the stoichiometry of membrane proteins in cellular environment.28,

29

It has obvious

advantages to observe the receptor sub-population and behavior on the cell membrane under near physiological conditions. Ensemble fluorescence resonance energy transfer (FRET) and bioluminescence resonance energy transfer (BRET) have played an important role in the discovery of receptor dimerization in living cells,30 but these methods do not provide information of the composition and distribution of oligomerization quantitatively. Studies using single-molecule imaging, however, can reveal the oligomeric status and dynamics of receptors in the cell membrane.31 These studies suggest dimerization of Class A GPCRs at the plasma membrane can exhibit a dynamic equilibrium between dimers and monomers. Here we take the advantage of total internal reflection fluorescence microscopy (TIRFM) to directly observe the stoichiometry of CCR3 in the living cell membrane. 4


Page 5 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

In this study, we report for the first time the application of TIRFM to monitor CCR3 oligomerization on stably transfected T-REX™-293 cells. Effect of expression level and binding with different agonists on oligomeric status of CCR3 was also investigated. Our results provide important information for better understanding the relationship between dimerization of CCR3 and their signal transduction function. 2. Materials and methods 2.1. Plasmid construction CCR3-EGFP fusion construct was generated by PCR using the following primers: CCR3 forward primer: 5’AAAAAGCTTATGACTACTTCTCTCGATACCGTGGAG ACCTTCG-3’, linker primer -F: 5’GAGCTGAGCATCGTCTTCGGCGGCGCGGCC GCTGGCAGCATGGTGAGCAA-3’, linker primer -R: 5’-TTGCTCACCATGCTGC CAGCGGCCGCGCCGCCGAAGACGATGCTCAGCTC-3’

and

EGFP

reverse

primer: 5’-AAAGAATTCTTACTTGTACAGCTCGTCCATGCCGAGA-3'. The PCR product was digested by two restriction endonucleases Hind III and EcoR I, then cloned into the pcDNA4.0/TO vector digested with the same restriction endonucleases. The plasmids were confirmed by DNA sequencing. 2.2. Transfection and screening of stably transfected inducible cell lines T-REx™-293 cell line and pcDNA™4/TO mammalian expression vector were purchased from Invitrogen (Life technologies, USA). T-REx™-293 cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with GlutaMAX™ (Life technologies, USA) 10% Fetal Bovine Serum (Sijiqing, China) and blasticidin (5 µg/ml) (Life technologies, USA) at 37 °C in 5% CO2 incubator. Transfection of T-REx™-293 cells was performed using Lipofectamine 3000 (Life technologies, USA) when the cells are grown to 70-80% confluent. After 48 hours of incubation, selective medium supplemented with 5 µg/ml blasticidin and 50 µg/ml zeocin was added. Cells were continuously cultured in the selective medium for additional 4 weeks. Colonies formed on the selective medium, i.e. those stably transfected with the recombinant vectors, were selected for further characterization of receptor expression. To observe CCR3 molecules, stably transfected cells were induced by 1 µg/ml 5


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 25

tetracycline, washed by PBS（137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4), and then imaged in serum free and phenol red free DMEM using TIRFM. To investigate the response of CCR3 to the stimulation of binding ligands, stably transfected cells were incubated with CCL11 and CCL24 (PeproTech, USA) in the DMEM without FBS for 15 min at 4 °C to avoid receptor internalization and then washed twice by PBS before fluorescence imaging. 2.3. Single-molecule fluorescence imaging Single-molecule fluorescence imaging was performed on an objective-type TIRFM system using an inverted Nikon Ti series microscope equipped with a total internal reflective fluorescence illuminator, 100×/1.49 NA Plan Apochromat TIR objective and an intensified electron-multiplying charge-coupled device (EMCCD) camera (Pentamax EEV 512× 512 FT, Roper Scientific). The sample was excited at 488 nm with a solid-state laser (Cobolt MLD 488 nm) with a power of 7 mW. The collected fluorescence signal was passed through two filters, B2A cubes BA510IF and HQ 525/50 (Nikon, Japan), before being directed onto the EMCCD camera. The gain of the EMCCD camera was set at 300. Movies of 100-500 frames were acquired for each sample at a frame rate of 10 Hz. 2.4. Image analysis The images were analyzed as reported.32 Briefly, the background fluorescence was first subtracted using the rolling ball method in ImageJ software (National Institutes of Health). Then the first frame of each movie was used for fluorescent spot (regions of

interest)

selection.

Fluorescence

trajectory

was

obtained

from

the

background-subtracted fluorescent spots with Speckel TrackerJ software (National Institutes of Health). 2.5. Dot blotting analysis Dot blotting analysis was performed described previously to quantitatively estimate the expression level of CCR3-EGFP with different induction time. HeLa, U87-MG and stably transfected cells with different induction times were lysed in PBS buffer 6


Page 7 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

supplemented with 2% (v/v) FC14 and 1 mM PMSF for 1 hour at 4°C. 3 µl of each sample was spotted onto nitrocellulose membrane. Non-specific sites were blocked by soaking in 5% skimmed milk in PBST buffer, then incubated with anti-CCR3 monoclonal antibody (Abcam, USA), followed by secondary antibody conjugated with horseradish peroxidase (Tiangen, China). The target protein was visualized through chemiluminescence and the luminescence intensity was analyzed by MultiGauge Ver.3.X software. 2.6. Chemotaxis assay Chemotaxis was assessed using 24-well chambers with polyvinylpyrrolidone-free polycarbonate membranes with 8 µm pores (CORNING, USA) for 5 h at 37 °C in humidified 5% CO2 incubator. The stably transfected cells were suspended (106 cells/ml) in DMEM containing 0.5% (v/v) bovine serum albumin. 100 µL of the cell suspension was added to the upper wells. Eotaxin-1 or Eotaxin-2 (50 nM) (PeproTech, USA) diluted in the same medium was added to the lower wells. Cell numbers migrating to the lower wells were quantified using crystal violet staining.

3. Results 3.1. Oligomeric status of CCR3 at low receptor density To visualize CCR3 with TIRFM, stably transfected T-REx™-293 cell line was generated to express human CCR3 with enhanced green fluorescent protein (EGFP) fused at its C-terminus. The stably transfected cell line was first imaged on a confocal microscope after 24 h induction of CCR3-EGFP with 1 µg/ml tetracycline (Fig. 1a). The confocal image shows that the protein was located both on the cell plasma membrane and in the cytosol. In order to detect CCR3 at the single-molecule level on the living cell membrane, the density of the labelled receptors must be low enough so that the distance between individual molecules is larger than diffraction limit. For this purpose, cells with different expression levels were investigated to explore at which expression level single-molecule experiments can be carried out. It is found that cells with 4 h induction time are suitable for single-molecule imaging. This expression time 7


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ensured that CCR3-EGFP was expressed homogeneously at a low density, corresponding to the number of bright spots on the surface of the cells being less than 80 molecules in a 20 µm × 20 µm area. As shown in Fig.1b and Movie S1, most CCR3-EGFP molecules appeared as well-dispersed diffraction-limited fluorescent spots (5 × 5 pixels, 800 nm × 800 nm area). Most fluorescent spots maintained their fluorescence mostly for less than 3 s before photobleached. To count the steps of photobleaching of an individual receptor, we extracted the fluorescence trajectory from each diffraction limited spot, which showed stepwise photobleaching behavior (Fig. 1c). It can be seen that some spots fit to one-step photobleaching and others fit to a two-step bleaching model (Fig. 1c).

8


Page 8 of 25

Page 9 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure. 1. Single-molecule imaging of CCR3-EGFP in living cells. (a) A representative confocal image of T-REx™-293 cells stably expressing CCR3 after 24 h of induction. The green and blue color represents the receptors and DAPI-stained nucleus, respectively. The scale bar is 20 µm. (b) Visualization of individual CCR3 on the surface of living cells by single-molecule microscopy. The image is a section (20 µm × 20 µm area) of the first frame from a stack of images (Movie S1) with background-subtracted by using the rolling ball method. The diffraction-limited spots (5

× 5 pixels, 800 nm × 800 nm area) enclosed with cyan circles represent the signals from individual CCR3-EGFP molecules, which were selected for intensity analysis. The scale bar is 2 µm. (c) Representative fluorescence intensity trajectories from individual diffraction-limited spots.

Next, the intensity and expression level of CCR3 were observed by TIRFM using different time scales. We determined the intensity of CCR3-EGFP after different induction time (Fig. 2). The statistical analysis of the photobleaching steps in individual receptors shows that after 4 h of induction a high proportion of the total (176 of 212 spots from 15 cells) exhibits one-step photobleaching (Fig. 3). This observation suggests that CCR3 exists in the monomeric form with the absence of ligands at the very beginning of induction i.e. 1 h to 4 h. In addition, dot blot analysis 9


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Fig. S1) shows that the expression level of CCR3 with about 4 h induction time is equivalent to the expression level of CCR3 in U87-MG and HeLa cells. U87-MG cells are known to express CCR3 naturally33 and the evidence for CCR3 also naturally expressed in HeLa cells is shown in Supporting Information. This result suggests that CCR3 exists mainly as monomer at physiological expression level. 3.2. Oligomerization of CCR3 at high expression level It is noteworthy that the receptor expression level in the heterologous cell lines has been suspected to impact the oligomer formation.34 We then explored whether the oligomeric status of CCR3 in resting cells was regulated by its expression level. With induction time of 8 h, the expression level of CCR3-EGFP increased significantly and the intensity of individual CCR3-EGFP fluorescent spots also increased. Under these conditions, CCR3 was overexpressed and the expression level was much higher than that in U87-MG and HeLa cells. It was found that some CCR3-EGFP molecules were observed as individual spots with multiple photobleaching steps (Fig. 3), suggesting the formation of oligomers. When the expression time was extended to 24 h, the size and density of the bright spots further increased (Fig. 2d and Movie S2). These results suggest that CCR3 molecules self-assemble and oligomerize at high concentration on the cell membranes. In addition, this finding is consistent with our previous studies, where immunoblotting data from purified CCR3 also confirmed the formation of CCR3 oligomers.35 Therefore, these studies strongly suggest that the expression level of membrane proteins has considerable influence on their oligomeric status, and that CCR3 exists as monomer at low expression level and oligomer at a higher expression level within resting cell.

10


Page 10 of 25

Page 11 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure. 2. The distribution of monomers and dimers of receptors on cell surface at different expression levels. (a), (b), (c), (d) represent TIRFM imaging of individual CCR3 on the living cell membrane after 4 h, 8 h, 12 h and 24 h induction time, respectively. Cyan circles represent the diffraction-limited spots. (scale bar = 2 µm).

11


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure. 3. Frequency of one-step, two-step and multi-step photobleaching of CCR3 on the membrane of stably transfected T-RExTM-293 cell in resting status at different expression level revealed by single-molecule imaging.

3.3 Influence of ligand binding on oligomerization of CCR3 We subsequently investigated whether CCR3 undergoes oligomerization in the presence of ligands. Two natural ligands and one antagonist, CCL11 (Eotaxin-1), CCL24 (Eotaxin-2) and SB-297006 were used at different expression levels of CCR3. With 1 h induction time, dimers of CCR3 were undetectable. Similarly, at this expression level dimerization was not detectable with or without stimulation of natural ligands (data not shown). With 2 h induction time, CCR3 started to form dimers but the dimerization level was very low and not affected by any of the natural ligands used in this work (Fig. 4a, c). After 4 h of induction, CCR3 formed considerable amount of dimers and CCL11, CCL24 induced a slightly increased population at a low concentration (Fig. 4b, d). The frequency of the dimer induced by CCL11 at 1 µM was up to 24.4% (56 out of 228 spots in 10 cells) compared with 19.3% (51 out of 267 spots in 10 cells) without CCL11 stimulation. Based on the t-test analysis, there is significant statistical difference in the fractions of one-step and two-step photobleaching between the group of high ligand concentrations (500 nM and 1 µM) and the control group (0 nM of ligands) both for CCL11 and CCL24 (P0.05). However, at ligand concentration of 1 µM, the population of the oligomers increased dramatically. The statistics analysis shows that there is significant statistical difference between CCL11 and CCL24 stimulation at concentration of 1 µM in the fractions of one-step, two-step and mutiple-step (P200). (a) Effect of CCL11 on oligomeric status of CCR3 with induction time of 2 h. (b) Effect of CCL11 on oligomeric status of CCR3 with induction time of 4 h. (c) Effect of CCL24 on oligomeric status of CCR3 with induction time of 2 h. (d) Effect of CCL24 on oligomeric status of CCR3 with induction time of 4 h. (e) Effect of antagonist SB-297006 on oligomeric status of CCR3 with induction time of 2 h. (f) Effect of antagonist SB-297006 on oligomeric status of CCR3 with induction time of 4 h.

3.4 Monomeric CCR3 as a minimal functional unit In order to reveal the relationship between oligomeric status of CCR3 and its chemotactic function, ligand-induced chemotaxis assay was carried out using stably transfected cells. Firstly, various chemokine concentrations of CCL11 and CCL24 were optimized for the chemotaxis assay (shown in Figure. S2). The results show that the number of the migrated cells upon CCL11 and CCL24 stimulation at concentration of 80 nM and 200 nM is less than that at 50 nM. We then investigated how cells at different induction time response to stimulation of 50 nM ligand (Fig.5). The data shows that CCR3 expressing cells exhibited a similar chemotactic response upon binding with different ligands. The chemotactic response of the transfected CCR3 to both CCL11 and CCL24 reaches a maximum when induction time was close to 4 h and was progressively inhibited with prolonged induction time. The statistical analysis of t-test shows that there is significant statistical difference of cell numbers in migration assay between the group with induction time of 4 h and the group with 14


Page 14 of 25

Page 15 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

induction time of 1 h both for CCL11 and CCL24 (P0.05), as shown in Fig. 5. The results from oligomeric status of CCR3 at different induction times and their chemotactic responses suggest that the chemotactic response to endogenous ligands can be inhibited when the receptor forms higher-order oligomers in the membrane of the living cells. As mentioned above, CCR3 mainly exists as a monomer when the induction time is around 4 h, however, CCR3 expressing cells exhibit highest chemotactic activities at induction time of 4 h. Our results therefore suggest that monomeric CCR3 receptor is the minimal functional unit for G protein signaling transduction.

Figure. 5. Migration of cells with different induction time of CCR3 in response to CCL11 and CCL24 at the concentration of 50 nM, respectively. Data are represented as the mean S.E. from three separate experiments.

4. Discussion Dimerization and/or higher-order oligomerization is a common phenomenon for most cell surface receptor families. Chemokine receptor, which belongs to Class A GPCR is no exception.37 There are numerous evidences of homo-oligomerization for chemokine receptors. CCR2b38 was the first chemokine receptor to be demonstrated to oligomerize and CCR5,39 CXCR1,40 CXCR2,41 CXCR441 were also confirmed to exist as homo-dimers. C-C Chemokine receptor CCR3 is one of the chemokine receptors having multiple ligands. Complicated signaling networks of multiple ligands recognition is particularly crucial for the physiological function of CCR3 15


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 25

modulation.26, 42 The concept of GPCR oligomerization provides a new perspective of physiological function regulation. However it is still challenging to explain the impact of GPCR oligomerization at physiological level. So far, numerous GPCRs have been reported to exist as dimers or oligomers using recombinant technologies and biophysical methods such as FRET and single-molecule imaging, but only a limited number of the GPCRs dimers and oligomers identified in heterologous cells have been validated in native tissues. Regarding class A receptors, oxytocin receptor oligomer has been reported in mammary gland in lactating rate using time-resolved fluorescence resonance energy transfer (TR-FRET) methods,43 which is the first evidence of GPCR oligomerization in vivo. Functional trans-complementation of mutant receptors in the absence of functional

wild-type

receptors

in

mice

strongly

suggests that

luteinizing

hormone receptor (LHR) can oligomerize in vivo.44 Endogenous dopamine D2-adenosine A2A receptor complexes in the striatum of mice has been confirmed using the proximity ligation in situ assay (P-LISA).45 Although more and more evidence on GPCR oligomerization has been obtained, it is still controversial what is the role of GPCR oligomerization on the cell surface in vivo. New techniques with improved nanobodies of higher affinity is still required in the near future to demonstrate the nature of GPCR oligomers in their native context. Under current circumstances, it is a feasible alternative to use single-molecule imaging in cell lines to extrapolate the formation of oligomers in native tissues. In order to determine the monomer, dimer and oligomer fractions of CCR3 at single molecular level, there is an important requirement that the concentration of the labelled receptors must be low enough on the living cell membrane. In this study, an image with 512 × 512 pixels (81.92 µm × 81.92 µm area) contains about 100 × 100 squares of 5 × 5 pixels. In this area there are 320 bright spots to the maximum, which corresponds to 3.2% probability to observe CCR3 in each square. The probability to observe two independent CCR3 in one square is as low as 0.1%, which is negligible. As a control, cells expressing EGFP-labelled CD86 were imaged in our previous studies.32 As a monomer, CD86 showed clearly one-step photobleaching, which 16


Page 17 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

means that at this expression level it is very rare to observe two or more individual proteins in an area within diffraction limit. Both of the above theoretical prediction and the CD86 control experiments demonstrate that the observation of monomers and dimers is reliable. It has been demonstrated that the stoichiometry of membrane-bound proteins can be determined by the statistical analysis of photobleaching steps of GFP fused to the proteins.46 Recent studies using TIRFM allowed the visualization of individual single-molecule GFP-fused receptors in the membrane of a living cell. Thus the stoichiometry of the receptors and ligand-induced receptor activation could be observed and quantified.47,

48

Epitope tags of GFP inserted at the N-terminus of

GPCRs may influence their structure, trafficking and functions since the ligands bind at the N-terminus. Although the C-terminal domains of GPCRs can be involved in many aspects of receptor functions including phosphorylation, desensitization even interaction with other intracellular proteins, C-terminal GFP tag has been successfully used in a number of receptors with no distinct consequences in their function.49, 50 Experiments in this work reveal the oligomeric status of CCR3 receptors in resting cells. They show that at the basal status CCR3 exists mainly as mixtures of monomers and dimers at low expression level similar to that in U87-MG. This suggests that CCR3 exists mainly as monomers under physiological conditions. So far, many Class A GPCRs have been reported to be a mixture of monomers and dimers in the living cell membrane at very low density. Our findings are therefore consistent with the results for other Class A GPCRs. The effect of ligands on GPCR oligomerization is highly controversial,8, 51 although some reports have suggested that the dynamic equilibrium between monomer and dimer of the receptor shifted with ligand stimulation. There is not yet report in which the oligomeric status of CCR3 with ligand binding has been analyzed. Our data support the view that agonist binding has no obvious effect on the oligomerization of CCR3 when the receptor expression level is low. In contrast, at higher expression level of CCR3, similar to the native expression level of U87-MG and HeLa, both CCL11 and CCL24 slightly increase the dimer ratio at lower concentrations (100 17


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

nM-200 nM). Addition of either ligand at higher concentration can result in a significant increase in the population of oligomers, however, that concentration (up to 1 µM) has far beyond the physiological level (nanomole) and may not occur in vivo.52 CCR3 and CXCR4 belong to family A GPCRs, however, the oligomerization of CCR3 triggered by CCL11 or CCL24 binding was different from that of CXCR4 induced by SDF-1α stimulation observed in our previous work.32 SDF-1α shows much stronger effect on modulation of oligomerization of CXCR4 than CCL11 and CCL24 on CCR3 even at high concentration up to 1 µM. The antagonist AMD3100, also as a partial agonist,53 can induce the increase of oligomerization of CXCR4, but the stimulation of antagonist SB297006 had no obvious effect on the modulation of CCR3 stoichiometry. Previous studies also show that TC14012, acting as an inverse agonist, can regulate the oligomerization status of CXCR4 in a reverse manner. Since there is still no inverse agonist of CCR3 available, the modulation of inverse agonists on oligomerization of CCR3 was not studied. These results indicate that stoichiometry of CCR3 and CXCR4 in the membrane of living cells can be modulated by ligands with diverse ligand efficacy and the various ways of regulation by ligands may be an important mechanism in exquisite cellular signaling. Fluorescence and bioluminescence resonance energy transfer (FRET, BRET) techniques have been widely employed for analysis of GPCR complexes in receptor-expressing cells, which has greatly enhanced the understanding of GPCR oligomerization at the cell surface. A number of the experimental evidences based on FRET or BRET methods support chemokine receptor homo- and heterodimertization. CXCR7 has been confirmed to be homo-dimer using BRET in cell lines and its ligand CXCL12 can modify the conformation of preformed homodimers of CXCR754 or induce different conformational changes.55 It is still controversial for studies on CXCR4 oligomerization using FRET or BRET methods. Obvious BRET efficiency changes or FRET signal of CXCR4 induced by agonist binding have been observed in some experiments.56 However, some of other previous experiments based on FRET or BRET methods indicated that receptor dimerization is in a ligand independent manner even to higher-order oligomerizations.20, 41 Due to the limitation of BRET or FRET 18


Page 18 of 25

Page 19 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

methods, evaluation of the size of GPCR oligomers and even quantification of oligomer complexes are very challenging and parts of the conclusions mentioned based on FRET or BRET methods is not well consistent with results from single-molecule techniques. One of the possible reasons is that changes in BRET signal can also be attributed to conformational changes in GPCRs. Although GPCR oligomerization has been investigated widely, the functional significance of monomeric class A GPCRs in the cellular signaling has not been elucidated. Several series of studies suggest that monomeric GPCRs may have a function in signaling.57, 58 Taken together the migration assay and oligomeric status of CCR3 at different induction time, our results suggest that a monomer of CCR3 can be the minimal functional unit required for chemotactic response and the oligomerization of CCR3 may play a negative role in cell migration. The potential role of different oligomeric receptor complexes in mediating the dedicated network of CCR3 signaling transduction pathways is still of particular interest and significance of the therapeutic implications. In summary, we have experimentally shown for the first time that CCR3 exists as mixture of monomers and dimers under physiological conditions in the absence of ligand, and the receptor can assemble into oligomers when highly expressed in the cell membrane. Ligand binding can induce an increase of dimers and oligomers at high concentration, whereas antagonists do not show influence on the oligomeric status. The monomeric CCR3 receptor is found to be the minimal functional unit in G protein signaling. Our results provide important information for better understanding the relationship between dimerization of CCR3 and their signal transduction, and can be beneficial for related rational drug design and disease treatment. Funding Information This work was supported by the National key Research and Development Plan of China [2016YFE0106700], the National Natural Science Foundation of China [ No.21373271, 21673294 and 21573289] and the Fundamental Research Funds for 19


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the Central Universities. Conflict of Interest: All authors declare that he/she has no conflict of interest. Ethical Statement: This article does not contain any studies with human participants or animals performed by any of the authors. Supporting Information Dot blot analysis of CCR3 in different cells (Figure S1); migration assay of CCR3 stably transfected cells induced by ligands of various concentrations (Figure S2); movies of CCR3 molecules imaged by TIRFM at different induction time (Movie S1 and S2). References 1.

Munk, C., Isberg, V., Mordalski, S., Harpsoe, K., Rataj, K., Hauser, A. S., Kolb, P., Bojarski, A. J., Vriend, G., and Gloriam, D. E. (2016) GPCRdb: the G protein-coupled receptor database - an introduction. British journal of pharmacology 173, 2195-2207.

2.

Tang, X. L., Wang, Y., Li, D. L., Luo, J., and Liu, M. Y. (2012) Orphan G protein-coupled receptors (GPCRs): biological functions and potential drug targets. Acta pharmacologica Sinica 33, 363-371.

3.

Ferre, S., Casado, V., Devi, L. A., Filizola, M., Jockers, R., Lohse, M. J., Milligan, G., Pin, J. P., and Guitart, X. (2014) G protein-coupled receptor oligomerization revisited: functional and pharmacological perspectives. Pharmacological reviews 66, 413-434.

4.

Rivero-Muller, A., Jonas, K. C., Hanyaloglu, A. C., and Huhtaniemi, I. (2013) Di/oligomerization of GPCRs-mechanisms and functional significance. Progress in molecular biology and translational science 117, 163-185.

5.

Gonzalez-Maeso, J. (2011) GPCR oligomers in pharmacology and signaling. Molecular brain 4, 20.

6.

George, S. R., O'Dowd, B. F., and Lee, S. P. (2002) G-protein-coupled receptor oligomerization

7.

Zhang, X. C., Liu, J., and Jiang, D. (2014) Why is dimerization essential for class-C GPCR

and its potential for drug discovery. Nat Rev Drug Discov. 1, 808-820. function? New insights from mGluR1 crystal structure analysis. Protein & cell. 5, 492-495. 8.

Hu, J., Hu, K., Liu, T., Stern, M. K., Mistry, R., Challiss, R. A., Costanzi, S., and Wess, J. (2013) Novel structural and functional insights into M3 muscarinic receptor dimer/oligomer formation. The Journal of biological chemistry 288, 34777-34790.

9.

Whorton, M. R., Bokoch, M. P., Rasmussen, S. G., Huang, B., Zare, R. N., Kobilka, B., and Sunahara, R. K. (2007) A monomeric G protein-coupled receptor isolated in a high-density lipoprotein particle efficiently activates its G protein. Proceedings of the National Academy of Sciences of the United States of America 104, 7682-7687. 20


Page 20 of 25

Page 21 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

10.

Ernst, O. P., Gramse, V., Kolbe, M., Hofmann, K. P., and Heck, M. (2007) Monomeric G protein-coupled receptor rhodopsin in solution activates its G protein transducin at the diffusion limit. Proceedings of the National Academy of Sciences of the United States of America 104, 10859-10864.

11.

White, J. F., Grodnitzky, J., Louis, J. M., Trinh, L. B., Shiloach, J., Gutierrez, J., Northup, J. K., and Grisshammer, R. (2007) Dimerization of the class A G protein-coupled neurotensin receptor NTS1 alters G protein interaction. Proceedings of the National Academy of Sciences of the United States of America 104, 12199-12204.

12.

Weimann, L., Lee, S. F., Felce, J. H., Davis, S. J., and Klenerman, D. (2013) Revealing the Stoichiometry of G Protein-Coupled Receptors (GPCRs) at the Cell Surface using Single Molecule Imaging. Biophysical journal 104, 525a.

13.

Tabor, A., Weisenburger, S., Banerjee, A., Purkayastha, N., Kaindl, J. M., Hubner, H., Wei, L., Gromer, T. W., Kornhuber, J., Tschammer, N., Birdsall, N. J., Mashanov, G. I., Sandoghdar, V., and Gmeiner, P. (2016) Visualization and ligand-induced modulation of dopamine receptor dimerization at the single molecule level. Scientific reports 6, 33233.

14.

Stephane Angers, A. S., and Michel Bouvier. (2002) DIMERIZATION: An Emerging Concept for G Protein–Coupled Receptor Ontogeny and Function. Annu. Rev. Pharmacol. Toxicol. 42, 409-435.

15.

Milligan, G. (2013) The prevalence, maintenance, and relevance of G protein-coupled

16.

Butcher, E. C., Picker, L. J. (1996) Lymphocyte Homing and Homeostasis, Science 272, 60-66.

17.

Munoz, L. M., Holgado, B. L., Martinez, A. C., Rodriguez-Frade, J. M., and Mellado, M. (2012)

receptor oligomerization. Molecular pharmacology 84, 158-169.

Chemokine receptor oligomerization: a further step toward chemokine function. Immunology letters 145, 23-29. 18.

Horuk, J. E. P. a. R. (2014) Recent progress in the development of antagonists to the

19.

Issafras, H., Angers, S., Bulenger, S., Blanpain, C., Parmentier, M., Labbe-Jullie, C., Bouvier, M.,

chemokine receptors CCR3 and CCR4. Expert Opin. Drug Discov. 9, 467-483. and Marullo, S. (2002) Constitutive agonist-independent CCR5 oligomerization and antibody-mediated clustering occurring at physiological levels of receptors. The Journal of biological chemistry 277, 34666-34673. 20.

Babcock, G. J., Farzan, M., and Sodroski, J. (2003) Ligand-independent dimerization of CXCR4,

21.

Thelen, M., Munoz, L. M., Rodriguez-Frade, J. M., and Mellado, M. (2010) Chemokine

a principal HIV-1 coreceptor. The Journal of biological chemistry 278, 3378-3385. receptor oligomerization: functional considerations. Current opinion in pharmacology 10, 38-43. 22.

Bachelerie, F., Ben-Baruch, A., Burkhardt, A. M., Combadiere, C., Farber, J. M., Graham, G. J., Horuk, R., Sparre-Ulrich, A. H., Locati, M., Luster, A. D., Mantovani, A., Matsushima, K., Murphy, P. M., Nibbs, R., Nomiyama, H., Power, C. A., Proudfoot, A. E., Rosenkilde, M. M., Rot, A., Sozzani, S., Thelen, M., Yoshie, O., and Zlotnik, A. (2014) International Union of Basic and Clinical Pharmacology. LXXXIX. Update on the extended family of chemokine receptors and introducing a new nomenclature for atypical chemokine receptors. Pharmacological reviews 66, 1-79.

23.

Gerber, B. O., Zanni, M. P., Uguccioni, M., Loetscher, M., Mackay, C. R., Pichler, W. J., Yawalkar, N., Baggiolini, M., and Moser, B. (1997) Functional expression of the eotaxin 21


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

receptor CCR3 in T lymphocytes co-localizing with eosinophils. Current Biology 7, 836-843. 24.

Sallusto, F., Mackay, C.R., and Lanzavecchia, A. (1997) Selective Expression of the Eotaxin Receptor CCR3 by Human T Helper 2 Cells. Science 277, 2005-2007.

25.

Uguccioni, M., Mackay, C. R., Ochensberger, B., Loetscher, P., Rhis, S., LaRosa, G. J., Rao, P., Ponath, P. D., Baggiolini, M., and Dahinden, C. A. (1997) High Expression of the Chemokine Receptor CCR3 in Human Blood Basophils, J. Clin. Invest. 100, 1137-1143.

26.

Provost, V., Larose, M. C., Langlois, A., Rola-Pleszczynski, M., Flamand, N., and Laviolette, M. (2013) CCL26/eotaxin-3 is more effective to induce the migration of eosinophils of asthmatics than CCL11/eotaxin-1 and CCL24/eotaxin-2. Journal of leukocyte biolog 94, 213-222.

27.

Naya, A., Kobayashi, K., Ishikawa, M., Ohwaki, K., Saeki, T., Noguchi, K., and Ohtake, N. (2001)

28.

Nichols, M. G., and Hallworth, R. (2016) The Single-Molecule Approach to Membrane Protein

Discovery of a Novel CCR3 Selective Antagonist. Bioorg. Med. Chem. Lett 11, 1219-1223. Stoichiometry. Methods in molecular biology 1427, 189-199. 29.

Hallworth, R., and Nichols, M. G. (2012) Single molecule imaging approach to membrane protein stoichiometry. Microsc Microanal.18, 771-780.

30.

Xu, X., Brzostowski, J. A., and Jin, T. (2009) Monitoring Dynamic GPCR Signaling Events Using Fluorescence Microscopy, FRET Imaging, and Single-Molecule Imaging. Methods Mol Biol. 571, 371-383.

31.

Kasai, R. S., Suzuki, K. G., Prossnitz, E. R., Koyama-Honda, I., Nakada, C., Fujiwara, T. K., and Kusumi, A. (2011) Full characterization of GPCR monomer-dimer dynamic equilibrium by single molecule imaging. The Journal of cell biology 192, 463-480.

32.

Lao, J., He, H., Wang, X., Wang, Z., Song, Y., Yang, B., Ullahkhan, N., Ge, B., and Huang, F. (2017) Single-Molecule Imaging Demonstrates Ligand Regulation of the Oligomeric Status of CXCR4 in Living Cells. J Phys Chem B. 121, 1466-1474.

33.

Jöhrer, K., Zelle-Rieser, C., Perathoner, A., Moser, P., Hager, M., Ramoner, R., Gander, H., Höltl, L., Bartsch, G., Greil, R., and Thurnher, M. (2005) Up-regulation of functional chemokine receptor CCR3 in human renal cell carcinoma. Clin Cancer Res. 11, 2459-2465.

34.

Calebiro, D., Rieken, F., Wagner, J., Sungkaworn, T., Zabel, U., Borzi, A., Cocucci, E., Zurn, A., and Lohse, M. J. (2013) Single-molecule analysis of fluorescently labeled G-protein-coupled receptors reveals complexes with distinct dynamics and organization. Proceedings of the National Academy of Sciences of the United States of America 110, 743-748.

35.

Wang, M., Ge, B., Li, R., Wang, X., Lao, J., Huang, F. (2013) Milligram Production and Biological Activity Characterization of the Human Chemokine Receptor CCR3. PloS one 8, e65500.

36.

White, J. R., Lee, J. M., Dede, K., Imburgia, C. S., Jurewicz, A. J., Chan, G., Fornwald, J. A., Dhanak, D., Christmann, L. T., Darcy, M. G., Widdowson, K. L., Foley, J. J., Schmidt, D. B., and Sarau, H. M. (2000) Identification of potent, selective non-peptide CC chemokine receptor-3 antagonist that inhibits eotaxin-, eotaxin-2-, and monocyte chemotactic protein-4-induced eosinophil migration. The Journal of biological chemistry 275, 36626-36631.

37.

Gurevich, V. V., and Gurevich, E. V. (2008) How and why do GPCRs dimerize? Trends in pharmacological sciences 29, 234-240.

38.

Stephens, B., and Handel, T. M. (2013) Chemokine receptor oligomerization and allostery. Progress in molecular biology and translational science 115, 375-420.

39.

Isik, N., Hereld, D., and Jin, T. (2008) Fluorescence resonance energy transfer imaging reveals that chemokine-binding modulates heterodimers of CXCR4 and CCR5 receptors. PloS one 3, 22


Page 22 of 25

Page 23 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

e3424. 40.

Wilson, S., Wilkinson, G., and Milligan, G. (2005) The CXCR1 and CXCR2 receptors form constitutive homo- and heterodimers selectively and with equal apparent affinities. The Journal of biological chemistry 280, 28663-28674.

41.

Hamatake, M., Aoki, T., Futahashi, Y., Urano, E., Yamamoto, N., and Komano, J. (2009) Ligand-independent higher-order multimerization of CXCR4, a G-protein-coupled chemokine receptor involved in targeted metastasis. Cancer science 100, 95-102.

42.

Wan, Y., Jakway, J. P., Qiu, H., Shah, H., Garlisi, C. G., Tian, F., Ting, P., Hesk, D., Egan, W., Billah, M. M., and Umland, S.P. (2002) Identification of full, partial and inverse CC chemokine receptor 3 agonists using [35S]GTPgammaS binding. European journal of pharmacology 456, 1- 10.

43.

Albizu, L., Cottet, M., Kralikova, M., Stoev, S., Seyer, R., Brabet, I., Roux, T., Bazin, H., Bourrier, E., Lamarque, L., Breton, C., Rives, M. L., Newman, A., Javitch, J., Trinquet, E., Manning, M., Pin, J. P., Mouillac, B., and Durroux, T. (2010) Time-resolved FRET between GPCR ligands reveals oligomers in native tissues. Nature chemical biology 6, 587-594.

44.

Rivero-Muller, A., Chou, Y. Y., Ji, I., Lajic, S., Hanyaloglu, A. C., Jonas, K., Rahman, N., Ji, T. H., and Huhtaniemi, I. (2010) Rescue of defective G protein-coupled receptor function in vivo by intermolecular cooperation. Proceedings of the National Academy of Sciences of the United States of America 107, 2319-2324.

45.

Taura, J., Fernandez-Duenas, V., and Ciruela, F. (2015) Visualizing G Protein-Coupled Receptor-Receptor Interactions in Brain Using Proximity Ligation In Situ Assay. Curr Protoc Cell Biol. 67, 17.17.1-16.

46.

Ji, W., Xu, P., Li, Z., Lu, J., Liu, L., Zhan, Y., Chen, Y., Hille, B., Xu, T., and Chen, L. (2008) Functional stoichiometry of the unitary calcium-release-activated calcium channel. Proceedings of the National Academy of Sciences of the United States of America 105, 13668-13673.

47.

Sun, Y., Li, N., Zhang, M., Zhou, W., Yuan, J., Zhao, R., Wu, J., Li, Z., Zhang, Y., and Fang, X. (2016) Single-molecule imaging reveals the stoichiometry change of beta2-adrenergic receptors by a pharmacological biased ligand. Chemical communications 52, 7086-7089.

48.

Zhang, W., Jiang, Y., Wang, Q., Ma, X., Xiao, Z., Zuo, W., Fang, X., and Chen, Y. G. (2009) Single-molecule imaging reveals transforming growth factor-beta-induced type II receptor dimerization. Proceedings of the National Academy of Sciences of the United States of America 106, 15679-15683.

49.

Qian, J., Wu, C., Chen, X., Li, X., Ying, G., Jin, L., Ma, Q., Li, G., Shi, Y., Zhang, G., and Zhou, N. (2014) Differential requirements of arrestin-3 and clathrin for ligand-dependent and -independent internalization of human G protein-coupled receptor 40. Cellular signalling 26, 2412-2423.

50.

Thompson, A., and Kanamarlapudi, V. (2015) Agonist-induced internalisation of the glucagon-like peptide-1 receptor is mediated by the Galphaq pathway. Biochemical pharmacology 93, 72-84.

51.

Teitler, M., and Klein, M. T. (2012) A new approach for studying GPCR dimers: drug-induced inactivation and reactivation to reveal GPCR dimer function in vitro, in primary culture, and in vivo. Pharmacology & therapeutics 133, 205-217.

52.

Min, J. W., Lee, J. H., Park, C. S., Chang, H. S., Rhim, T. Y., Park, S. W., Jang, A. S., and Shin, H. D. 23


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(2005) Association of eotaxin-2 gene polymorphisms with plasma eotaxin-2 concentration. Journal of human genetics 50, 118-123. 53.

Zhang, W. B., Navenot, J. M., Haribabu, B., Tamamura, H., Hiramatu, K., Omagari, A., Pei, G., Manfredi, J. P., Fujii, N., Broach, J. R., and Peiper, S. C. (2002) A point mutation that confers constitutive activity to CXCR4 reveals that T140 is an inverse agonist and that AMD3100 and ALX40-4C are weak partial agonists. The Journal of biological chemistry 277, 24515-24521.

54.

Levoye, A., Balabanian, K., Baleux, F., Bachelerie, F., and Lagane, B. (2009) CXCR7 heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113, 6085-6093.

55.

Kalatskaya, I., Berchiche, Y. A., Gravel, S., Limberg, B. J., Rosenbaum, J. S., and Heveker, N. (2009) AMD3100 is a CXCR7 ligand with allosteric agonist properties. Molecular pharmacology 75, 1240-1247.

56.

Toth, P. T., Ren, D., and Miller, R. J. (2004) Regulation of CXCR4 receptor dimerization by the chemokine SDF-1alpha and the HIV-1 coat protein gp120: a fluorescence resonance energy transfer (FRET) study. The Journal of pharmacology and experimental therapeutics 310, 8-17.

57.

Whorton, M. R., Jastrzebska, B., Park, P. S., Fotiadis, D., Engel, A., Palczewski, K., and Sunahara, R. K. (2008) Efficient coupling of transducin to monomeric rhodopsin in a phospholipid bilayer. The Journal of biological chemistry 283, 4387-4394.

58.

Bayburt, T. H., Vishnivetskiy, S. A., McLean, M. A., Morizumi, T., Huang, C. C., Tesmer, J. J., Ernst, O. P., Sligar, S. G., and Gurevich, V. V. (2011) Monomeric rhodopsin is sufficient for normal rhodopsin kinase (GRK1) phosphorylation and arrestin-1 binding. The Journal of biological chemistry 286, 1420-1428.

24


Page 24 of 25

Page 25 of 25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For Table of Contents Use Only 161x67mm (96 x 96 DPI)


Regulation of the Oligomeric Status of CCR3 with Binding Ligands

Recommend Documents