666
Chem. Res. Toxicol. 1998, 11, 666-673
Replication Inhibition and Miscoding Properties of DNA Templates Containing a Site-Specific cis-Thymine Glycol or Urea Residue John M. McNulty,† Bozidar Jerkovic,‡ Philip H. Bolton,‡ and Ashis K. Basu*.† Department of Chemistry, University of Connecticut, Storrs, Connecticut 06269, and Department of Chemistry, Wesleyan University, Middletown, Connecticut 06469 Received December 22, 1997
Oligodeoxynucleotides modified site-specifically with cis-thymine glycol or urea residue, two ionizing radiation/oxidation damages, were used as templates in primer extension reactions catalyzed by 3′ f 5′ exonuclease-deficient Klenow fragment, human DNA polymerase β, AMV reverse transcriptase, and a modified T7 DNA polymerase (Sequenase). Both lesions blocked DNA replication one nucleotide before and opposite the lesion site, but a significant fraction of full-length product was obtained after prolonged incubation. Hill plot analysis of the results on both thymine glycol- and urea- containing templates by 3′ f 5′ exonuclease-deficient Klenow fragment for incorporation of either dATP or dGTP gave linear plots with Hill coefficients much less than 1. This suggests that the dNTP concentration influences the termination of DNA synthesis at multiple steps of the catalytic process. The specificity of nucleotide incorporation opposite these lesions and chain extension by the same polymerase was determined by a steady-state kinetic analysis. The kinetic studies established that the rate of nucleotide incorporation and chain extension was highest with deoxyadenosine opposite both these lesions. However, the efficiency of forming a G‚T pair relative to an A‚T pair for the control at a level of 1/109 was enhanced to approximately 1/160 for thymine glycol and 1/20 for urea, although the former lesion was more bypassable than the latter lesion. On the basis of these in vitro results, we conclude that both these DNA damages are impediments of DNA synthesis and that a urea residue, in particular, has the potential to miscode.
Introduction Ionizing radiation induces a variety of DNA damages, including base modifications, strand breaks, cross-links, and abasic sites (1-3). A variety of assays have shown that ionizing radiation is mutagenic with base substitutions being the most common (4-7). The types of DNA damage produced by ionizing radiation and cellular oxidation are qualitatively similar (8), with thymine bases being most susceptible to modification (9-12). The major stable products of thymine modification in vitro and in vivo are cis-5,6-dihydroxy-5,6-dihydrothymine isomers (cis-thymine glycol or t′)1 (9, 10). Urea residues (u′), a fragmentation product of unstable thymine hydroperoxides and a product of t′ hydrolysis, have been detected in X-irradiated DNA (12, 13) (Scheme 1). Endonuclease III, a DNA glycosylase and class I AP endonuclease in Escherichia coli (14), has specificity for t′, u′, and several other pyrimidine radiolysis products (15). A class II endonuclease such as exonuclease III or endonuclease IV is also required for the repair of t′ and u′ (15). Both t′ and u′ inhibit DNA synthesis in vitro (16). DNA synthesis is usually terminated opposite t′ and one * Address correspondence to this author. Phone: (860) 486-3965. Fax: (860) 486-2981. E-mail:
[email protected]. † University of Connecticut. ‡ Wesleyan University. 1 Abbreviations: t′, cis-5,6-dihydroxy-5,6-dihydrothymine or cisthymine glycol; u′, urea residue; KF (exo-), 3′ f 5′ exonuclease-deficient Klenow fragment; BSA, bovine serum albumin; DTT, dithiothreitol; AMV, avian myeloblastosis virus.
Scheme 1
nucleotide before u′. Significant translesion synthesis was observed in DNA sequences in which t′ is located between a 5′-C and a 3′-purine nucleotide (17). Genetic studies indicate that a single t′ in such a sequence is not inhibitory to DNA replication in vivo (18) and that several t′ residues are needed to inactivate a phage DNA (19). In φx RF I DNA 10-12 t′ or 9-10 u′ residues per genome are needed to produce one lethal hit in a repair-competent strain (19). An activated form of RecA as well as UmuD′C proteins are required for SOS translesion bypass of t′, which results in significant increase in phage survival. By contrast, no reactivation of phage DNA containing u′ was observed (19). Several in vitro and in vivo studies have failed to detect any mutagenesis by t′ (20-24). A site-specific study in a 5′-Ct′A sequence, however, showed that t′ is only weakly mutagenic in E. coli inducing T f C transitions at a frequency of 0.20.3% and that mutagenic frequency is the same in strains that are deficient in its repair (18). Similar studies with u′ have not been reported. However, a random mutagen-
S0893-228x(97)00225-7 CCC: $15.00 © 1998 American Chemical Society Published on Web 05/06/1998
In Vitro Replication of cis-Thymine Glycol and Urea Residue
esis study has shown that u′ residues are as toxic and as mutagenic as abasic sites and that u′ mutagenesis is dependent on SOS induction of host cells (25). The major type of mutations induced by u′ is T f C transitions (25). Although genotoxic and mutagenic properties of sitespecific t′ have been studied extensively both in vitro and in vivo, single-adduct mutagenesis experiments have never been performed with u′. In this study we explored the in vitro mutagenic potential of a site-specific u′ on a DNA template in comparison with t′ as well as a control template. Bypass studies have been performed with four different polymerases, which include a reverse transcriptase [from avian myeloblastosis virus (AMV)], a human DNA polymerase (pol β), a replicative polymerase from an E. coli virus (Sequenase), and a repair polymerase from E. coli [3′ f 5′ exonuclease-deficient Klenow fragment (KF (exo-)]. For the kinetic studies, however, KF (exo-) was used, because it does not require accessory proteins, has high fidelity, and is available as a highly pure enzyme. In addition, many more kinetic studies on misincorporation opposite damaged nucleotides have been carried out with KF than with any other DNA polymerase, allowing for comparison of the results of this investigation with studies on other damaged DNAs.
Materials and Methods Materials. Allyl alcohol and KMnO4 were purchased from Aldrich Chemical Co. (Milwaukee, WI). KF (exo-)2 and Sequenase version 2.0 were from Amersham Corp. (Cleveland, OH). Human DNA polymerase β was purchased from Molecular Biology Resources (Milwaukee, WI). AMV reverse transcriptase was obtained from International Biotechnologies. T4 polynucleotide kinase and DNA ligase were from Bethesda Research Laboratory (Gaithersberg, MD). [γ-32P]dATP was from DuPont New England Nuclear (Boston, MA). Methods. Synthesis of d(CGCGAt′ACGCC) and d(CGCGAu′ACGCC). Oligonucleotide containing t′ was prepared by oxidation of the parent single-stranded DNA with 0.1 M KMnO4. The oxidation was carried out in a 300-mL plastic jar containing 20 mL of 0.2 M K2HPO4 at pH 8.6 and 0.45 µmol (50 A260) of d(CGCGATACGCC), the parent strand. The mixture was stirred with a magnetic stirrer for 20 min in an ice bath. Subsequently, it was treated with 8 mL of 0.1 M KMnO4 for 5 min at 4 °C. The reaction was quenched by the addition of 0.5 mL of allyl alcohol which converts the excess MnO4- to MnO2. The sample was kept at 4 °C for at least 1 h to allow the MnO2 to completely precipitate. The reaction mixture was then centrifuged to remove the MnO2. The supernatant containing the products was diluted to 100 mL with distilled water and was desalted on a Sep-pak (Waters) C18 cartridge. The modified 11-mer was eluted from the Sep-pak cartridge with 14 mL of 70% CH3CN/H2O in four steps (3 × 4 mL and 1 × 2 mL). It was purified by HPLC on a semipreparative reversed-phase PRP-1 column (Hamilton Co., Reno, NV). The purified 11-mer containing t′ was collected and desalted on a C18 Sep-pak cartridge. DNA containing u′ was prepared by alkali hydrolysis of t′containing oligonucleotide. Approximately 135 nmol (15 A260) of d(CGCGAt′ACGCC) was incubated in 1 mL of 0.025 M phosphate buffer at pH 13.0 at room temperature for 1 h. To bring the pH to ∼7.0, 1.1 mL of 0.2 M EDTA at pH 5.43 was added to the solution. The solution was then desalted and purified by HPLC as described above. Construction of 26-mers. Each of the modified 11-mers and the unmodified control 11-mer (∼4.5 nmol) was ligated to 5′-phosphorylated 15-mer, 5′-TAGAGATTGGTAGGG (∼6.7 nmol), 2 Concentration of KF (exo-) (1 unit ) 46 nM) reported in this work is according to the assay performed by the supplier.
Chem. Res. Toxicol., Vol. 11, No. 6, 1998 667 in the presence of a 20-nucleotide complementary oligonucleotide, 5′-TACCAATCTCTAGGCGTATC (∼6.7 nmol) (26). The mixture of the three oligonucleotides in 10 µL of 50 mM TrisHCl, pH 7.6, 10 mM MgCl2, and 10 mM dithiothreitol (DTT) was heated to 70 °C, slowly cooled to 25 °C, and subsequently left at 4 °C for 15 h. T4 DNA ligase (2 units), ATP (final concentration 1 mM), and BSA (50 µg/mL) were added, and the mixture was incubated at 4 °C for 16 h. The reaction was stopped by the addition of formamide-EDTA dye mixture, and the oligonucleotides were separated by electrophoresis on a 16% polyacrylamide-8 M urea gel. The ligated product bands were visualized by UV shadowing and excised. The 26-mers, 5′CGCGAT*ACGCCTAGAGATTGGTAGGG (where T* denotes t′, u′, or T), were desalted on a Sephadex G-25 (Sigma) column and stored at -20 °C until further use. DNA Polymerase Reactions. The primed template was obtained by annealing about a 5-fold molar excess of the modified or control 26-mer templates (∼20 ng) to a complementary 5′-32P-labeled 9-mer (2-3 ng) in 10 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 50 mM NaCl, and 10 mM β-mercaptoethanol. The mixture was heated to 70 °C for 2 min and then cooled slowly to room temperature to allow for annealing to occur. After addition of MgCl2 to 8 mM, DTT to 2 mM, and BSA to 50 µg/ mL final concentration, a mixture of nucleotide triphosphates (dATP, dGTP, dTTP, and dCTP) was added. The concentration of the dNTPs varied between experiments. Aliquots of these solutions were transferred and incubated with 4 units of KF (exo-). After the desired time of incubation at 25 °C, 5 µL of stop solution (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol) was added. After denaturing at 90 °C for 2 min, a portion was loaded onto a 16% polyacrylamide sequencing gel containing 8 M urea. In the case of Sequenase version 2.0, the buffer used was 36 mM Tris-HCl (pH 7.5), 0.1 mM EDTA, 8 mM MgCl2, 50 mM NaCl, and 1 mM DTT. After annealing, a mixture of dNTPs and DTT (2 mM final concentration) was added and aliquots of this mixture were incubated with 3 units of Sequenase version 2.0. The buffer for the AMV reverse transcriptase (7.5 units) was similar, but the pH was changed to 8.3 at which the avian enzyme works more efficiently. Human DNA polymerase β (3 units) was incubated at 25 °C in 50 mM Tris-HCl (pH 8.0), 20 mM MgCl2, 2 mM DTT, and BSA (0.5 µg/µL). For the 9-mer primer we used the reaction temperature of 25 °C rather than the physiological temperature, because the melting temperature of this duplex was lower than 37 °C. Hill Plot Analysis. Hill’s analysis of oxygen binding to hemoglobin has been extended to various conditions of enzyme activity. This approach is particularly useful for determination of the molecular order of participation of activators or inhibitors in enzymatic processes (27). Wilson and co-workers have extended this methodology to the analysis of termination of DNA synthesis by KF (28). They showed that incorporation of dNTP opposite a modified residue was dependent on the concentration of dNTP. At the site of the modified base the polymerase has two options: it can either terminate synthesis or extend the primer by incorporating dNTP. The probability of termination, Pt, at position n will be the ratio of DNA products n nucleotides long to DNA products n nucleotides long or longer molecules. The probability of incorporation, Pi, at position n will be 1 - Pt. The total polymerase population, [ET], which reaches position n, will include polymerases that terminate at position n + 1 or polymerases that continue synthesis by incorporating the dNTP at position n + 1. Analogous to a Hill plot, one can define z ) Pi/(1 - Pi) ) Pi/Pt and plot log z versus log [dNTP]. The resultant equation log z ) y log [dNTP] + k suggests a straight line relationship, in which log z vanishes when dNTP concentration leads to a termination probability of 50%, and at that point k ) -y log [dNTP]. In the case of KF, a single subunit enzyme with one dNTP binding site, Hill plot analysis can determine the cooperativity of the catalytic reaction. For the Hill plot analysis we used a 15-mer primer with its 3′ end six bases away from the lesion site. Preliminary
668 Chem. Res. Toxicol., Vol. 11, No. 6, 1998 experiemnts showed that the 15-mer primer was extended 3′ to the lesion site by KF (exo-) at 37 °C without any incorporation opposite t′ or u′ when reaction mixtures contained 10 µM each of dCTP, dTTP, and dGTP, which allowed us to carry out the Hill plot analysis of termination probability by varying the concentrations of either dATP or dGTP opposite t′ and u′. Nucleotide Insertion and Chain Extension. To determine the nucleotide preferentially incorporated opposite the adducts with a “running start”, a 19-mer primer was used and only a single nucleotide was added to the reaction mixture in addition to dTTP. Kinetic data of nucleotide incorporation opposite the lesion and further extension were determined at 37 °C by the method of Goodman and co-workers (29-31). Reaction mixtures containing 23 nM2 KF (exo-) were incubated at 37 °C for 1-6 min in reactions containing 213 nM primer/ template duplex (26-mer template primed with 32P-labeled 19mer) in 10 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 8 mM MgCl2, 2 mM DTT, 50 mM NaCl, 10 mM β-mercaptoethanol, BSA (50 µg/mL), and the dNTPs for the insertion kinetics. For dATP opposite the control template, however, 0.046 nM KF (exo-) was used. Likewise, four different 21-mers were used for the extension kinetics in the same buffer. For the insertion kinetics, the optimal dTTP concentration was determined to be 50 µM. All reactions were linear during the course of these experiments. The Michaelis constant (Km) and rate of incorporation (kcat) were extrapolated from a Hanes-Woolf plot of the kinetic data as described by Lowe and Guengerich (32). Nucleotide insertion (Fins) and extension (Fext) frequencies were determined relative to dT‚dA pair as described (31, 32), where F ) (kcat/Km) [wrong pair]/(kcat/Km) [right pair], in which “wrong pair” is any base pair containing t′ or u′.
Results Synthesis and Characterization of 26-mers Containing Either t′ or u′. The 11-mer containing a t′ was synthesized by permanganate oxidation of the parent oligonucleotide. The isolated yield was typically about 40-50%. Alkaline hydrolysis of part of the t′-containing 11-mer at pH 13.0 gave the u′-containing 11-mer. The isolated yield of the latter was about 75%. It is interesting that at pH 13.0 we observed rapid cleavage of the 11-mer containing an abasic site, but the u′ 11-mer was much more stable to the basic condition. Part of the purified 11-mers was enzymatically digested to component nucleosides and analyzed by HPLC. Chromatographic analysis at 254 nm showed the anticipated amounts of dA, dG, and dC, but no detectable dT from the t′-containing 11-mer. However, the t′ nucleoside could be detected at 220 nm. It is noteworthy that permanganate oxidation of thymidine provided approximately a 3:1 ratio of 5R,6S and 5S,6R isomers of dt′, whereas oxidation of the 11-mer generated >95% of the former stereoisomer. Similar observation was described by Kao et al. (33) and Kung et al. (34). Reverse-phase HPLC analysis showed different elution times for each of the 11-mers. The unmodified 11-mer eluted at 22.0 min, whereas t′- and u′-containing 11-mers eluted at 20.1 and 16.8 min, respectively. It is noteworthy that the 11-mer containing an abasic site at the same position eluted at 14.2 min. The HPLC traces of the 11mers are shown in Supporting Information Figure S1. Each modified 11-mer was also examined by highresolution 1H NMR spectroscopy. The one-dimensional 1 H NMR spectra of the modified 11-mers were entirely consistent with their chemical structures. The structure of the duplex 11-mer containing t′, d(C1G2C3G4A5N6A7C8G9C10C11) paired with d(G12G13C14G15T16A17T18C19G20C21G22) (where N6 denotes the damaged base), has
McNulty et al.
Figure 1. Polyacrylamide gel electrophoresis of modified and unmodified 11-mers. The samples were electrophoresed on a 84cm long 20% acrylamide/N,N′-methylenebis(acrylamide) (19:1) gel containing 8 M urea at 2500 V for 28 h.
been determined (34), whereas the same for the u′containing 11-mer is currently in progress. A comparison of the aromatic and H1′ resonances (5-8.5 ppm) and of the methyl region (1-3 ppm) of the three damaged 11mers containing t′, u′, and an abasic site is shown in Supporting Information Figures S2 and S3, respectively. The methyl resonance of dT16 in the complementary strand flanking the dt′‚dA pair is distinctly different from that in the du′‚dA pair. Similarly, the aromatic resonances of the H8 of dA7 are distinct in the three cases as are the signals of the H1′ of dG4 and H6 of dC21. The NMR samples of these modified 11-mers have been routinely stored at -20 °C, and they have been examined by a combination of NMR and HPLC prior to use in structural studies over the time scale of 1 year or longer. The combined use of NMR and HPLC can detect the presence of about 5% u′ 11-mer in t′-DNA. Likewise, about 5% abasic site-containing DNA in u′ 11-mer is detectable by this approach. We did not observe any such degradation. The final proof of purity of the samples came from polyacrylamide gel electrophoresis. We could separate each of the modified 11-mers and the unmodified control on a 84-cm long 20% polyacrylamide gel running at 2500 V for 28 h in a BRL model SA electrophoresis apparatus. As shown in Figure 1, the u′ 11mer ran faster than the t′ 11-mer, which in turn ran faster than the control. An analysis by a PhosphorImager showed no detectable contamination of t′ and unmodified DNA in the u′ 11-mer, whereas t′ 11-mer did not contain any unmodified 11-mer but appeared to contain trace amounts of u′ 11-mer, which was as high as ∼0.6% in one sample. As expected, unmodified 11mer did not contain any detectable amount of the modified 11-mers. The long 20% polyacrylamide gel electrophoresis also provided evidence that incubation of the 11-mers under conditions of the replication experiments did not influence the integrity of the radiolabeled bands suggesting that both t′ and u′ are stable to the experimental conditions. The modified and unmodified control 11-mers were ligated to a 5′-phosphorylated 15-mer, 5′-TAGAGATTGGTAGGG, in the presence of T4 DNA ligase and a 20nucleotide complementary oligomer, 5′-TACCAATCTCTAGGCGTATC, which held the ligating oligonucleotides together. The resultant 26-mers, 5′-CGCGAT*ACGCCTAGAGATTGGTAGGG (where T* denotes t′, u′, or T), were purified by electrophoresis on a denaturing polyacrylamide gel. Analysis by polyarylamide gel electrophoresis showed that the modified 11-mers are stable to the conditions of ligation and subsequent manipula-
In Vitro Replication of cis-Thymine Glycol and Urea Residue
Chem. Res. Toxicol., Vol. 11, No. 6, 1998 669
Figure 3. Polyacrylamide gel electrophoresis separation of DNA fragments generated by extension of 32P-end-labeled 9-mer primer using unmodified (first lane in each frame), t′-modified (second lane), and u′-modified (third lane) 26-mer templates. Polymerization was catalyzed by AMV reverse transcriptase, human DNA polymerase R, KF (exo-), and Sequenase version 2.0. Incubations were for 2 h at 25 °C. Details are provided in Materials and Methods.
Figure 2. Maxam-Gilbert sequence analysis of the unmodified (frame A) and u′-containing (frame B) 26-mers. The times of exposure of the X-ray film for frames A and B were 2 h 45 min and 11 h, respectively.
tions. The modified and unmodified 26-mers were subjected to Maxam-Gilbert sequencing reactions, which confirmed the sequence of these oligomers. For the modified 26-mers, the sequence beyond the 3′ nucleotide to the adduct site was very weak. Unlike the unmodified template, piperidine-induced cleavage occurred at the nucleotide position 21 from the 3′ end of the modified template in all the base-specific cleavage reactions (Figure 2). Nevertheless, a more prolonged exposure of the film revealed the DNA sequence of the modified 26mers. It is interesting that the t′-containing 26-mer showed more extensive cleavage than the u′-containing 26-mer (data not shown). In Vitro DNA Replication System. In preliminary experiments we studied the ability of several DNA polymerases to replicate past t′ and u′ in vitro. The replication system used the following primed template in which the modified nucleotide has been denoted as T*:
The template was hybridized to a 5′-32P-labeled complementary 9-mer primer. The lesion was located at template position 21 from the 3′ end, and the 3′ terminus of the primer was two nucleotides away from the lesion site in the template as shown above. We have analyzed the products of DNA synthesis by using denaturing polyacrylamide gel electrophoresis. For each experiment, a control template was replicated in a similar manner. A 2-h extension with KF (exo-), human DNA polymerase β, AMV reverse transcriptase, and Sequenase (version 2.0) is shown in Figure 3. To optimize the concentrations of these polymerases, different amounts
of the enzymes have been used in several earlier experiments. While activity of a similar number of units for KF (exo-), human DNA polymerase β, and Sequenase was approximately the same, AMV reverse transcriptase showed variable results. This problem notwithstanding, the data from the experiments with AMV reverse transcriptase showed very similar characteristics, at least qualitatively. A major goal of using several different repair and replicative polymerases from different organisms is to provide a preliminary comparison of their abilty to bypass these DNA damages. It appears that t′ is a stronger block of DNA synthesis with these polymerases except for KF (exo-). With 0.5 unit of KF (exo-) (∼23 nM) a time course of chain extension was carried out (Figure 4). It is evident that both t′ and u′ constitute a replication block. Initially, the DNA polymerase stalled one nucleotide before the lesion. With time a nucleotide is incorporated opposite the lesion. For t′ after a 30-min incubation a visible band of full-length product was observed, which increased in intensity over time, whereas the band for a full-length product was almost undetectable in the case of u′. As detailed in Materials and Methods, termination of DNA synthesis opposite t′ or u′ can be examined by varying the concentration of dNTP, which, in principle, should generate a linear Hill plot. Indeed, when termination of DNA synthesis opposite t′ or u′ was analyzed by Hill plot, linear relationships were observed for both dATP and dGTP substrates with reasonable r2 values (Figure 5). dTTP and dCTP substrates have not been used in this analyses, because incorporation of the pyrimidine nucleotides opposite either t′ or u′ was extremely sluggish (vide infra). Hill plot analysis was carried out according to the equation log z ) y log [dNTP] + k, where z ) Pi/Pt and the slope y is the Hill coefficient (Figure 5). The average Hill coefficients for t′ were 0.16 (r2 0.97) and 0.31 (r2 0.97) for dATP and dGTP, respectively. Likewise, the coefficients for u′ were 0.19 (r2 0.90) and 0.27 (r2 0.89) for dATP and dGTP, respectively. Exclusion of the data point at log [dNTP] 1.7 for u′:dGTP
670 Chem. Res. Toxicol., Vol. 11, No. 6, 1998
Figure 4. Time course of 9-mer primer extension catalyzed by KF (exo-) on 26-mer templates containing a T, t′, or u′ in the presence of all four dNTPs. In each case, 1-6 represent the incubation times of 1, 5, 10, 30, 60, and 120 min. M shows the migration characteristics of the oligonucleotide standards.
Figure 5. Hill plot analysis of termination probability of t′ and u′ templates versus dATP and dGTP concentration. Open squares and circles represent t′ with dATP and dGTP, respectively, whereas closed squares and circles represent u′ with dATP and dGTP, respectively. Each data point represents the mean ( standard deviation of three independent experiments. For some points standard deviation was smaller than the symbol.
plot improves the r2 value to 0.99 with a modified coefficient of 0.25. Therefore, for both t′ and u′ templates the Hill coefficients are much less than 1 with either dATP or dGTP, suggesting negative cooperativity. One can interpret this as termination from two or more forms of the polymerase that are reversibly connected in a sequence, as in the postulated mechanism of KF by Benkovic and co-workers (36). In this model multiple forms of KF are in equilibrium and increasing concentration of the dNTP essentially pulls the polymerase through the translocation step or favors formation of enzymetemplate/primer-dNTP complex ready for the catalytic step. Similar conclusions were made by Abbott et al. in a detailed study on termination of DNA synthesis by KF (28). The kinetic parameters of nucleotide insertion and chain extension catalyzed by KF (exo-) were determined (Table 1). For insertion kinetics with a running start,
McNulty et al.
the 19-mer primer must add one nucleotide before reaching the template target site. For extensions, a 21mer containing either an A or a G at the 3′ end was used. Kinetic data of nucleotide incorporation opposite the lesion and further extension were determined at 37 °C by the method of Goodman and co-workers, except Vmax was replaced by kcat (29-32). Preliminary experiments showed that kinetics of both insertion and chain extension were too sluggish for the dCMP and dTMP opposite t′ or u′. To avoid the possibility of substrate inhibition, we did not use substrate concentrations above 5 mM. We therefore determined the kinetic parameters of dAMP and dGMP incorporation opposite the lesions. The results as shown in Table 1 clearly indicate that both t′ and u′ are impediments of DNA synthesis and that the latter is a stronger replication block. The frequency of both insertion and chain elongation was higher when A was opposite either of these two lesions rather than G. The frequency (Fins) at which nucleotide incorporation opposite the lesion occurs, coupled with the frequency (Fext) at which different base pairs are extended from the 3′ primer terminus, can be employed to predict miscoding potential of a lesion during translesion synthesis. Using Fins × Fext as a parameter to estimate the frequency of bypass, A was preferred nearly 109-to-1 over G in the control template (Table 1). With this approach, Fins × Fext for A and G was calculated to be 5.7 × 10-8 and 3.5 × 10-10 opposite t′, respectively, in reactions catalyzed by KF (exo-). The Fins × Fext for A and G insertion opposite u′ was 2.4 × 10-9 and 1.1 × 10-10, respectively (Table 1). This suggests that the polymerase discriminatation of G opposite T (relative to A opposite T) at a level of 1/109 was reduced approximately to 1/160 for t′ and 1/20 for u′, even though t′ was more bypassable than u′. To determine the DNA sequence of the extended primers, we allowed DNA synthesis to continue for 2 h in the presence of all four dNTPs and excised the extension products. Maxam-Gilbert sequencing of each of these extension products was carried out. For both t′ and u′ templates, dAMP incorporation opposite the lesion was detectable as in the case of the unmodified template (data not shown). Although DNA sequencing of the extension products showed a weaker band in the G lane, a similar “shadow” band was also observed in the control template. As determined from the kinetic studies, this shows that dAMP is preferentially incorporated opposite both t′ and u′ by KF (exo-).
Discussion The aromaticity and planarity of the ring structure of thymine are lost in t′. The puckered ring structure of t′, however, adversely influences its ability to stack with neighboring bases. The solution structures of duplex DNAs containing t′ have been examined (33, 34). The structure of the duplex containing the same sequence as used in the current study showed that the t′ residue is largely extrahelical (34). The structural distortions due to the presence of t′, in this sequence context, appear to be localized to the damaged site and the two neighboring base pairs. In the case of u′ there is no ring structure, and the lesion therefore may more closely resemble an abasic site. It is possible, however, that the carbonyl and amino functionality of u′ can be involved in hydrogen bonding. The potential of a u′ residue to hydrogen-bond
In Vitro Replication of cis-Thymine Glycol and Urea Residue
Chem. Res. Toxicol., Vol. 11, No. 6, 1998 671
Table 1. Kinetic Parameters for Nucleotide Insertion and Chain Extension Reactions Catalyzed by the exo- Klenow Fragmenta
A‚Tc G‚T A‚t′ G‚t′ A‚u′ G‚u′
Km (µM)
kcat (s-1)
Finsb
Km (µM)
kcat (s-1)
Fextb
Fins × Fext
1.58 ( 0.07 95 ( 20 0.24 ( 0.05 30 ( 9 4(2 26 ( 11
49.20 ( 0.01 0.11 ( 0.01 0.004 ( 0.002 0.0039 ( 0.0008 0.0036 ( 0.0008 0.0034 ( 0.0005
1 3.7 × 10-5 5.9 × 10-4 4.1 × 10-6 3.0 × 10-5 4.1 × 10-6
0.32 ( 0.03 61 ( 20 2.5 ( 0.7 3(1 0.6 ( 0.1 3(1
13 ( 1 0.07 ( 0.01 0.010 ( 0.002 0.012 ( 0.002 0.0018 ( 0.0003 0.0031 ( 0.0005
1 2.8 × 10-5 9.7 × 10-5 8.5 × 10-5 7.9 × 10-5 2.8 × 10-5
1 1.0 × 10-9 5.7 × 10-8 3.5 × 10-10 2.4 × 10-9 1.1 × 10-10
a The K and k m cat were obtained from Hanes-Woolf plots ([dNTP/ν] versus [dNTP]). The data represents the average of 3-6 separate experiments. b Evaluated from kcat/Km ratios. c For insertions the dNTP(A or G) is presented first, followed by the base in the oligonucleotide, and for extension reactions the N‚T* pair is shown in this column.
with T has been investigated by NMR spectroscopy (35). This study suggested that the u′ deoxyribose exists as a mixture of two isomers, of which the predominant one can form hydrogen bonds with complementary thymine. In the major species u′ and the complementary thymine are located within the right-handed B-DNA helix. A minor species is also observed, in which u′ and thymine adopt an extrahelical position. This study suggests the likelihood of u′ to form a preferential pair, although all four possible pairs must be studied to provide a better insight. When u′ residues were introduced at random in M13 DNA, DNA polymerase I terminated one nucleotide prior to u′ sites (16). In the current study, however, we found that translesion synthesis past t′ or u′ depends on the DNA polymerase used. More bypass synthesis and more full-length products on u′ template were observed with human DNA polymerase β, Sequenase version 2.0, and AMV reverse transcriptase relative to t′ template. By contrast, u′ is a stronger block in comparison to t′ for KF (exo-) as reported by others (16). Like many other lesions, concentration of dNTP can influence termination opposite either t′ or u′. In each case the Hill coefficient of less than 1 indicated negative cooperativity, irrespective of whether dATP or dGTP was used as a substrate. We conclude that both dATP and dGTP can influence termination of DNA synthesis at multiple steps in the catalytic process. It is conceivable that u′ residues, like abasic sites, are noninstructive. In vitro results showed that the specificity of nucleotide insertion, Vmax/Km, opposite a model abasic site by Drosophila DNA polymerase R is 6-11 times greater for A over G (30), whereas the same for the natural abasic site is 7 times higher with KF (exo-) (37). Moreover, unlike the normal bases the insertion specificity at the abasic sites depends more on Vmax than Km. Nucleotide insertions governed by Vmax discrimination have been ascribed to an enzyme selection mechanism in which active site constraints imposed by the polymerase determine the rates of phosphodiester formation. In the current investigation, however, for both t′ and u′ specificity of insertion of A over G was primarily dependent on Km. For example, Km was 125-fold higher for G over A in the case of t′ and was approximately 7-fold higher for u′, whereas the kcat for each pair was nearly
the same. The polymerase discrimination for insertion of A versus G opposite both t′ and u′ therefore occurs at the level of Km, although the exact implication of Km in these situations is not well-defined (38, 39). It is interesting that despite these differences, Fins of A over G at abasic sites by Drosophila DNA polymerase R and KF (exo-) is roughly 7 times greater, which is approximately the same for u′. It is important to emphasize, however, that Klenow fragment discriminates primarily by a kcat (or Vmax) effect (36), whereas base selection of pol R at the level of substrate binding utilizes a Km effect (29). For extension, both Km and kcat were very similar for A‚t′ and G‚t′ pairs, unlike the control in which Km was ∼200-fold for G‚T relative to A‚T pair. In the case of u′ Km was ∼5-fold for G over A. The frequency of translesion synthesis past these two lesions, as determined by Fins × Fext, shows that t′ is more than 20-fold bypassable relative to u′. A more important conclusion, however, is that the ratio of Fins × Fext for A‚t′/G‚t′ ≈ 160 and the same for A‚u′/G‚u′ is only ∼20, compared to nearly a 109fold difference for the control pairs. The mutagenic potential of u′ is high when it is compared with certain carcinogen-DNA adducts, such as the C8-Gua adduct of N-2-aminofluorene. The latter induces G f T transversions in vivo, and it was estimated that the dAMP/dCMP misinsertion ratio opposite this adduct is ∼2/109 with KF (exo-) (40), which is several orders of magnitude lower than the dGMP/dAMP misinsertion ratio opposite u′. Our result is consistent with an in vivo study of randomly introduced u′ residue in E. coli, which showed that u′ f C is the major type of mutation (25). We should acknowledge, however, that the in vitro approach employed in this investigation may not be free from certain biases of this experimental system. As enumerated earlier, Klenow fragment has many advantages as a model polymerase for kinetic studies, but the fact remains that it is most commonly associated with DNA repair synthesis and is not the major replicative polymerase of E. coli. In addition, we have used a short 26mer template, and the extent of replication past a lesion appears to be dependent on the size of the template (41). Indeed, DNA polymerase III replication is poorly processive and strongly terminated by a carcinogen-DNA adduct on a 33-mer template, whereas facile bypass
672 Chem. Res. Toxicol., Vol. 11, No. 6, 1998
occurred when the adduct was located on a bacteriophage M13 template (41). Furthermore, in most biological systems DNA replication is an asymmetric process and leading strand synthesis proceeds concomitantly with fork opening, whereas lagging strand synthesis takes place on a single-stranded template. In an in vitro study fork-like DNA templates were shown to support bypass replication of lesions that block DNA synthesis on singlestranded templates (42). Nevertheless, this is the first study in which mispairing properties of a site-specifically located u′ has been investigated, and the data suggest that u′ has the potential to induce mutagenesis. It would be interesting to investigate the survival and mutagenesis of a site-specific u′ in vivo.
Acknowledgment. We are grateful to Dr. Laura Lowe Furge (Vanderbilt University) for helpful discussions and to Dr. H. C. Kung (Wesleyan University) for technical assistance. The project described was supported by the National Institute of Environmental Health Sciences, NIH (Grants ES07946 and ES09127) to A.K.B. and by the American Cancer Society (Grant NP-750) to P.H.B. J.M.M. was supported in part by a training grant (ES07163) from NIEHS. Supporting Information Available: Figure S1 shows the HPLC traces of the 11-mer oligonucleotides; Figures S2 and S3 show a comparison of the aromatic H1′ resonances (5-8.5 ppm) and of the methyl region (1-3 ppm) of the three damaged 11mers containing t′, u′, and an abasic site (5 pages). See any current masthead page for ordering information.
References (1) Huttermann, J., Kohnlein, W., Teoule, R., and Bertinchamps, A. J., Eds. (1978) Effects of ionizing radiation on DNA. Effects of Ionizing Radiation on DNA, Springer-Verlag, New York. (2) Hutchinson, F. (1985) Chemical changes induced in DNA by ionizing radiation. Prog. Nucleic Acid Res. Mol. Biol. 32, 115154. (3) Basu, A. K., and Essigmann, J. M. (1995) DNA damage: structural and functional consequences. In DNA Repair Mechanisms: Impact on Human Diseases and Cancer (Vos, J.-M. H., Ed.) pp 1-24, R. G. Landes, Austin. (4) Glickman, B. W. (1990) Study of mutational specificity in the lac I gene of Escherichia coli as a window on the mechanism of mutation. Environ. Mol. Mutagen. 16, 48-54. (5) Brandenburger, A., Godson, G. N., Radman, M., Glickman, B. W., van Sluis, C. A., and Doubleday, O. P. (1981) Radiation-induced base substitution mutagenesis in single-stranded DNA phage M13. Nature (London) 294, 180-182. (6) Kato, T., Oda, Y., and Glickman, B. W. (1985) Randomness of base substitution mutations induced in the lacI gene of Escherichia coli by ionizing radiation. Radiat. Res. 101, 402-406. (7) Grosovsky, A. J., De Boer, J. G., De Jong, P. J., Drobetsky, E. A., and Glickman, B. W. (1988) Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutations in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 85, 185188. (8) Frenkel, K., Chrzan, K., Troll, W., Teebor, G. W., and Steinberg, J. J. (1986) Radiation-like modification of bases in DNA exposed to tumor promoter-activated polymorphonuclear leukocytes. Cancer Res. 46, 5533-5540. (9) Te´oule, R., Bonicel, A., Bert, C., Cadet, J., and Polverelli, M. (1974) Identification of radioproducts resulting from the breakage of thymine moiety by gamma irradiation of E. coli DNA in an aerated aqueous solution. Radiat. Res. 57, 46-58. (10) Cathcart, R., Schwiers, E., Saul, R. L., and Ames, B. N. (1984) Thymine glycol and thymidine glycol in human and rat urine: a possible assay for oxidative DNA damage. Proc. Natl. Acad. Sci. U.S.A. 81, 5633-5637. (11) Teebor, G., Cummings, A., Frenkel, K., Shaw, A., Voituriez, L., and Cadet, J. (1987) Quantitative measurements of the diastereoisomers of cis-thymidine glycol in gamma-irradiated DNA. Free Radical Res. Commun. 2, 303-309.
McNulty et al. (12) Te´oule, R., Bert, C., and Bonicel, A. (1977) Thymine fragment damage retained in the DNA polynucleotide chain after gamma irradiation in aerated solution. II. Radiat. Res. 72, 190-200. (13) Te´oule, R. (1987) Radiation-induced DNA damage and its repair. Int. J. Radiat. Biol. 51, 573-589. (14) Demple, B., and Linn, S. (1980) DNA N-glycosylase and UV repair. Nature (London) 287, 203-208. (15) Kow, Y. W., and Wallace, S. S. (1987) Mechanism of action of endonuclease III from Escherichia coli. Biochemistry 26, 82008206. (16) Ide, H., Kow, Y. W., and Wallace, S. S. (1985) Thymine glycols and urea residues in M13 DNA constitute replicative blocks in vitro. Nucleic Acids Res. 13, 8035-8052. (17) Hayes, R. C., and LeClerc, J. E. (1986) Sequence dependence for bypass of thymine glycols in DNA by DNA polymerase I. Nucleic Acids Res. 14, 1045-1061. (18) Basu, A. K., Loechler, E. L., Leadon, S. A., and Essigmann, J. M. (1989) Genetic effects of thymine glycol: site-specific mutagenesis and molecular modeling studies. Proc. Natl. Acad. Sci. U.S.A. 86, 7677-7681. (19) Lapsia, M. F., and Wallace, S. S. (1988) Excision repair of thymine glycols, urea residues, and apurinic sites in Escherichia coli. J. Bacteriol. 170, 3359-3366. (20) Clark, J. M., and Beardsley, G. P. (1986) Thymine glycol lesions terminate chain elongation by DNA polymerase I in vitro. Nucleic Acids Res. 14, 737-749. (21) Clark, J. M., and Beardsley, G. P. (1987) Functional effects of cis-thymine glycol lesions on DNA synthesis in vitro. Biochemistry 26, 5398-5403. (22) Clark, J. M., Pattabiraman, N., Jarvis, W., and Beardsley, G. P. (1987) Modeling and molecular mechanical studies of the cisthymine glycol radiation damage lesion in DNA. Biochemistry 26, 5404-5409. (23) Clark, J. M., and Beardsley, G. P. (1989) Template length, sequence context, and 3′-5′ exonuclease activity modulate replicative bypass of thymine glycol lesions in vitro. Biochemistry 28, 775-779. (24) Hayes, R. C., Petrullo, L. A., Huang, H., Wallace, S. S., and LeClerc, J. E. (1988) Oxidative damage in DNA: lack of mutagenicity by thymine glycol lesions. J. Mol. Biol. 201, 239-246. (25) Maccabee, M., Evans, J. S., Glackin, M. P., Hatahet, Z., and Wallace, S. S. (1994) Pyrimidine ring fragmentation products: effects of lesion structure and sequence context on mutagenesis. J. Mol. Biol. 236, 514-530. (26) Basu, A. K., Hanrahan, C. J., Malia, S. A., Kumar, S., Bizanek, R., and Tomasz, M. (1993) Effect of site-specifically located mitomycin C-DNA monoadducts on in vitro DNA synthesis by DNA polymerases. Biochemistry 32, 4708-4718. (27) Neet, K. E. (1983) In Contemporary Enzyme Kinetics and Mechanism (Purich, D. L., Ed.) pp 267-320, Academic Press, New York. (28) Abbotts, J., SenGupta, D. N., Zon, G., and Wilson, S. H. (1988) Studies on the mechanism of Escherichia coli DNA polymerase I large fragment. J. Biol. Chem. 263, 15094-15103. (29) Boosalis, M. S., Petruska, J., and Goodman, M. F. (1987) DNA polymerase insertion fidelity: Gel assay for site-specific kinetics. J. Biol. Chem. 262, 14689-14696. (30) Randall, S. K., Eritja, R., Kaplan, B. E., Petruska, J., and Goodman, M. F. (1987) Nucleotide insertion kinetics opposite abasic lesions in DNA. J. Biol. Chem. 262, 6864-6870. (31) Mendelman, L. V., Petruska, J., and Goodman, M. F. (1990) Base mispair extension kinetics. J. Biol. Chem. 265, 2338-2346. (32) Lowe, L. G., and Guengerich, F. P. (1996) Steady-state and presteady-state kinetic analysis of dNTP insertion opposite 8-oxo7,8-dihydroguanine by Escherichia coli polymerase I exo- and II exo-. Biochemistry 35, 9840-9849. (33) Kao, J. Y., Goljer, I., Phan, T. A., and Bolton, P. H. (1993) Characterization of the effects of a thymine glycol residue on the structure, dynamics, and stability of duplex DNA by NMR. J. Biol. Chem. 268, 17787-17793. (34) Kung, H. C., and Bolton, P. H. (1997) Structure of a duplex DNA containing a thymine glycol residue in solution. J. Biol. Chem. 272, 9227-9236. (35) Gervais, V., Guy, A., Te´oule, R., and Fazakerley, G. V. (1992) Solution conformation of an oligonucleotide containing a urea deoxyribose residue in front of a thymine. Nucleic Acids Res. 20, 6455-6460. (36) Kuchta, R. D., Benkovic, P. A., and Benkovic, S. J. (1988) Kinetic mechanism whereby DNA polymerase I (Klenow) replicates DNA with high fidelity. Biochemistry 27, 6716-6723.
In Vitro Replication of cis-Thymine Glycol and Urea Residue (37) Shibutani, S., Takeshita, M., and Grollman, A. P. (1997) Translesional synthesis on DNA templates containing a single abasic site. A mechanistic study of the “A rule”. J. Biol. Chem. 272, 13916-13922. (38) Johnson, K. A. (1993) Conformational coupling in DNA polymerase fidelity. Annu. Rev. Biochem. 62, 685-713. (39) Johnson, K. A. (1995) Rapid quench kinetic analysis of polymerase, adenosine triphosphates, and enzyme intermediates. Methods Enzymol. 249, 38-61. (40) Shibutani, S., and Grollman, A. P. (1993) On the mechanism of frameshift (deletion) mutagenesis in vitro. J. Biol. Chem. 268, 11703-11710.
Chem. Res. Toxicol., Vol. 11, No. 6, 1998 673 (41) Latham, G. J., McNees, A. G., De Corte, B., Harris, C. M., Harris, T. M., O’Donnel, M., and Lloyd, R. S. (1996) Comparison of the efficiency of synthesis past single bulky DNA adducts in vivo and in vitro by the polymerase III holoenzyme. Chem. Res. Toxicol. 9, 1167-1175. (42) Hoffmann, J.-S., Pillaire, M.-J., Lesca, C., Burnouf, D., Fuchs, R. P. P., Defais, M., and Villani, G. (1996) Fork-like DNA templates support bypass replication of lesions that block DNA synthesis on single-stranded templates. Proc. Natl. Acad. Sci. U.S.A. 93, 13766-13769.
TX970225W
