6450
J. Phys. Chem. 1992, 96, 6450-6457
Resonance Raman Spectra of Electronlcally Excited, Water-Soluble Copper( I I ) Porphyrins Bound to Oligonucleotides: Possibility of Translocation from a GC to an AT
Gary D.Strahan, Dongsheng Lu, Masamichi Tsuboi, and Kazuo Nakamoto* Department of Chemistry, Marquette University, Milwaukee, Wisconsin 53233 (Received: December 5, 1991; In Final Form: March 24, 1992)
Resonance Raman (RR) spectra of a series of water-soluble copper(I1) porphyrins mixed with DNA and syntheticoligonucleotides were measured by using CW and pulsed laser excitation. In CW excitation (406.7 and 441.6 nm), all the porphyrins mixed with these nucleic acids exhibit porphyrin core vibrations near 1570 and 1368 cm-I. Upon pulsed laser excitation (416 and 436 nm), some porphyrins mixed with nucleic acids containing ATAT sites exhibit extra bands at 1550 and 1346 cm-I, which originate in the transient exciplex formulated as Cu(porphyrin)*+(AT)-. Under proper experimental conditions,the populations of the ground-state porphyrins and the corresponding exciplexes become nearly equal. In the case of GC/CG intercalating porphyrins, this result suggests that some of these porphyrins are translocated from GC/CG to ATAT sites upon electronic excitation by pulsed laser. Three experiments were carried out, which supported the concept of translocation: (1) A typical GC/CG intercalator, Cu(TMpy-P4), was mixed with a 32-mer containing 26 possible GC/CG intercalation sites and only one ATAT site at the molar ratio of one porphyrin per two duplexes. Under these conditions, most of the porphyrins in their electronic ground states are expected to be intercalated at GC/CG sites. Yet, this solution exhibits a RR spectrum in which the exciplex bands are slightly stronger than the ground-state bands. (2) After Cu(TMpy-P4) was mixed with the 32-mer as in (l), a well-known AT site binder, Co(TMpy-P4), was added to the solution to block any unoccupied ATAT sites. Analysis of the pulsed laser RR spectrum of this solution reveals that at least 32% of the total porphyrin has been translocated from the GC/CG to an ATAT site. (3) The pulsed laser RR spectrum of Cu(TMpy-P4)-DNA at -85 *C indicates that the intensities of the exciplex bands have decreased markedly relative to those at room temperature. This observation suggests that some degree of molecular rearrangement is required to form the exciplex. Finally, the time scale of such translocatioin has been estimated and the biological significance of exciplex formation discussed. Observations have also been made regarding the enhanced photodegradation of DNA caused by this exciplex.
Introduction Intercalation of the water-soluble porphyrin H2(TMpy-P4), tetrakis(4-N-methylpyridyl)porphinate,into DNA was first discovered by Fie1 et al.’J Since that time, the binding of these porphyrins, and their metal derivatives (Figure l), to nucleic acids has been studied by a variety of techniques including electronic absorption, circular dichroism, thermodynamic and kinetic ~ t u d i e s ,flow ~ . ~ di~hroism,~ fluorescence,6 ESR,’ NMR,*-l0 RR (resonance(Raman),11J2 and Viscometry and unwinding of DNA.I3 These studies demonstrated that planar (four-coordinated) porphyrins [M = H2, Cu(II), and Ni(II)] are selectively intercalated at GC or CG sites, while porphyrins having axial ligands (H20) [M = Zn(II), Co(III), Fe(III), and Mn(III)] are bound nonintercalatively at AT or TA sites of DNA. Recently, a resonance Raman (RR) study was performed on the effect of pulsed laser illumination on the interaction of Cu(TMpy-P4) with nucleic acidsi4 This study demonstrated that at high laser powers, Cu(TMpy-P4) exhibits two extra bands at 1550 and 1346 cm- when mixed with DNA or poly(dA-dT), but not when mixed with poly(dG-dC). These extra bands were not seen with C W or low-power pulsed excitation. They were attributed to an electronically excited Cu(TMpy-P4) molecule that was stabilized by forming an exciplex with the AT or TA site of DNA. This exciplex was suggested to be a *-cation radical, Cu(TMpyP4)*+(AT)-, which reversibly returns to the ground state Cu(TMpy-P4). l 4 The nature of this exciplex has been further examined by a t w w l o r pump-probe experiment,Is which revealed that the extra bands at 1550 and 1346 cm-’ have a RR excitation profile with a peak near 430 nm. In other words, the Soret band of this transient complex is only slightly red-shifted from that of the ground-state Cu(TMpyP4) (located near 426 nm). This result was interpreted as suggesting another possibility, that the transient species which produces the extra Raman bands may be a ground-state, metastable charge-transfer (CT) complex, which is formed from an exciplex through internal conversion, rather than the exciplex it~e1f.l~ In any case it is now quite clear that
Cu(TMpy-P4) forms a transient exciplex with an AT or a TA site of the DNA. Therefore, the terms “exciplex”, “chargetransfer complex”, and “transient species” will be used somewhat interchangeably in this paper. In the present study, we have attempted to establish structural requirements for the formation and stabilization of the exciplex. The questions that are addressed are what kind of porphyrin, what base sequence(s) of DNA, and what kind of binding geometry are essential to form the exciplex? To answer these questions, we have systematically varied the structure of the porphyrin and the nucleic acid sequence. The porphryins that were studied vary only in their steric characteristics without substantial differences in their electronic properties or solubilities. Thus, any differences in their binding mode and site originate from their molecular structures. Likewise, the nucleic acid sequences were varied so as to alter the available binding modes and sites. Most importantly, we have carried out detailed studies on the mechanism of and time required for exciplex formation. Observations were also made regarding the long-term photodegradation of DNA caused by such an exciplex formation. Some of the results obtained are suggestive of a mechanism of hematoporphyrin phototherapy as will be mentioned in the last part of this paper. Experimental Section
The copper(I1) porphyrins were prepared as described in a previous paper.16 Samples were prepared by mixing an aqueous metalloporphyrin solution with a solution of the respective nucleic acid, keeping the molar ratio (R) of the base pairs/porphyrin at about 30. The final porphyrin concentrations were approximately 1X M, and the final nucleic acid concentrations were about 3 X lo4 M (in base pairs). The experiments involving the 32-mer, however, had a molar ratio of R = 64, where the nucleic acid concentration was 6.4 X lo4 M in base pairs. All porphyrin concentrations were determined spectrophotometrically by using published c values.’J6 The extinction coefficients of the nucleic acids were obtained either directly from the literature” or were estimated from empirically derived rules for oligonucleotide se-
0022-365419212096-6450%03.00/0 0 1992 American Chemical Society
Cu( 11) Porphyrins Bound to Oligonucleotides
The Journal of Physical Chemistry, Vol. 96, No. 15, 1992 6451
-CP
1300
1400
1500
1600
RAMAN SHIFT (cm.’) Figure 2. Resonance Raman spectra of Cu(porphyrin)-DNA complexes (4 16-nm excitation).
(TMAP)
R1
R2
D
R3
R4
O;(CHl),
Figure 1. Structure of water-soluble copper(I1) porphyrins (M (11)).
* Cu-
quences.’* All sample solutions contained a sodium phosphate/sodium chloride buffer (pH 6.8). The final ionic strength was 0.2 M. The calf thymus DNA was purchased from Sigma (St. Louis, MO) and purified according to literature method^.^ The alternating polynucleotides, poly(dG-dC), poly(dA-dT), and polydApolydT, were purchased from Pharmacia LKB Biotechnology Inc. (Piscataway, NJ) and used without further purification. All of the self-complementary oligonucleotides,with the exception of d(CGTACG), were purchased either from Synthecell Corp. (Rockville, MD) or Pharmacia Inc. as a purified product (gel electrophoresis) and used as received. The hexadeoxyribonucleotide, d(CGTACG), was prepared and purified according to the manner previously p~b1ished.l~ The exciplex RR spectra were obtained by using the 41 6- and 436-nm lines, generated by Raman shifting (H2) the third and second harmonics, respectively, of a Quanta Ray DCR-3G Nd:YAG laser (duration, 8 ns; repetition, 20 Hz), coupled with a Spex 1403 double monochromator and a Spex DMlB computer. Ground-state (nonexciplex) Raman spectra were obtained by using the 406.7-nm line of a Coherent Model 100 Kr+ laser or the 441.&nm lime of a Liconix He:Cd laser. The average laser powers at the sample were 15-20 mW, regardless of the laser source. Using pulsed excitation powers that are higher than this did not, in general, increase the exciplex population, except in the case of the 32-mer (vide infra). Except where indicated, all samples were maintained at room temperature. In addition, all experiments were performed by using a spinning cell and 135O scattering geometry. The high peak power of the pulsed laser can easily photodecompose the sample as well as damage the sample cell. Hence, the laser light was only loosely focused on the sample (the sampling region was about 1.5 mm3). Measurements of RR spectra at -85 OC were performed by using a low-temperature spinning cell as described elsewhere?O The laser powers used were increased to -30 mW in order to compensate for losses due to multiple glass surfaces used in the cell. Results and Discussion Effect of Porphyrin Structure. We reported previously14that, upon pulsed laser excitation at 426 nm, Cu(TMpy-P4)-DNA
TABLE I: Binding Modes of Water-Soluble Copper(I1) Porphyrinsu Cu(wrDhvrin) wlvldG-dCI wlv(dA-dT) DNA .. .. -. Cu(TMpyP4) Int (strong) GB Int(GC) >> GB(AT) Cu(TMpy-P3) Int (strong) GB Int(GC > GB(AT) CuiTrij Int (weak). GB/OB Int(GC) + (GB/OB)(AT) Cu(TMAP) Int (medium) GB Int(GC) + GB(AT) Cu(TMpy-PZ) O.B. GB [GB/OBI(AT) Cu(cis) O.B. GB/OB [GB/OB](AT) Cu(trans) O.B. GB/OB [GB/OB)(AT) 1
I
I
.
I
.
“Int = Intercalation; GB = groove-binding; OB = outside-binding. For DNA, the preferred site is indicated in parentheses.
exhibits two extra bands at 1550 (C@-Castretch) and 1346 cm-l (C,-N stretch), which are attributed to the charge-transfer complex, Cu(TMpy-P4)*+(AT)-. Figure 2A shows the RR spectrum of this solution obtained by 416-nm excitation. In this work, the structure of the porphyrin was systematically varied in order to understand the structural requirements for the formation of the transient chargetransfer complex mentioned earlier. The various structurally-related Cu-porphyrins used in this investigation (Figure 1) have been previously studied and found to have slightly different preferred modes of interaction (Table I).1J6,2’ The different binding modes are primarily caused by differences in the size of the substituent on the R group (the pyridyl or phenyl ring) and the location of the positive charge on the R group. Some of these porphyrins are able to intercalate partially by inserting a part of the porphryin core between the DNA bases, while most of the pyridyl or phenyl rings stick out of the helix.** The size of the R group is very important since it determines how closely the porphyrin can approach the DNA helix in the case of groove-binding. By examining Figure 2 and Table 11, one can see that, to varying degrees, most of the different types of porphyrins can form the exciplex in question. Tables I and I1 show that those porphyrins that are known to strongly intercalate or groove-bind are the same ones that give strong transient bands, whereas those that bind weakly, by either groove- or outside-binding, produce transient bands that are significantly weak. Although many factors are involved in the formation and stabilization of the exciplex, the trend found in the exciplex band intensities clearly parallels the binding mode of the ground-state porphyrin. In all these porphyrins, the overriding factor for the formation of the exciplex is the ability of the porphyrin to get close enough to the nucleic acids to form a chargetransfer complex. This ability is determined primarily by the R group on the porphyrin, as discussed above. For example, Cu(TMpy-P2) is unable to form a stable exciplex,
6452 The Journal of Physical Chemistry, Vol. 96, No. 15, I992
Strahan et al.
+ d(OCATATATCJC1,
I
1300
.
I
+~(~c~c~cATAT~c~c~c),
1400
1500
1600
RAMAN SHIFT (cm.1) Figure 3. Resonance Raman spectra of Cu(TMpy-P4)-nucleic acid complexes. All the spectra were obtained by using a pulsed laser excitation at 416 nm except for the top spectrum (CW 406.7-nm excitation).
although it does not appear to be significantly more bulky than Cu(TMpy-P4). Since Cu(TMpy-P2) has its N+-CH3 group in the ortho position, the rotation of the pyridyl group is restricted such that a close approach to the bases is not p~ssible.~ It may also be that the location of the positive charge is not favorable for Coulombic interaction with the charged phosphate backbone of the DNA. Effect of the Nucleic Acid Binding Site. Figure 3 shows the FtR spectra of Cu(TMpyP4) mixed with a variety of nucleic acids. We have shown previously14that the presence of AT or TA sites is necessary for the formation and stabilization of the chargetransfer complex. This is seen again in the present data (Figure 3B-D), as those complexes formed from the nucleic acids containing AT or TA sites give the strongest transient bands (Table 11). The origin of this site preference has been attributed to the energetic coincidenceof the highest occupied orbital of the porphyrin and the lowest vacant orbital of thymine.14 In fact, barely any intensity in the exciplex bands is observed with poly(dG-dC) (Figure 3E). Not only is the presence of AT sites necessary for the formation of the exciplex, but also the number of adjacent sites is even more imporrant. The intensities of the transient bands increase sharply from a single TA to a double ATAT sequence, but their intensities do not continue to increase by lengthening the sequence to ATATAT (Figure 3F-H). Those complexes formed with d(CGTACG)2, having but a single TA site, had band intensities that were much weaker than those found in other oligonucleotides containing ATAT sites. On the other hand, when all of the porphyrins were required to groove-bind, as in the case of poly(dA-dT), the band intensities were the strongest. Why is the number of AT sites important? A simple calculation reveals that these porphyrins have a diameter of about 15 A. Assuming the B-DNA structure, which has base pairs occurring at every 3.4 A, the porphyrin diameter corresponds to about 4.4 bases along the DNA axis. Thus, it would require a little more than 4 base units for a porphyrin to bind in the major groove. Model-building studies show that the porphyrin can bind in a “faceon” manner in the major groove but can only bind edgewise in the minor groove. Figure 4 shows a schematic diagram of such a face-on binding proposed by Fie1 et al.23 This configuration is stabilized by ionic interactions between the DNA phosphate backbone and the positive charges on the pyridine rings. Some
Cu(I1) Porphyrins Bound to Oligonucleotides
/e
The Journal of Physical Chemistry, Vol. 96, No. 15, 1992 6453
1
1
I3*O
PUMPONLY
/)
I
R A M A N SHlliT ( c d ) 1390
Figure 5. Time delay experiments to estimate the lifetime of the Cu(TMpy-P4)-DNA exciplex. Figure 4. Schematic diagram of major and minor groove-bindings (adapted from ref 23).
of us24have shown previously that the POz group vibrations of DNA show marked downshifts (18-26 cm-’)when Co(TMpy-P4) and Mn(TMByP4) are groove-bound to DNA. Thus, we conclude that Coulombic interaction in the major groove is the primary mode of binding that is capable of stabilizing these transient species. It has been suggestedzsthat groove-bound porphyrins deform the helical structure at AT regions, as observed by Dattagupta et al. for the external or groovebindingdrug irehdiamine.26 Since GC base-pair regions are more rigid and stable relative to AT base-pair r e g i o n ~ , ~the ~ ~deformations ~* required to stabilize a groove-bound molecule are more difficult to achieve in poly(dGdC). The use of poly(dA).poly(dT) in the formation of the complex further substantiates the major-groove-bindingmodel of the exciplex. The greatest difference between this sequence and that of poly(dA-dT) is in their secondary structures: Poly(dA)*poly(dT)has a secondary structure that is more limited in conformational flexibility than p ~ l y ( d A - d T ) . ~Therefore, ~ porphyrins can not easily bind in the major groove of poly(dA)*poly(dT). Consequently, the intensities of the transient bands resulting from this complex (Figure 3D) are less than one-third of those found with poly(dA-dT) (Figure 3C). Finally, although it is not included in Table 11, no transient bands occur when Cu(TMpyP4) is mixed with deoxyadenosine, thymidine, or a mixture of the two. This verifies that there needs to be some way to “hold” the porphyrin near the bases to form a stable chargetransfer complex. Time -le of the Transient Species. A one-color (416 nm), pumpprobe experiment on Cu(TMpy-P4)-DNA was performed by using a 35-11s delay in order to ascertain the order of magnitude of the exciplex lifetime. As seen in Figure 5 , the transient band intensity has gone to zero (within experimental limits) after this delay. Thus the lifetime is shorter than 35 ns. According to a recent two-color, pumpprobe experiment by Chinsky et al.,15the lifetime of the exciplex observed in Cu(TMpy-P4)-poly(dA-dT) is shorter than 20 ns. It should be noted, however, that their system involves only groovebinding followed by a chargetransfer process. M e d ” of Exciplex Fonnatioa. One rather puzzling aspect of the formation of this exciplex lies in the fact that Cu(TMpy-P4) is known to intercalate into GC or CG sites when mixed with
DNA313 (see Table I), yet when this same solution is excited with a pulsed laser, it produces transient bands even though this requires groove-bindingat the ATAT site. Excitation profile studies by Chinsky et al.15 suggest that the absorption spectrum of the excited-state porphyrin is only slightly red-shifted from that of the ground-state porphyrin. In this work, we observed that, when the laser power (436 nm excitation) is varied, the loss (gain) in intensities of the excited-state bands at 1550 and 1346 cm-’is offset approximately by the equivalent gain (loss) in intensities of the ground-state bands at 1570 and 1367 cm-I, while the intensities of the remaining porphyrin bands are almost unchanged. It is, therefore, reasonable to assume that, at 436-nm excitation, the Raman cross sections of the two excited-state bands mentioned above do not differ appreciably from those of the corresponding ground-state bands. However, the spectra obtained by 416-nm excitation (Figure 3) underrepresent the relative population of the exciplex, since this excitation is farther from the maximum of its RR excitation profile but close to that of the ground state. Thus, the spectra such as Figure 3B,C indicate that the population of the exciplex is at least comparable to, and may even exceed, that of the ground state, under the experimental conditions used for these experiments. How can the two populations be comparable if the ground-state species is preferentially intercalated? There are three possible resolutions to this logical quandary. The first is that the premise of preferential intercalation is incorrect. That is to say that the many studies on Cu(TMpy-P4)-DNA binding1-” have grossly underestimated the percentage of nonintercalated species. For example, two recent paper~~O*~I present data implying that some related porphyrins (containing different metal ions) are not preferential in their ground-state binding. However, these studies did not examine the Cu-porphyrins at issue in this work. This is crucial, since these are the only porphyrins known to be able to form the exciplex. On the other hand, Feng and P i l b r o ~ have ~~ demonstrated that all available absorption data on the binding of these porphyrins is best fit to a theoretical model in which intercalation is favored over outside-bindingby a factor of -60. Thus, at the present time, there is no justification in discarding the substantial evidence supporting preferential ground-state intercalation of Cu(TMpy-P4). The second explanation is that these porphyrins are able to move from an intercalated GC site to a groove-bound ATAT site upon electronic excitation. To our knowledge, such a phenomenon has not been reported previously. The third explanation is that although the porphyrin itself does
Strahan et al.
6454 The Journal of Physical Chemistry, Vol. 96, No. 15. 1992 TABLE 111: Band Shifts of Cu(TMw-P4) u w n Interaction with Nucleic ~~
I, 1006 cm'l,
band
~
11, 100 cm-I, V, 1258 cm-I, VI, 1367 cm-' VIII, 1571 cm-l, IX, 1646 cm-I,
Cu(TMpy-P4) + AA, nm 3'% H u(C,-C,) 6(CB-H) v(C,-pyr) v(C,-N) v(C,dp) &pyr) DNA +6 18 +0.7 +5.1 -2.6 +0.4 +0.4 -1.5 +0.8 +6.8 -2.3 +1.6 +16 35 +1.7 -0.9 poly(dG-dC) +4.4 +9 30 +0.4 -2.4 -0.8 +1.4 -1.1 d(CGTACG)2 d(GCGCGCATATCGCGCG)z -0.5 +5.4c -1.9 d +1.W -1.8 32-mer +11 40 +0.5 +5.8 -2.5 +1.0 +l.2 -1.5 +0.2 +3 -2 -1 .o -1.5 -0.5 -0.1 -2.2 poly(dA-dT) 'v = stretching; 6 = bending; pyr = N-methylpyridyl; C,, C,, and C, are designated as in Figure 1. The data for DNA, poly(dG-dC), and poly(dA-dT) are from ref 12, while the data for d(CGTACG)2are from ref 19. bThe ratio (R) of [base pairs]/[porphyrin] was about 30 for all solutions, except for d(CGTACG)2,where R = 3, and for the 32-mer, where R = 64. 'This band broadens upon mixing with this nucleic acid sequence. "This band does not shift, but upon mixing its several sidebands vanish, and the band-width greatly narrows. Complexation to DNA apparently limits the number of possible conformations to only one mode. This is consistent with an intercalative binding mechanism. 1367 f+,
cr\ 350
400
450 500 WAVELESGTH Inm)
550
CUP + 32-mer
1570
C: CUP + COP + %?-mer(1:2:2) D: COP
600
Figure 6. Abrption spectra of Cu(TMpyP4) alone (A) and that mixed with the 32-mer (B).
not move, a long-range transfer of charge can occur in which an electron travels along the DNA axis to an ATAT site where it is stabilized. This last case seems unlikely since it is difficult to imagine why four base pairs (ATAT) would be required to stabilize the charge. In order to resolve this issue, three sets of experiments were performed. In the first experiment, Cu(TMpyP4) was mixed with an oligonucleotide that contained predominantly GC/CG sites, but only one ATAT site, and its absorption and Raman spectra were measured. This oligonucleotide was the 32-mer, d-
(GCGCGCGCGCGCGCATATGCGCGCGCGCGCGC)Z. AS stated earlier, most of the previous investigations indicate that Cu(TMpyP4) preferentially binds a t GC/CG sites when the nucleotide contains both GC/CG and AT/TA sites. Furthermore, there is evidence that all of the Cu(TMpy-P4) (within experimental error) is bound to poly(dGdC) when mixed at a ratio of 30-70 base pairs per porphyrin m~lecule.~ Therefore, we chose the ratio of the 32-mer to the porphyrin as two duplexes per one porphyrin (or a ratio of 64 base pairs per porphyrin, R = 64). The "neighbor exclusion rule" does not need to be invoked at such concentration levels, as statistically only one of every two duplexes can have a porphyrin bound to it. In addition, each duplex has 26 possible intercalation sites (14 GC and 12 CG sites) but only one groovebinding site (ATAT). Under such conditions, most of the porphyrin is expected to be intercalated at the GC/CG sites. Even if the binding modes are nonpreferential, the porphyrin has only one chance of groove-binding in the 27 different binding sites, or about a 3.7% chance. The absorption spectrum of Cu(TMpy-P4) mixed with the 32-mer (Figure 6)shows a definite red shift (+11 nm) and hypochromicity (40%) of the porphyrin Soret band. This is consistent with an intercalative binding mode and correlates well with the changes found when this porphyrin is mixed with poly(dG-dC), but not with poly(dA-dT) (see Table III).3 Likewise, the RR spectra measured using a CW laser (for the ground-state species) indicate that the pattern and magnitude of the band shifts are
1320
1400
1520
1600
RAMAN SHIFT (cm-l) Figure 7. Resonance Raman spectra of (A) Cu(TMpy-P4) mixed with
the 32-mer (416-nm excitation); (B) the same solution (436-nm excitation); (C) the same solution as (B) except that, after the solution was equilibrated, Co(TMpy-P4) was added with a concentration equal to that of the 32-mer duplex; (D) Co(TMpy-P4) alone (436-nm excitation);(E) difference spectrum (C-D). certainly much closer to those found in a mixture with poly(dG dC) than to those with poly(dA-dT) (Table 111). These results clearly show that, in the ground state, the majority of Cu(TMpy-P4) is bound to the GC/CG sites of the 32-mer via an intercalative mechanism. Upon excitation with the resonant pulsed laser, however, the transient bands appear with significant intensities (Figure 7), indicating the existence of the groove-bound exciplex. As shown previously,15the intensities of the exciplex bands are maximized by excitation near 430 nm. Thus, the increases in intensities of the exciplex bands in going from 416-nm excitation (Figure 7A) to 436-nm excitation (Figure 7B) are self-explanatory. Interestingly, it was necessary to increase the laser power from 20 to 30 mW in order to "izethe intensities of the exciplex bands of the 32-mer. This indicates that it is more difficult to form an exciplex with this 32-mer. Such a power dependence is not expected when the majority of the porphyrins are already groove-bound at ATAT sites. If the latter were the case, the porphyrins would have no need to move upon electronic excitation and the power necessary for excitation would have been independent of the percentage of groove-binding sites. The fact that an increase in power is required for the 32-mer is consistent
Cu(I1) Porphyrins Bound to Oligonucleotides with a model in which the excited-state species is repetitively excited and changes its binding site. The longer the chain and the fewer the groove-binding sites, the more difficult it becomes for such a porphyrin to find a groove-binding site. This is s u p ported by the observation that, as the percentage of GC/CG sites increases, the intensities of the exciplex bands with 416-nm excitation decreases (Figure 3 and Table 11). As stated earlier, the populations of the ground- and excited-state porphyrins can be estimated approximately based on relative intensities of their RR bands. From Figure 7B, we find that about 58% of the porphyrin has been converted into the exciplex at the ATAT site. However, these porphyrins consist of two types: those already at the ATAT site in the ground state and those translocated from the GC/CG to ATAT sites by electronic excitation. To determine the ratio of these two types, we performed a second set of experiments in which the Cu(TMpyP4) was mixed with the 32-mer at the same ratio as above (R = 64) and allowed to equilibrateova about an hour. Any unoccupied groovebinding sites were then blocked by adding a well-known AT site binder Co(III)(TMpy-P4), at a ratio of one Co(TMpy-P4) per duplex (or twice the concentration of the Cu(TMpyP4)). It is well established that Co(TMpy-P4) is only capable of groove-binding at the AT/TA site because it is axially ligated by H20.3 After allowing the solution to sit at room temperature for another hour, the RR spectrum was measured (Figure 7C). Sice Co(TMpy-P4) is known to form a fairly stable groove-bound complex, there is probably insufficient driving force to dissociate Co(TMpy-P4) from the ATAT site, unless Cu(TMpyP4) can migrate from the GC site and displace it. The contribution of Co(TMpyP4) to the intensities of the 1367- and 1570-cm-' bands was determined by measuring the RR spectrum of a free Co(TMpyP4) solution of identical concentration with identical laser power (Figure 7D). Since previous work2*has shown that the electronic absorption and RR spectra of Co(TMpyP4) mixed with nucleic acids are only slightly different from that of Co(TMpyP4) alone, this RR spectrum should be nearly the same as that for the mixture of Co(TMpyP4) with 32-mer. The difference spectrum (Figure 7E) should therefore represent the approximate percentage of Cu(TMpyP4) that has already been groove-bound in the ground state: We estimate this to be no more than about 26%. Possible origins of errors include incomplete blocking of groove-binding sites by Co(TMpyP4) and the intercalation of Cu(TMpyP4), which may distort the helix enough to lower the binding efficiency of Co(TMpyP4). Both of these would result in more unoccupied ATAT sites than predicted and allow more Cu(TMpy-P4) to move there upon pulsed laser excitation, thereby producing more intense exciplex bands. A comparison of parts B and E of Figure 7 suggests that at least 32% (=58% - 26%) of the porphyrins must move from the GC to ATAT site upon resonant excitation. When the laser power was increased to 140 mW, no significant change in band intensiites was observed and no significant photodecomposition could be detected. This indicates that these two types of Cu(TMpyP4) are in a dynamic equilibrium state. A third set of experiments was performed to determine if movement of the porphyrin is necessary to form the exciplex or if a long-range transfer of charge can occur without the movement of the porphyrin. In these experiments the samples, Cu(TMpyP4) DNA and Cu(TMpyP4) poly(dA-dT), were frozen at ca. -85 OC, while being spun in an NMR spinner. The sample was frozen quickly by immersing it in liquid N2, and it was not irradiated with the laser until after the temperature of the sample cell was stabilized. Care was taken to ensure that the sample was receiving nearly the same amount of power in the frozen state as in the liquid state. It was found that, at temperatures below about -70 OC,local warming due to high peak power of the laser was not a significant problem. In order to further ensure that the sample did not melt and refreeze in the time span of the scan (about 40 s), the sample cell was moved slightly between each scan so that a fresh portion of the sample was probed each time. The reproducibility of the spectral intensities (even over much longer times) gave reassurance that no local warming occurred or that a low-temperature steady state was achieved. Figure 8
+
+
The Journal of Physical Chemistry, Vol. 96, No. 15, 1992 6455 I
"
"
I
"
"
I
"
"
1
"
"
Cu(TMpyP4) + DNA
Room Temperature
Room Temperature
1300
1400
1500
RAMAN SHIFT (cm.')
1600 1300
1400
1500
16W
RAMAN SHIR
Fwe 8. Resonance Raman spectra of Cu(TMpy-P4) mixed with DNA and poly(dAdT) at room temperature and -85
O C
(416-nm excitation).
shows that the intensities of the exciplex bands are greatly decreased for complexes with both DNA and poly(&-dT); however, those with DNA are affected to a slightly greater extent (- 10%). It would be informative to measure the temperature dependence of RR intensities of both solutions in order to determine the potential energy barriers associated with the exciplex formation. Unfortunately, such attempts were not successful due to the laser-induced local warming at more moderate temperatures. However, a higher energy threshold would be expected for the DNA mixture, as here the porphyrin needs to translocate itself from the GC to AT site to form the exciplex. Since a long-range transfer of charge (due only to the movement of an electron) would not be highly temperature sensitive, one is obliged to find a structural explanation. One suggestion is that as the sample is cooled, the porphyrin in the groove is frozen at a greater distance from the DNA bases than it normally is at room temperature. However, because the solutions are rapidly frozen, any such conformational change would be small. Another suggestion is that the exciplex is most stable when the porphyrins are even closer to the helix than they are under usual groovebinding conditions (in the ground state). Stated differently, some degree of molecular rearrangement is required to form the exciplex, regardless of whether the ground-state molecule is intercalated or groove-bound. The combined results of these three sets of experiments provide evidence that strongly supports the idea that some kind of molecular rearrangement does occur upon electronic excitation and that the distance moved is sufficiently large to make a difference in the population of the exciplex. For mixtures with DNA, the fmt step in translocation is deintercalation. Since these porphyrins are only partially intercalated,22the distance required for deintercalation is only a fraction of the diameter of the porphyrin. Time Required for "location. A natural question that arises at this point is regarding the time scale of such a rearrangement process. At least three molecular species of Cu(TMpyP4) must be postulated in the process: So, the ground-state molecule intercalated in the GC portion of DNA; B, Soret excited state produced by the 436-nm laser irradiation; and E, the exciplex or a transient complex now in question, which is formed from the Soret excited state (B). They are related with one another as shown in Figure 9, and their concentrations are given as d[SO]/dt = -kp[SO1 + kb[Bl + k[E1 (1) d[B]/dt = kp[S,] - kb[B] - kqB] (2) d[E]/dt = kqB] - k,[E] (3) where kp, kbrk,, and k'are the rate constants. The pumpprobe experiments clearly show that the lifetime of the exciplex is shorter than can be measured (less than 35 or 20 ns). Thus,the population of the exciplex must build up to a maximum during the time of the laser pulse (8 ns) and then decay rapidly. Since these experiments were performed with laser powers yielding the maximum
6456 The Journal of Physical Chemistry, Vol. 96, No. 15, 1992
..
1
Figure 9. Kinetics of photochemical process.
possible exciplex formation, it is unlikely that the exciplex population would continue to ramp upward after the end of the laser pulse. We assume, therefore, that the population of the exciplex closely follows the shape of the laser pulse. This is the same as assuming that the laser pulse duration is long in comparison to both the formation time and the lifetime of the exciplex. A reasonable approximation of this behavior is to assume that the steady state is reached during the time of laser pusle, so that d[S,]/dt = d[B]/dt = d[E]/dt = 0 (4) Under our experimental conditions, B species could not be detected. The energy-level structure and photodynamics of Cu(TMpy-P4) are not yet well-known. For Cu-tetraphenylporphyrin (CuTPP), however, these were studied in detail by Harriman.” The lifetime of its Soret excited state is very short (“picoseconds), and it decays nonradiatively down to another energy level. In CuTPP, the Q-singlet level is also of short lifetime, and it is converted rapidly into the “tripmultiplet” states before it gives fl~orescence.’~ Similar to the case of CuTPP, we were not able to detect fluorescence of Cu(TMpy-P4), which would be assignable to the Q(m*) ground state transition. It was possible, however, to estimate an upper limit of the quantum yield of this fluorescence (
