Resveratrol-Loaded Liquid-Crystalline System Inhibits UVB-Induced

Article pubs.acs.org/jnp

Resveratrol-Loaded Liquid-Crystalline System Inhibits UVB-Induced Skin Inflammation and Oxidative Stress in Mice Andressa T. Fujimura,† Renata M. Martinez,‡ Felipe A. Pinho-Ribeiro,§ Amélia M. Lopes Dias da Silva,⊥ Marcela M. Baracat,‡ Sandra R. Georgetti,‡ Waldiceu A. Verri, Jr.,§ Marlus Chorilli,*,† and Rubia Casagrande*,‡ †

Departamento de Ciências Farmacêuticas, Universidade Estadual Paulista-UNESP, Rodovia Araraquara-Jaú, Km 01, 14.801-902 Araraquara, São Paulo, Brazil ‡ Departamento de Ciências Farmacêuticas, Universidade Estadual de Londrina-UEL, Avenida Robert Koch, 60, Hospital Universitário, 86039-440 Londrina, Paraná, Brazil § Departamento de Ciências Patológicas, Universidade Estadual de Londrina-UEL, Rodovia Celso Garcia Cid, Km 380, PR445, Cx. Postal 10.011, 86057-970 Londrina, Paraná, Brazil ⊥ Centro de Investigaçaõ e Tecnologia de Ciências Agro-ambientais e Biológicas (CITAB), Universidade de Trás-os-Montes e Alto Douro (UTAD), Quinta de Prados 1013, P-5001-801 Vila Real, Portugal ABSTRACT: Evidence shows beneficial effects of resveratrol (RES) on human health. However, its poor aqueous solubility limits therapeutic effectiveness. Thus, the use of nanostructured delivery systems for RES, such as a liquid-crystalline system (LCS), could be viable. The purpose of this study was to develop, characterize, and determine the in vivo effectiveness of a RES-loaded LCS. We studied an LCS containing silicon glycol copolymer, polyether functional siloxane, and the polymeric dispersion carbomer homopolymer type B (C974) in the ratio 20:55:25 with and without RES. Results obtained using polarized light microscopy, small-angle X-ray scattering, and rheology analysis showed that the RES-loaded LCS system presents a lamellar structure and behaves as a non-Newtonian fluid presenting pseudoplastic (the apparent viscosity decreases as the stress increases) and thixotropic (the apparent viscosity decreases with the duration of stress) behaviors. Cytotoxicity studies showed that the formulation components are noncytotoxic. Topical application of a RES-loaded LCS protected hairless mice from UVB-irradiation-induced skin damage by inhibiting edema, neutrophil recruitment, lipid hydroperoxide and superoxide anion production, gp91phox mRNA expression, and oxidative stress. The RES-loaded LCS maintained 2,2′-azinobis(3ethylbenzothiazoline-6-sulfonic acid) (ABTS) and ferric reducing abilities, catalase activity, reduced glutathione levels, and mRNA expression of glutathione peroxidase 1 and glutathione reductase. The RES-loaded LCS also up-regulated matrix metalloproteinase-9 activity, IL-10 production, and mRNA expression of transcription factor Nrf2 and heme oxygenase-1. Therefore, a RES-loaded LCS is a promising new therapeutic approach to mitigate skin photodamage.

S

(Gpx).7 The transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) is involved in glutathione synthesis and elimination of ROS, providing a protective function against oxidative stress. Thus, enhancing the activation of Nrf2 is considered as a rational approach for chemoprevention,8 and exogenous supplementation of antioxidants may be an effective strategy for reversing the deleterious effects of UVB-induced ROS generation. Resveratrol (trans-3,4′,5-trihydroxystilbene; referred to as RES), a phytoalexin found in grapes, red wine, and fruits, is a potent antioxidant and anti-inflammatory agent.9−21 It has been reported that RES induces activation of Nrf222−24 and increases the viability of human keratinocyte cells after UV exposure by

kin exposure to external agents can cause serious damage and contribute to the development of several skin disorders. Solar ultraviolet B (UVB) irradiation is the main triggering factor for the development of skin diseases.1 Excessive UVB irradiation induces reactive oxygen species (ROS) production, which, in turn, causes detrimental consequences to tissue, including inflammation, lipid peroxidation (LPO), and immunosuppression.2,3 UVB irradiation has been linked to increased incidence of skin cancer around the world.4 Superoxide anion (O2•−) production is a critical event for the onset of oxidative stress conditions.5,6 During UVB exposure, NADPH oxidase 2 (NOX 2) subunit gp91phox represents an important source of O2•−. Excessive UVB irradiation exposure depletes endogenous antioxidants in the skin, such as catalase, reduced glutathione (GSH), and glutathione peroxidase © XXXX American Chemical Society and American Society of Pharmacognosy

Received: December 18, 2015

A

DOI: 10.1021/acs.jnatprod.5b01132 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

up-regulating Nrf2.25 However, one of the biggest problems related to RES is its low bioavailability in vivo when administered orally, since the peak plasma level decreases rapidly.26,27 Thus, the topical administration of RES may be a convenient route for its delivery at the inflammatory foci. On the other hand, limited aqueous solubility decreases its topical therapeutic effectiveness since it has low skin penetration.28 Technological strategies can improve the low efficiency and allow the controlled release of active principles.29 A liquidcrystalline system (LCS) has properties of a crystalline solid and an isotropic liquid. An LCS is a suitable carrier of active molecules in topical formulations since it shelters the active molecule, sustains drug release, has low cost, can be produced on an industrial scale, and is a transparent system.30 The aim of this work was to develop and characterize a RESloaded LCS. A RES-loaded LCS was prepared using the association of silicones as oil phase and surfactant. Most importantly, we demonstrate that the RES-loaded LCS has in vivo anti-inflammatory action and can protect against oxidative stress caused by UVB irradiation in hairless mice.

clear and translucent predominance regions on the pseudoternary phase diagram showing a distinct transition from a translucent low-viscosity system (TLVS), transparent liquid system (TPLS), transparent viscous system (TPVS), translucent viscous system (TVS), and transparent low-viscosity system (TPLVS). Furthermore, transparent or translucent viscous system formation and low-viscosity transparent or translucent system formation was observed over a wide-ranging diagram. This feature is important since we aimed to develop a nanostructured system for topical application. Therefore, a certain flow resistance for formulations is interesting to facilitate skin product application. The studied formulation is composed of 55% surfactant, 20% oil phase, and 25% water phase, and it is demonstrated on a pseudoternary phase diagram (Figure 1). Polarized Light Microscopy. Isotropic and anisotropic materials can be distinguished by polarized light microscopy. A dark field characterizes isotropic material under polarized light. Anisotropic material has optical properties that change with the orientation of the incident light in nonequivalent directions. The liquid-crystalline lamellar and hexagonal mesophases are anisotropic and are identified respectively by Maltese crosses and stretch marks. Cubic mesophases and microemulsions are classified as isotropic and are identified by the presence of a dark field.31 The representative photomicrographs shown in Figure 2A (a.1 and a.2) show a characteristic lamellar liquidcrystalline mesophase marked by Maltese crosses. The structure of the LCS was not altered by RES addition. Small-Angle X-ray Scattering (SAXS). Further SAXS studies were performed to confirm the lamellar structure. The results were plotted from the intensity of the scattering patterns (I) versus the scattering vector modulus q (deg A−1). The curves of the SAXS data are shown in Figure 2B for both the unloaded LCS and RES-loaded LCS. To determine the type of structure present in the samples, the positions of the peaks (q1 and q2) were noted, and the ratio between q2 was calculated as a function of the position of the first peak (q1). The data of Figure 2B form two peaks with correlation distances of 1:2. From the values obtained, we were able to infer the presence of the lamellar mesophase.32 Regardless of the presence of RES, the SAXS patterns show a broad and intense peak, characteristic of lamellar liquid-crystalline structure. These results are in agreement with the polarized light microscopy presented in Figure 2A, demonstrating the structural organization of the lamellar phase of the system. Rheological Analysis. The flow properties of the unloaded LCS and RES-loaded LCS are shown in Figure 2C. The formulations behave as non-Newtonian fluids since the upward flow curve is not formed by a straight line, not passes through the origin, and also its shear rate and shear stress values are not constant.33 Due to nonlinearity between the shear stress and the shear rate, the formulations behave as a pseudoplastic fluid (the apparent viscosity decreases as the stress increases).34,35 Furthermore, the formulations share a thixotropic (the apparent viscosity decreases with the duration of stress) timedependent behavior, because the descending curves do not overlap the ascending curves. Thus, there is a hysteresis area suggesting that the material needs a longer time to recover its initial structure.36,37 The hysteresis area is strongly influenced by the presence of the liquid-crystalline structure; that is, the higher the hysteresis area, the higher will be the microstructuring of the LCS networks. The thixotropic behavior observed is related to the

■

RESULTS AND DISCUSSION Phase Behavior Studies. A phase diagram provides an overview of where phase transitions may occur. 30 A pseudoternary phase diagram was constructed using the oil phase (silicon glycol copolymer), surfactant (polyether functional siloxane), and water phase (polymer dispersion carbomer homopolymer type B (C974) to 0.5%) (Figure 1). There are

Figure 1. Pseudoternary phase diagram for systems containing polyether functional siloxane, PFS (S), silicon glycol copolymer, SGC (O), and purified water (W). TLVS = translucent low-viscosity system; TPLS = transparent liquid system; TPVS = transparent viscous system; TVS = translucent viscous system; TPLVS = transparent low-viscosity system; PS = phase separation region. B



Article

Figure 2. Characterization of a resveratrol (RES)-loaded liquid-crystalline system (LCS). (A) Photomicrograph obtained by polarized light microscopy of the recently prepared unloaded LCS (a.1) and RES-loaded LCS (a.2). (B) Small-angle X-ray scattering patterns of samples of RESunloaded LCS and RES-loaded LCS. (C) Rheological behavior of the RES-unloaded LCS and RES-loaded LCS. (D) Frequency sweep profile of storage modulus (G′), loss modulus (G″), and viscosity (n*) as a function of the frequency of samples of RES-unloaded LCS and RES-loaded LCS.

Figure 3. Liquid crystalline system (LCS) components do not affect cellular viability. Cytotoxicity using Caco-2 (A and B) and SV-80 (C and D) cells treated with titrated concentrations of a dispersion of carbomer homopolymer type B (C974 [Carbopol]), silicon glycol copolymer (DC 193 [SGC]), and polyether functional siloxane (DC 5329 [PFS]) during 1 (A and C) and 24 (B and D) hours.

structure can be easily recovered as the shear rate decreases. It is interesting to note that this pseudoplastic behavior is favorable for future use of this formulation since the application

strength of the interaction between all the components present in the formulations. Thus, this structure can be destroyed simultaneously with increasing shear rate. However, this initial C



Article

on the skin involves high shear rates, which cause a “shear thinning” due to deinterlacing formulation polymer chains. However, on withdrawing this external force, the initial viscosity is recovered again, increasing the sample permanence time on the skin.38 The RES-loaded LCS formulation flux curves show that the presence of the RES does not alter its nonNewtonian behavior with characteristic thixotropic and pseudoplastic behaviors. The oscillatory rheological data are displayed as storage modulus (G′) and loss modulus (G″) as a function of the frequency in Figure 2D. The storage modulus is a measure of the energy stored and represents the solid-like component of a viscoelastic material. The loss modulus is a measure of the energy dissipated per cycle and represents the liquid-like component. The storage modulus is large when a sample is predominantly elastic or highly structured.31 The frequency sweep analysis suggests that the unloaded LCS is more viscous and less elastic above 10 Hz. On the other hand, the RESloaded LCS is more viscous at all selected frequencies, because G″ > G′. Moreover, there was a decrease in viscosity of the LCS upon RES addition (Figure 2D). LCS Components are Noncytotoxic. The results indicate that the formulation components exhibited a cellular viability of more than 80% (Figure 3). Thus, cytotoxicity studies performed with Caco-2 and SV-80 cells showed that the LCS components are noncytotoxic, rendering the RES-loaded LCS eligible for evaluation of in vivo efficacy against skin inflammation and oxidative stress caused by UVB irradiation. RES-Loaded LCS Reduces UVB-Irradiation-Induced Edema and Myeloperoxidase (MPO) Activity in the Skin of Hairless Mice. Exposure of skin to UVB irradiation causes induction of inflammation with recruitment of inflammatory cells and edema formation.39 As shown in Figure 4A, UVB irradiation induced a significant increase of skin

duced skin edema and MPO activity at a dose of 2 mg per mouse compared to 5.7 mg per mouse in the previous study.13,40 Second, acetone increases the skin permeability, suggesting that the use of acetone as vehicle might have influenced the effectiveness of RES. However, acetone is not a suitable vehicle for topical treatment of humans because it promotes skin dryness and barrier disruption.41 Recently, RES liposomes at a dose of 0.23 mg/cm2 also reduced low-dose UVB-induced skin edema.42 Therefore, although the experimental conditions and aims of the studies regarding topical treatment with the RES varied, making difficult a comparison, the present data together with previous evidence13,40,42 support the rationale of topical treatment with RES to reduce UVBirradiation-induced skin inflammation. Neutrophils are the first cells recruited to inflammatory sites, where they produce large amounts of pro-inflammatory mediators such as reactive oxygen species.43 UVB irradiation significantly elevated MPO activity (indirect marker of neutrophil counts) in comparison with the nonirradiated control group. In agreement with the edema results (Figure 4A), treatment with the RES-loaded LCS significantly inhibited MPO activity in the skin (Figure 4B). Again, no effect was observed in mice treated with unloaded LCS. Supporting our results, the effect of RES on reducing MPO activity was described in other models.16−18,44 Neutrophils induce tissue lesions and amplify the inflammatory response by further producing pro-inflammatory molecules. Therefore, the reduction of UVB-irradiation-induced neutrophil recruitment by the RES-loaded LCS might account for reduced skin inflammation and tissue damage. RES-Loaded LCS Increases Matrix Metalloproteinase 9 (MMP-9) Activity and Up-Regulates IL-10 Production in the Skin of Hairless Mice after UVB Exposure. Neutrophils and keratinocytes produce MMPs, which are enzymes primarily related to degradation of skin collagen and components of the elastic fiber network. MMPs serve a dual role by potentiating the destruction of skin structures45 as well as tissue remodeling and neovascularization.46 Herein, as well as in other studies,39,47,48 UVB irradiation induced a significant increase in MMP-9 activity (Figure 5A). Interestingly, the RES-loaded LCS displayed a more pronounced increased in MMP-9 activity (Figure 5A). In another model, RES increased the activation and expression of MMP-9.49 Moreover, as inflammatory cells need to cross the extracellular matrix during skin repair following UV irradiation, it is possible that the increase in MMP activity might reflect a shift toward skin healing.47 IL-10 is a classic immunoregulatory and anti-inflammatory cytokine.50,51 IL-10 was shown to limit MPO activity in tissue exposed to inflammation and oxidative stress.51 On the basis of this evidence, we investigated whether the RES-loaded LCS treatment modulates IL-10 production after UVB exposure. We found that the RES-loaded LCS significantly increased IL-10 production compared to the nonirradiated control group (Figure 5B), implying that the RES-loaded LCS can exert its anti-inflammatory effect by enhancing IL-10 production. Corroborating the present data, RES up-regulates IL-10 production in LPS-activated microglia.15 RES-Loaded LCS Prevents UVB Irradiation-Induced Decrease of Antioxidant Capacity and Lipid Peroxidation in Skin. Increased production of ROS following exposure to UV irradiation decreases antioxidant defenses, causing detrimental consequences, including inflammation and LPO.3 Results of 2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)

Figure 4. Resveratrol (RES)-loaded liquid-crystalline system (LCS) reduces UVB-irradiation-induced skin edema and myeloperoxidase (MPO) activity in hairless mice. Skin edema (A) and MPO activity (B) were determined in samples collected 12 h after the end of irradiation. Bars represent means ± SEM of 5 mice per group per experiment and are representative of two independent experiments [*p < 0.05 compared to the nonirradiated control group (white bars); # p < 0.05 compared to the irradiated control groups (black bars)].

edema, which was significantly inhibited by treatment with the RES-loaded LCS. No effect was observed with the unloaded LCS. Similarly, topical application of RES (25 μmol/0.2 mL acetone per mouse) to hairless mice decreased UVBirradiation-induced skin edema.13 The comparison with this previous finding raises two important points. First, the current RES-loaded LCS formulation inhibited UVB-irradiation-inD



Article

Figure 5. Effects of a resveratrol (RES)-loaded liquid crystalline system (LCS) on matrix metalloproteinase-9 (MMP-9) activity and IL-10 production in the skin after UVB irradiation exposure. (A) MMP-9 activity was determined in samples collected 12 h after the end of irradiation. (B) IL-10 levels were determined in skin samples collected 4 h after the end of irradiation. Bars represent means ± SEM of 5 mice per group per experiment and are representative of two independent experiments [*p < 0.05 compared to the nonirradiated control group (white bars)].

(ABTS) radical scavenging capacity reflect the levels of the endogenous antioxidant GSH, while the ferric reducing antioxidant power (FRAP) assay correlates with the levels of antioxidants such as ascorbic acid, uric acid, and α-tocopherol.52 We observed that UVB irradiation induced a significant decrease of ABTS and ferric reducing abilities of the skin compared to the nonirradiated control group (Figure 6A and B). The RES-loaded LCS inhibited UVB-irradiation-induced reduction of FRAP and ABTS, maintaining antioxidant capacity similar to the control group (nonirradiated) in both tests (Figure 6A and B). No effect was observed in mice treated with unloaded LCS. We also evaluated catalase activity, an important antioxidant enzyme that breaks down H2O2 into O2 and H2O.53 In the present study, the UVB irradiation was able to reduce significantly the catalase activity, and treatment with the RESloaded LCS significantly inhibited UVB-irradiation-induced catalase activity depletion (Figure 6C). Supporting this result, it has been reported that the treatment with RES restored the catalase activity to control values in oxidative stress in rat liver,14 neuroapoptosis in neuronal cells,54 nephrotoxicity in rabbits,19 diabetes in rats,20 and oxidative stress in gastrocnemius muscles of aged mice.21 The increase of UV-induced H2O2 generates the hydroxyl radical (HO•), which triggers chain LPO, a deleterious event associated with photo-oxidative stress.55 Herein, UVB irradiation induced skin LPO, which was significantly inhibited by the RES-loaded LCS to levels similar to nonirradiated controls (Figure 6D). These results are in agreement with other studies reporting that treatment with RES inhibits LPO.9−14 The unloaded LCS had no effect on UVB-irradiation-induced LPO. RES-Loaded LCS Inhibits UVB-Irradiation-Induced Superoxide Anion Production and gp91phox mRNA Expression in the Skin of Hairless Mice. UVB induces overproduction of ROS such as superoxide anion (O2•−), which is a substrate for generating HO•.56 NOX 2 subunit gp91phox

Figure 6. Resveratrol (RES)-loaded liquid crystalline system (LCS) application maintains antioxidant capacity and inhibits lipid peroxidation of skin after UVB irradiation exposure. Antioxidant capacity was measured using ABTS (A) and FRAP (B) assays in samples collected 12 h after the end of irradiation. (C) Catalase activity was determined in samples collected 2 h after the end of irradiation. (D) Lipid peroxidation was measured by a tert-butyl hydroperoxide (LOOH)-initiated chemiluminescence (QL) assay in samples collected 4 h after the end of irradiation. Bars represent means ± SEM of 5 mice per group per experiment and are representative of two independent experiments [*p < 0.05 compared to the nonirradiated control group (white bars); #p < 0.05 compared to the irradiated control groups (black bars)].

represents an important source of UVB-induced O 2 •− production.57 As shown in Figure 7A, UVB irradiation significantly increased O2•− production, and this increase was inhibited by the RES-loaded LCS. Moreover, as shown in Figure 7B, it is likely that this reduction of O2•− production in the skin by the RES-loaded LCS might be, at least in part, related to the inhibition of UVB-irradiation-induced gp91phox mRNA expression. No effect was observed in mice treated with the unloaded LCS. Corroborating the present data, RES has been shown to inhibit mRNA58,59 and protein expression levels58,60 of gp91phox in other disease models as well as UVBirradiation-induced inflammation.57 RES-Loaded LCS Maintains Glutathione System Components after UVB Irradiation Exposure in the Skin of Hairless Mice. Several ROS-eliminating systems are present in tissues to protect cells from ROS overproduction as occurs after UVB radiation exposure. For example, glutathione peroxidase-1 (Gpx1) removes ROS-related products and oxidizes GSH to GSSG during this process, while glutathione reductase (Gr) regenerates GSH from GSSG.61 However, excessive UVB irradiation exposure depletes endogenous antioxidants in the skin.62 In this study, UVB irradiation E



Article

Figure 7. Resveratrol (RES)-loaded liquid-crystalline system (LCS) inhibits UVB-irradiation-induced superoxide anion production and gp91phox expression. (A) Superoxide anion production was measured by the nitroblue tetrazolium (NBT) reduction assay in samples collected 2 h after the end of irradiation. (B) Expression of gp91phox mRNA in skin was measured by qPCR 4 h after the end of irradiation. Bars represent means ± SEM of 5 mice per group per experiment and are representative of two independent experiments [*p < 0.05 compared to the nonirradiated control group (white bars); #p < 0.05 compared to the irradiated control groups (black bars)].

exposure significantly decreased the GSH levels (Figure 8A) and led to lower mRNA expression of Gpx1 (Figure 8B) and Gr (Figure 8C) in skin compared to the nonirradiated control group. On the other hand, topical treatment with the RESloaded LCS maintained basal levels of GSH protein and mRNA expression of Gpx1 and Gr in the skin of UVB-irradiated mice (Figure 8). Similarly, RES increased the GSH contents and protein expression of the Gpx1 and Gr enzymes on human coronary artery endothelial cell damage induced by hydrogen peroxide.63 The unloaded LCS had no effect on UVBirradiation-induced reduction of GSH levels or mRNA expression of either Gpx1 or Gr (Figure 8). RES-Loaded LCS Up-Regulates Nuclear Factor Erythroid 2-Related Factor 2 and Heme Oxygenase-1 (HO-1) mRNA Expression in the Skin of Hairless Mice. The redoxsensitive transcription factor Nrf2 plays a key role in regulating induction of antioxidant enzymes such as Gpx1, Gr, and catalase.64−66 Thus, activation of Nrf2 is considered to be an important molecular target of many chemoprotective agents. Furthermore, inhibition of Nrf2 activity potentiates UVBirradiation-induced skin damage.8 As shown in Figure 9A, UVB irradiation significantly reduced Nrf2 mRNA expression in the skin. On the other hand, treatment with the RES-loaded LCS inhibited UVB-irradiation-induced reduction of Nrf2 mRNA expression in the skin. Moreover, the RES-loaded LCS enhanced Nrf2 mRNA expression in the skin compared to the nonirradiated control group (Figure 9A). Corroborating these results, RES-treated human keratinocytes present an increase of Nrf2 mRNA expression upon UVB irradiation.25 Additionally, in other disease models RES also induces the activation of Nrf2.22−24 HO-1 is an inducible protein that requires transcription via Nrf2 activation. HO-1 is essential to maintaining cellular resistance during stress conditions,67 and enhancing HO-1 expression is a promising therapeutic approach to inhibit skin damage after irradiation exposure.68 We observed that UVB irradiation induced a significant increase of HO-1 mRNA expression in the skin, and RES-loaded LCS induced an even more pronounced HO-1 mRNA expression in the skin (Figure 9B). These data are in agreement with published findings from

Figure 8. Resveratrol (RES)-loaded liquid crystalline system (LCS) maintains glutathione system components after UVB irradiation exposure. (A) Reduced glutathione (GSH) levels were measured in samples collected 12 h after the end of irradiation. Expression of (B) glutathione peroxidase 1 (Gpx1) and (C) glutathione reductase (Gr) mRNA in the skin was measured by qPCR 4 h after the end of irradiation. Bars represent means ± SEM of 5 mice per group per experiment and are representative of two independent experiments [*p < 0.05 compared to the nonirradiated control group (white bars); # p < 0.05 compared to the irradiated control groups (black bars)].

Figure 9. Effects of resveratrol (RES)-loaded liquid crystalline system (LCS) in nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) expression in the skin after UVB irradiation exposure. (A) Nrf2 and (B) HO-1 mRNA expression were evaluated by qPCR from skin samples collected 4 h after the end of irradiation. Bars represent means ± SEM of 5 mice per group per experiment and are representative of two independent experiments [*p < 0.05 compared to the nonirradiated control group (white bars); ##p < 0.05 compared to the irradiated control groups (black bars) and nonirradiated control group (white bars)].

F



Article

polarized light. A Jenamed, Carl Zeiss microscope was used to analyze several fields of each sample at room temperature using 20× magnification. The isotropic or anisotropic behavior of the samples was noted. Small-Angle X-ray Scattering. The nanometric structure of the phases was studied by SAXS measurements. Data were collected at the Synchrotron SAXS beamline of the National Laboratory of Synchrotron Light (LNLS, Campinas, Brazil), equipped with an asymmetrically cut and bent Si (1 1 1) monochromator (λ = 1.608 Å) that yields a horizontally focused beam. A vertical position-sensitive Xray detector and a multichannel analyzer were used to record the SAXS intensity, I(q), as a function of the modulus of the scattering vector q; q = (4π/λ) sin(ε/2), ε being the scattering angle. The parasitic scattering produced by slits was subtracted from the total scattering intensity. Rheological Analysis. Formulation rheograms were obtained using an AR200EX rheometer (TA Instruments; Wood Dale, IL, USA) with cone−plate 40 mm geometry with a gap of 200 mm and constant temperature of 32 °C. The rheological properties of the systems were evaluated by continuous flow rheological analysis and oscillatory rheological analysis. For the test, samples were carefully applied to the bottom plate, trying to ensure minimum possible shear of the formulation. At continuous flow rheological analysis was made as a study of shear stress versus shear rate in the region from 0 to 30 s−1. Oscillatory rheological analysis was performed over the frequency range 0.1−100 Hz at a constant stress of 1 Pa. The assay was performed in triplicate. Cytotoxicity. The cytotoxicity of the formulation components was evaluated by the Alamar Blue (AB) assay, which measures cellular metabolic activity. The AB assay is based on the conversion of the blue nonfluorescent dye resazurin, which is converted by mitochondrial and other enzymes to the pink fluorescent resorufin. Cells were added with formulation components plus 10 μL/well of AB. The absorbance was read at 570 and 620 nm after an additional 1 and 24 h. The number of viable cells correlates with the magnitude of dye reduction and is expressed as percentage of AB reduction.74 Animals and Experimental Protocol. In vivo experiments were performed in sex-matched hairless mice (HRS/J), weighing 20−30 g, obtained from the University Hospital of Londrina State University. Mice were maintained with free access to water and food and temperature of 23 ± 2 °C. They were housed in cages with a 12 h light/12 h dark cycle. Animal care and handling procedures were approved by the Animal Ethics Committee (registered under the number CEUA 273/12, process number 25664.2012.35) of the Londrina State University. Hairless mice were randomly assigned to different groups with 5 mice each: nonirradiated control, irradiated control, irradiated and treated with unloaded LCS, irradiated and treated with RES-loaded LCS. All experiments were performed twice; therefore, a total of 10 mice per group were used. Mice received topical treatment on the dorsal surface with 0.5 g of the formulation,48 12 h, 6 h, and 5 min before and 6 h after the irradiation session. Irradiation. The UVB source was a Philips TL/12 RS 40W (Medical-Holand) emitting a continuous spectrum between 270 and 400 nm with a peak emission at 313 nm. The lamp was mounted 20 cm above the mice, resulting in an irradiation of 0.384 mW/cm2 as measured by an IL 1700 radiometer (International Light; Newburyport, MA, USA) equipped with a sensor for UV (SED005) and UVB (SED240). The irradiation dose used for induction of oxidative stress was 4.14 J/cm2.39,75,76 All groups were irradiated simultaneously. Mice were terminally anaesthetized with 1.5% isoflurane (Abbott [Abbott Park, IL, USA]) at 12 h (Figures 4, 5A, 6A,B and 8A) or anesthetized followed by decapitation at 2 h (Figures 6C and 7A) or 4 h (Figures 5B, 6D, 7B, 8B,C, and 9) after the UVB exposure, and dorsal skin samples were collected. Samples were stored at −70 °C until analysis. Samples collected for cutaneous edema determination were weighed immediately after removal and were not frozen.39 Skin Edema. The skin edema analysis was performed by comparing the weight of the skin between groups, and the result was expressed in mg of skin.39,75,76

other laboratories demonstrating that RES up-regulates HO-1 expression via Nrf2-ARE (antioxidant responsive elements) signaling.22,69−71 In fact, Nrf2 induces HO-1 expression in the skin in response to oxidative stress, as we observed in the present study. In addition, IL-10 induces HO-1 in LPS-induced endotoxemia,72 and increased nuclear levels of Nrf2 were accompanied by high levels of IL-10.73 Therefore, it is possible that the enhancement of IL-10 production by the RES-loaded LCS (Figure 5B) may play a role in the induction of HO-1 mRNA expression. In the present study we developed a RES-loaded LCS compatible with the skin and nontoxic to cells. The nanostructured delivery system containing RES reduced the UVB-irradiation-induced oxidative stress (LPO, O2•−, and gp91phox mRNA expression) and depletion of antioxidant defenses (FRAP, ABTS, GSH, Gpx1, and Gr mRNA expression) as well as reduced skin inflammation (edema, neutrophil recruitment) together with an increase of IL-10 production and Nrf2 and HO-1 mRNA expression. These data suggest the RES-loaded LCS as a promising novel pharmaceutical form for the treatment of skin photodamage and, potentially, for other inflammatory and oxidative skin diseases in which excessive ROS production is involved.

■

EXPERIMENTAL SECTION

General Experimental Procedures. Resveratrol at 100% purity ́ was purchased from Galena Quimica e Farmacêutica (Campinas, Brazil). Polyether functional siloxane (PFS), DC 5329, and silicon glycol copolymer (SGC) DC 193 were purchased from Dow Corning (Midland, MI, USA). Carbomer homopolymer type B (Carbopol 974−C974) was purchased from Lubrizol do Brasil Aditivos Ltd.a. (São Paulo, Brazil). Brilliant blue R, reduced glutathione, hexadecyltrimethylammonium bromide, N-ethylmaleimide, o-dianisidine dihydrochloride, phenylmethanesulfonyl fluoride, 2,2′-azinobis(3-ethylbenzothiazoline-6-sulfonic acid), 5,5′-dithiobis(2-nitrobenzoic acid), 2,4,6-tris(2-pyridyl)-s-triazine, nitroblue tetrazolium, and bis(acrylamide) were obtained from Sigma-Aldrich (St. Louis, MO, USA). tert-Butyl hydroperoxide was purchased from Acros (Pittsburgh, PA, USA). Xylene cyanol and Tris were obtained from Amresco (Solon, OH, USA). The ELISA kit for determination of IL-10 was obtained from eBioscience (San Diego, CA, USA). Acrylamide, sodium dodecyl sulfate, glycerol, Superscript III, Oligo(dT)12−18 primers, Platinum SYBRGreen, and primers were purchased from Invitrogen (Carlsbad, CA, USA). All other reagents used were of pharmaceutical grade. Formulation Preparation. First, a C974 dispersion was prepared in a 5.0% (w/w) concentration. This polymer was suspended in MilliQ water. After complete solubilization, the pH was adjusted to 7.0 with triethanolamine. The ternary phase diagram was composed of SGC as the oil phase, the silicone PFS as surfactant, and the polymeric dispersion of carbomer homopolymer type B (C974) to 0.5% as the aqueous phase. Initially, 10% of the 5% polymer dispersion was mixed in water to yield a 0.5% final concentration. The systems were prepared by directly mixing the components at room temperature and homogenized using a glass rod for 10 min. The obtained systems containing different proportions of the components were characterized in a pseudoternary phase diagram in order to describe the proportions of the components forming the lamellar LCS. The proportions of each component were calculated from titrations of the binary mixtures of the oil phase and surfactant with water. The transitions from an opaque semisolid phase to a clear liquid system (CL), clear viscous system (CV), viscous translucent system (TV), liquid emulsion system (LEM), and viscous emulsion (VEM) and phase separation (PS) were delimited. The resveratrol incorporation was made in the oil phase. It was incorporated at 0.1% of the RES in the system. Polarized Light Microscopy. A drop of the sample was placed on a glass slide that was covered with a coverslip and then analyzed under G



Article

Inc.; San Diego, CA, USA). The bars in the figures indicate the mean values ± standard error of the mean (SEM) of 5 mice per group per experiment and are representative of two separate experiments. Results were considered significantly different when p < 0.05.

Myeloperoxidase Activity. The UVB-induced leukocyte migration to the skin of hairless mice was evaluated using the MPO colorimetric assay as described previously.39,75−77 The MPO activity of samples was compared to a standard curve of neutrophils. The results are presented as MPO activity (number of neutrophils per mg of skin). Analyses of Skin Proteinase by Substrate-Embedded Enzymography. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) substrate-embedded enzymography was used to detect enzymes with gelatinase activity. Assays were carried out as previously described.39,48,75,76 After electrophoresis, the gels were incubated for 1 h with 2.5% Triton X-100 under constant shaking, incubated overnight in 0.05 M Tris-HCl (pH 7.4) and 0.01 M CaCl2 at 37 °C, and stained the following day with Brilliant Blue R. After destaining in 20% acetic acid, the zones of enzyme activity were analyzed by comparing the groups with the ImageJ program (NIH; Bethesda, MD, USA). Cytokine Measurement. Skin samples were used to measure the IL-10 levels by an enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions (eBioscience).39,76,77 Absorbance was determined at 450 nm in a microplate spectrophotometer reader (Multiskan GO, Thermo Scientific; Waltham, MA, USA), and the results are expressed as picograms (pg) of cytokine/mg of skin. ABTS Assay. The ability to reduce the ABTS radical was measured by the decrease of absorbance at 730 nm.39,78 A curve of Trolox (0.01−20 nmol) was prepared, and the results are presented as nmol of Trolox equivalent per mg of skin. FRAP Assay. The reducing ability of skin samples was determined by the FRAP assay.39,78 A curve of Trolox (0.01−20 nmol) was prepared, and the results are presented as nmol of Trolox equivalent per mg of skin. Catalase Assay. The catalase activity was evaluated by measuring the decay in the concentration of hydrogen peroxide (H2O2) and the generation of oxygen as described previously.39,77 The catalase values were expressed as units of catalase/mg of skin/min. Lipid Hydroperoxides (LOOH). LOOH-initiated chemiluminescence was determined as described previously.39,77 The experiment was conducted at 30 °C for 120 min. The results were measured in counts per min (cpm) per mg of skin. O2•− Production. The measurement of O2•− production in the skin was performed using the nitroblue tetrazolium assay (NBT) as described previously.39,75 Reduction of NBT was measured at 620 nm using a microplate spectrophotometer reader, and the results are presented as optical density (OD) per 10 mg of skin. GSH Assay. GSH levels were determined as described previously.39,76 The standard curve was prepared with GSH (5−150 μM), and the results are presented as μM of GSH per mg of skin. Reverse Transcriptase (RT) and Quantitative Polymerase Chain Reaction (qPCR). Skin samples were homogenized in TRIzol reagent (Life Technologies; Carlsbad, CA, USA), and total RNA was isolated according to the manufacturer’s directions.39,75,77 RNA purity was confirmed by the 260/280 ratio. RT-qPCR was performed using the GoTaq 2-Step RT-qPCR system (Promega; Fitchburg, WI, USA) on a StepOnePlus real-time PCR system (Applied Biosystems; Foster City, CA, USA). The relative gene expression was measured using the comparative 2− (ΔΔCq) method. The expression of GAPDH mRNA was used as a control for tissue integrity in all samples. The primers used were: Gp91phox, sense: AGCTATGAGGTGGTGATGTTAGTGG, antisense: CACAATATTTGTACCAGACAGACTTGAG; Gpx1, sense: CCAACACCCAGTGACGACC, antisense: CTCAAAGTTCCAGGCAATGTC; Gr, sense: TGCGTGAATGTTGGATGTGTACCC, antisense: CCGGCATTCTCCAGTTCCTCG; Nrf 2, sense: TCACACGAGATGAGCTTAGGGCAA, antisense: TACAGTTCTGGGCGGCGACTTTAT; HO-1, sense: CCCAAAACTGGCCTGTAAAA, antisense: CGTGGTCAGTCAACATGGAT; and Gapdh sense: CATACCAGGAAATGAGCTTG, antisense: ATGACATCAAGAAGGTGGTG. Statistical Analysis. Data were statistically analyzed by one-way ANOVA followed by Tukey’s t test. Statistical analyses were performed using GraphPad Prism 4 software (GraphPad Software

■

AUTHOR INFORMATION

Corresponding Authors

*Tel (M. Chorilli): +55 16 33016960. E-mail: chorilli@fcfar. unesp.br. *Tel (R. Casagrande): +55 43 33712475. E-mail: rubiacasa@ yahoo.com.br. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by Brazilian grants from Cooŕ Superior denadoria de Aperfeiçoamento de Pessoal de Nivel ́ e (CAPES), Conselho Nacional de Desenvolvimento Cientifico Tecnológico (CNPq), Ministério da Ciência, Tecnologia e Inovaçaõ (MCTI), Secretaria da Ciência, Tecnologia e Ensino Superior (SETI), Fundaçaõ Araucária, Governo do Estado do Paraná, FAPESP ref Process: 2012/16956-3 and 2014/24180-0, and PADC (Programa de Apoio ao Desenvolvimento ́ Cientifico)-FCF-UNESP. We thank M. Tempesta Oliveira, D. Duarte, and C. Aparecida Lopes for their technical support to this research. The StepOnePlus real-time PCR system (Applied Biosystems) was purchased by FINEP funding (CT-INFRA 01/2013).

■

REFERENCES

(1) Mukhtar, H.; Elmets, C. A. Photochem. Photobiol. 1996, 63, 356− 357. (2) Afaq, F.; Katiyar, S. K. Mini-Rev. Med. Chem. 2011, 11, 1200− 1215. (3) Halliday, G. M. Mutat. Res., Fundam. Mol. Mech. Mutagen. 2005, 571, 107−120. (4) Chang, N.-B.; Feng, R.; Gao, Z.; Gao, W. Int. J. Hyg. Environ. Health 2010, 213, 359−368. (5) Anrather, J.; Racchumi, G.; Iadecola, C. J. Biol. Chem. 2006, 281, 5657−5667. (6) Circu, M. L.; Aw, T. Y. Free Radical Biol. Med. 2010, 48, 749− 762. (7) Afaq, F.; Adhami, V. M.; Mukhtar, H. Mutat. Res., Fundam. Mol. Mech. Mutagen. 2005, 571, 153−173. (8) Saw, C. L.; Yang, A. Y.; Huang, M. T.; Liu, Y.; Lee, J. H.; Khor, T. O.; Su, Z. Y.; Shu, L.; Lu, Y.; Conney, A. H.; Kong, A. N. Cell Biosci. 2014, 4, 39. (9) Sengottuvelan, M.; Deeptha, K.; Nalini, N. Chem.-Biol. Interact. 2009, 181, 193−201. (10) Ourique, G. M.; Finamor, I. A.; Saccol, E. M. H.; Riffel, A. P. K.; Pês, T. S.; Gutierrez, K.; Gonçalves, P. B. D.; Baldisserotto, B.; Pavanato, M. A.; Barreto, K. P. Reprod. Toxicol. 2013, 37, 31−39. (11) Sengottuvelan, M.; Senthilkumar, R.; Nalini, N. Biochim. Biophys. Acta, Gen. Subj. 2006, 1760, 1175−1183. (12) Yutani, R.; Teraoka, R.; Kitagawa, S. Chem. Pharm. Bull. 2015, 63, 741−745. (13) Afaq, F.; Adhami, V. M.; Ahmad, N. Toxicol. Appl. Pharmacol. 2003, 186, 28−37. (14) Kasdallah-Grissa, A.; Mornagui, B.; Aouani, E.; Hammami, M.; El May, M.; Gharbi, N.; Kamoun, A.; El-Fazaâ, S. Life Sci. 2007, 80, 1033−1039. (15) Cianciulli, A.; Dragone, T.; Calvello, R.; Porro, C.; Trotta, T.; Lofrumento, D. D.; Panaro, M. A. Int. Immunopharmacol. 2015, 24, 369−376. (16) Martín, A. R.; Villegas, I.; La Casa, C.; de la Lastra, C. A. Biochem. Pharmacol. 2004, 67, 1399−1410. H



Article

(17) Li, J.; Xie, C.; Zhuang, J.; Li, H.; Yao, Y.; Shao, C.; Wang, H. Mol. Med. Rep. 2015, 11, 1120−1126. (18) Abdin, A. A. Eur. J. Pharmacol. 2013, 718, 145−153. (19) Cigremis, Y.; Akgoz, M.; Ozen, H.; Karaman, M.; Kart, A.; Gecer, M.; Atalan, G. Can. J. Physiol. Pharmacol. 2015, 93, 727−735. (20) Aribal-Kocatürk, P.; Kavas, G. O.; Büyükkağnici, D. I. Biol. Trace Elem. Res. 2007, 118, 244−249. (21) Ryan, M. J.; Jackson, J. R.; Hao, Y.; Williamson, C. L.; Dabkowski, E. R.; Hollander, J. M.; Alway, S. E. J. Gerontol., Ser. A 2010, 65, 815−831. (22) Chen, C.-Y.; Jang, J.-H.; Li, M.-H.; Surh, Y.-J. Biochem. Biophys. Res. Commun. 2005, 331, 993−1000. (23) Rubiolo, J. A.; Mithieux, G.; Vega, F. V. Eur. J. Pharmacol. 2008, 591, 66−72. (24) Kode, A.; Rajendrasozhan, S.; Caito, S.; Yang, S.-R.; Megson, I. L.; Rahman, I. Am. J. Physiol. Lung Cell. Mol. Physiol. 2008, 294, L478− L488. (25) Liu, Y.; Chan, F.; Sun, H.; Yan, J.; Fan, D.; Zhao, D.; An, J.; Zhou, D. Eur. J. Pharmacol. 2011, 650, 130−137. (26) Ndiaye, M.; Philippe, C.; Mukhtar, H.; Ahmad, N. Arch. Biochem. Biophys. 2011, 508, 164−170. (27) Cottart, C.-H.; Nivet-Antoine, V.; Laguillier-Morizot, C.; Beaudeux, J.-L. Mol. Nutr. Food Res. 2010, 54, 7−16. (28) Yutani, R.; Morita, S.; Teraoka, R.; Kitagawa, S. Chem. Pharm. Bull. 2012, 60, 989−994. (29) Grill, A. E.; Johnston, N. W.; Sadhukha, T.; Panyam, J. Recent Pat. Drug Delivery Formulation 2009, 3, 137−142. (30) Chorilli, M.; Prestes, P. S.; Rigon, R. B.; Leonardi, G. R.; Chiavacci, L. A.; Sarmento, V. H. V; Oliveira, A. G.; Scarpa, M. V. Colloids Surf., B 2011, 85, 182−188. (31) Raman, I. A.; Suhaimi, H.; Tiddy, G. J. T. Adv. Colloid Interface Sci. 2003, 106, 109−127. (32) Djekic, L.; Primorac, M. Int. J. Pharm. 2008, 352, 231−239. (33) Oyafuso, M. H.; Carvalho, F. C.; Chiavacci, L. A.; Gremião, M. P. D.; Chorilli, M. J. Nanosci. Nanotechnol. 2015, 15, 817−826. (34) Oliveira, M. B.; Calixto, G.; Graminha, M.; Cerecetto, H.; González, M.; Chorilli, M. BioMed Res. Int. 2015, 2015, 396894. (35) Salmazi, R.; Calixto, G.; Bernegossi, J.; Ramos, M. A. D. S.; Bauab, T. M.; Chorilli, M. Int. J. Nanomed. 2015, 10, 4815−4824. (36) Calixto, G.; Yoshii, A. C.; Silva, H. R. e; Cury, B. S. F.; Chorilli, M. Pharm. Dev. Technol. 2015, 20, 490. (37) Carvalho, F. C.; Calixto, G.; Hatakeyama, I. N.; Luz, G. M.; Gremião, M. P. D.; Chorilli, M. Drug Dev. Ind. Pharm. 2013, 39, 1750−1757. (38) Bruschi, M. L.; Jones, D. S.; Panzeri, H.; Gremião, M. P. D.; de Freitas, O.; Lara, E. H. G. J. Pharm. Sci. 2007, 96, 2074−2089. (39) Martinez, R. M.; Pinho-Ribeiro, F. A.; Steffen, V. S.; Caviglione, C. V.; Vignoli, J. A.; Baracat, M. M.; Georgetti, S. R.; Verri, W. A.; Casagrande, R. J. Photochem. Photobiol., B 2015, 148, 145−153. (40) Reagan-Shaw, S.; Afaq, F.; Aziz, M. H.; Ahmad, N. Oncogene 2004, 23, 5151−5160. (41) Kamo, A.; Tominaga, M.; Negi, O.; Tengara, S.; Ogawa, H.; Takamori, K. J. Dermatol. Sci. 2011, 62, 64−66. (42) Sirerol, J. A.; Feddi, F.; Mena, S.; Rodriguez, M. L.; Sirera, P.; Aupí, M.; Pérez, S.; Asensi, M.; Ortega, A.; Estrela, J. M. Free Radical Biol. Med. 2015, 85, 1−11. (43) Rijken, F.; Bruijnzeel-Koomen, C. A. Clin. Pharmacol. Ther. 2011, 89, 120−124. (44) Cheng, L.; Jin, Z.; Zhao, R.; Ren, K.; Deng, C.; Yu, S. Int. J. Clin. Exp. Med. 2015, 8, 10420−10428. (45) Harper, J. I.; Godwin, H.; Green, A.; Wilkes, L. E.; Holden, N. J.; Moffatt, M.; Cookson, W. O.; Layton, G.; Chandler, S. Br. J. Dermatol. 2010, 162, 397−403. (46) Page-McCaw, A.; Ewald, A. J.; Werb, Z. Nat. Rev. Mol. Cell Biol. 2007, 8, 221−233. (47) Fonseca, Y. M.; Catini, C. D.; Vicentini, F. T. M. C.; Nomizo, A.; Gerlach, R. F.; Fonseca, M. J. V. J. Ethnopharmacol. 2010, 127, 596−601.

(48) Casagrande, R.; Georgetti, S. R.; Verri, W. A., Jr.; Dorta, D. J.; dos Santos, A. C.; Fonseca, M. J. J. Photochem. Photobiol., B 2006, 84, 21−27. (49) Gweon, E. J.; Kim, S. J. Oncol. Rep. 2013, 29, 826−834. (50) Verri, W. A.; Vicentini, F. T. M. C.; Baracat, M. M.; Georgetti, S. R.; Cardoso, R. D. R.; Cunha, T. M.; Ferreira, S. H.; Cunha, F. Q.; Fonseca, M. J. V; Casagrande, R. Stud. Nat. Prod. Chem. 2012, 36, 297−330. (51) Borghi, S. M.; Pinho-Ribeiro, F. A.; Zarpelon, A. C.; Cunha, T. M.; Alves-Filho, J. C.; Ferreira, S. H.; Cunha, F. Q.; Casagrande, R.; V, W. A., Jr Exp. Physiol. 2015, 100, 531. (52) Katalinic, V.; Modun, D.; Music, I.; Boban, M. Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 2005, 140, 47−52. (53) Chelikani, P.; Fita, I.; Loewen, P. C. Cell. Mol. Life Sci. 2004, 61, 192−208. (54) Bai, T.; Dong, D.-S.; Pei, L. Int. J. Mol. Med. 2013, 32, 819−826. (55) Girotti, A. W. J. Photochem. Photobiol., B 2001, 63, 103−113. (56) Gutteridge, J. M. FEBS Lett. 1986, 201, 291−295. (57) Hiramoto, K.; Kobayashi, H.; Yamate, Y.; Ishii, M.; Sato, E. F. Exp. Dermatol. 2012, 21, 911−914. (58) Yao, Y.; Li, J.; Niu, Y.; Yu, J.-Q.; Yan, L.; Miao, Z.-H.; Zhao, X.X.; Li, Y.-J.; Yao, W.-X.; Zheng, P.; Li, W.-Q. Mol. Med. Rep. 2015, 12, 6133−6139. (59) Yu, H.-P.; Hwang, T.-L.; Hwang, T.-L.; Yen, C.-H.; Lau, Y.-T. Crit. Care Med. 2010, 38, 1147−1154. (60) Zhu, W.; Chen, S.; Li, Z.; Zhao, X.; Li, W.; Sun, Y.; Zhang, Z.; Ling, W.; Feng, X. Nutr. Metab. 2014, 11, 35. (61) Masella, R.; Di Benedetto, R.; Varì, R.; Filesi, C.; Giovannini, C. J. Nutr. Biochem. 2005, 16, 577−586. (62) Fischer, T. W.; Kleszczyński, K.; Hardkop, L. H.; Kruse, N.; Zillikens, D. J. Pineal Res. 2013, 54, 303−312. (63) Sayin, O.; Arslan, N.; Guner, G. Acta Clin. Croat. 2012, 51, 227−235. (64) Chen, R. C.; Sun, G. B.; Wang, J.; Zhang, H. J.; Sun, X. B. Food Funct. 2015, 6, 1331. (65) Lee, J.-M.; Shih, A. Y.; Murphy, T. H.; Johnson, J. A. J. Biol. Chem. 2003, 278, 37948−37956. (66) Harvey, C. J.; Thimmulappa, R. K.; Singh, A.; Blake, D. J.; Ling, G.; Wakabayashi, N.; Fujii, J.; Myers, A.; Biswal, S. Free Radical Biol. Med. 2009, 46, 443−453. (67) Listopad, J.; Asadullah, K.; Sievers, C.; Ritter, T.; Meisel, C.; Sabat, R.; Döcke, W.-D. Exp. Dermatol. 2007, 16, 661−670. (68) Zhang, S.; Song, C.; Zhou, J.; Xie, L.; Meng, X.; Liu, P.; Cao, J.; Zhang, X.; Ding, W.-Q.; Wu, J. Radiat. Oncol. 2012, 7, 4. (69) Ungvari, Z.; Bagi, Z.; Feher, A.; Recchia, F. A.; Sonntag, W. E.; Pearson, K.; de Cabo, R.; Csiszar, A. Am. J. Physiol. Heart Circ. Physiol. 2010, 299, H18−H24. (70) Cheng, A.-S.; Cheng, Y.-H.; Chiou, C.-H.; Chang, T.-L. J. Agric. Food Chem. 2012, 60, 9180−9187. (71) Bhattarai, G.; Poudel, S. B.; Kook, S.-H.; Lee, J.-C. Acta Biomater. 2016, 29, 398. (72) Lee, T.-S.; Chau, L.-Y. Nat. Med. 2002, 8, 240−246. (73) Asghar, M.; George, L.; Lokhandwala, M. F. Am. J. Physiol. Renal Physiol. 2007, 293, F914−F919. (74) Al-Nasiry, S.; Geusens, N.; Hanssens, M.; Luyten, C.; Pijnenborg, R. Hum. Reprod. 2007, 22, 1304−1309. (75) Campanini, M. Z.; Pinho-Ribeiro, F. A.; Ivan, A. L.; Ferreira, V. S.; Vilela, F. M.; Vicentini, F. T.; Martinez, R. M.; Zarpelon, A. C.; Fonseca, M. J.; Faria, T. J.; Baracat, M. M.; Verri, W. A., Jr.; Georgetti, S. R.; Casagrande, R. J. Photochem. Photobiol., B 2013, 127, 153−160. (76) Ivan, A. L.; Campanini, M. Z.; Martinez, R. M.; Ferreira, V. S.; Steffen, V. S.; Vicentini, F. T.; Vilela, F. M.; Martins, F. S.; Zarpelon, A. C.; Cunha, T. M.; Fonseca, M. J.; Baracat, M. M.; Georgetti, S. R.; Verri, W. A., Jr.; Casagrande, R. J. Photochem. Photobiol., B 2014, 138, 124−133. (77) Martinez, R. M.; Pinho-Ribeiro, F. A.; Steffen, V. S.; Caviglione, C. V.; Vignoli, J. A.; Barbosa, D. S.; Baracat, M. M.; Georgetti, S. R.; Verri, W. A.; Casagrande, R. J. Nat. Prod. 2015, 78, 1647−1655. I



Article

(78) Campanini, M. Z.; Custodio, D. L.; Ivan, A. L.; Martins, S. M.; Paranzini, M. J.; Martinez, R. M.; Verri, W. A., Jr.; Vicentini, F. T.; Arakawa, N. S.; de J Faria, T.; Baracat, M. M.; Casagrande, R.; Georgetti, S. R. AAPS PharmSciTech 2014, 15, 86−95.

J


Resveratrol-Loaded Liquid-Crystalline System Inhibits UVB-Induced

Recommend Documents